César Marco Aurelio Jurado-Vargas a, *, José Cruz-de León b, José Tulio Mendez-Montiel c
a Universidad Michoacana de San Nicolás de Hidalgo, Facultad de Biología, Laboratorio de Investigación en Invertebrados, Ciudad Universitaria, Av. Fco. J. Mujica s/n, 58030 Morelia, Michoacán, México
b Universidad Michoacana de San Nicolás de Hidalgo, Facultad de Ingeniería en Tecnología de la Madera, Laboratorio de Conservación y Preservación de la Madera, Ciudad Universitaria, Av. Fco. J. Mujica s/n, 58030 Morelia, Michoacán, México
c Universidad Autónoma Chapingo, Dirección de Ciencias Forestales, Carretera Federal México-Texcoco Km 38.5, 56230 Texcoco, Estado de México, México
*Autor para correspondencia: cjurado@umich.mx (C.M.A. Jurado-Vargas)
A partir de un análisis morfológico y taxonómico de adultos del género Calymmaderus Solier, 1849 (Ptinidae: Dorcatominae), se describen y proponen 2 nuevas especies para el Neotrópico en México: C. robustus sp. nov. y C. semioblongus sp. nov. Ellas se distinguen de las 7 especies reportadas y reconocidas actualmente para México con base en su coloración, pubescencia y estrías elitrales laterales. Se describe la estructura genital de machos.
Two new Neotropical species of the genus Calymmaderus (Coleoptera: Ptinidae), associated to structural wood in Taretan, Michoacán, Mexico
Abstract
Through morphological and taxonomic analysis of adults of the genus Calymmaderus Solier, 1849 (Ptinidae: Dorcatominae), 2 new Neotropical species in Mexico are described and proposed: C. robustus sp. nov. and C. semioblongus sp. nov. They are distinguished from the 7 species currently reported and recognized for Mexico based on their coloration, pubescence and lateral elitral striae. The genital structure of males is described.
El género Calymmaderus incluye especies de escarabajos xilófagos de distribución mundial, para el cual se reconocen 89 especies americanas (Blackwelder, 1945; Lüer y Honour, 2017; Toskina, 2000; White, 1974, 1982, 1983, 1984), de las que 7 especies se encuentran en México: C. dejeani (Pic, 1905), C. donckieri (Pic, 1904), C. oblongus (Gorham, 1883), C. pupatus (Gorham, 1883), C. semirufus (Champion, 1913), C. sharpi (Gorham, 1886) y C. subvestitus (Champion, 1913) (White, 1983; Zaragoza et al., 2016). El estudio de las especies de este género es complicado debido a la falta de revisiones taxonómicas, lo limitado de sus descripciones diagnósticas y la carencia, en la mayoría de los casos de ilustraciones de los órganos genitales, estudio que le da mayor robustez a la determinación de especies (Bercedo et al., 2008; Lüer y Honour, 2017; Viñolas, 2018). Los miembros de Calymmaderus se distinguen de las demás especies de Ptinidae por su cuerpo alargado y oblongo, antenas con los 2 últimos segmentos de la clava estrechamente unidos, coxas protorácicas expuestas ventralmente, un lóbulo metasternal bifurcado que aloja al último segmento antenal cuando el cuerpo está en reposo y el número de suturas elitrales laterales (Arango, 2012; Español, 1992; White, 1971). Las especies de este género son de importancia económica al dañar la madera estructural de edificios históricos y bienes culturales. La especie más conocida en México es C. oblongus (Gorham, 1883), a la que varios autores señalan como asociada al deterioro de la madera (Bercedo et al., 2008; Cibrián et al., 1995; Jurado-Vargas, 2020; Jurado-Vargas y Cruz, 2010, 2020; Jurado-Vargas et al., 2003; Pichardo et al., 2017; White, 1974).
El presente estudio tiene como objetivo describir 2 especies nuevas de Calymmaderus, que fueron encontradas en la localidad de Taretan, Michoacán, México, ubicada en la Zona de Transición Mexicana, que es un área de alta diversidad y endemismos de artrópodos y presenta la mayor mezcla biótica entre elementos neárticos y neotropicales (Halffter, 2017). Ambas especies representan taxones morfológicamente diferentes a las especies descritas en la literatura conocida para este grupo. White fue el último investigador que publicó datos sobre especies de Calymmaderus y otros géneros de escarabajos de la familia Ptinidae americanas entre 1981 y 1984, dejando pendientes algunos ejemplares con estatus incierto aún por resolver. En este trabajo presentamos la descripción y propuesta de las 2 nuevas especies de Calymmaderus referidas.
Materiales y métodos
El área de estudio corresponde a la localidad de Taretan, Michoacán, México (1,140 m snm, 19°20’3.32” N, 101°55’3.02” O) (fig. 1), que presenta un clima cálido A (w), con precipitación media anual de 1,240 mm y temperatura media anual 25° C (INEGI, 2010).
Se recolectaron 463 ejemplares del género Calymmaderus de la techumbre de madera del templo de San Ildefonso por medio de 2 trampas de luz blanca, durante el periodo de emergencia de los adultos en los meses de junio-agosto del 2017 y 2018. Los ejemplares se fijaron en una solución de alcohol al 80%. La determinación de los ejemplares se realizó usando descripciones y claves de identificación para el género y especies de Calymmaderus (Arango, 2012; White,1971, 1974, 1982, 1983, 1984). En el proceso, la preparación de los órganos se realizó mediante la técnica de montaje permanente en laminillas con resina sintética (Gaviño et al., 2004).
La descripción de los caracteres morfológicos de los ejemplares adultos se realizó mediante un microscopio estereoscópico Nikon a 45 aumentos. Se obtuvieron imágenes de los ejemplares en posición dorsal, lateral y ventral, además de metasterno, abdomen y antenas, mediante un microscopio estereoscópico Carl Zeiss (modelo Axio Zoom V16). Las imágenes de las preparaciones de la estructura genital se lograron a través de un microscopio compuesto Marca Leica a 100 aumentos y una cámara Panasonic adaptada a la distancia focal del ocular. Para obtener detalles adicionales de la morfología externa de los ejemplares, se tomaron imágenes por medio del microscopio electrónico de barrido modelo JSM-6400.
Se determinaron las medidas de largo y ancho de 30 ejemplares de cada una de las especies que se describen con un vernier digital, con las que se realizó un análisis estadístico descriptivo básico de los parámetros utilizados para su descripción. La fenología de emergencia de adultos se determinó mediante gráficos de los registros mensuales de captura de los ejemplares adultos en los periodos de trabajo. Los holotipos y paratipos de las 2 especies se depositaron en la Colección de Invertebrados (Insectos Xilófagos) de la Facultad de Biología de la Universidad Michoacana (CIFBUM-XIL).
Figura 1. Ubicación de Taretan, localidad tipo de las 2 nuevas especies de Calymmaderus (INEGI, 2016).
Diagnosis. Cuerpo robusto en vista lateral, 1.9 veces más largo que ancho, color negro uniforme mate, pubescencia blanquecina decumbente y abundante, separada menos de su longitud, élitros paralelos después de la base hasta 3/4 partes; antenas desde la base de café rojizo a café negruzco en los últimos segmentos; metasterno con menos pubescencia que resto del cuerpo. Lóbulo mestasternal con muesca profunda en forma característica de U.
Holotipo ♂, largo 3.8 mm, ancho 2.1 mm. Cuerpo robusto en vista lateral, 1.9 veces más largo que ancho (figs. 2, 3), color negro mate, excepto en palpos maxilares y labiales, que presentan el segmento basal café oscuro y los otros segmentos café rojizo. Tarsos de color café rojizo. Pubescencia decumbente blanquecina, abundante, uniforme en todo el cuerpo. Puntuaciones elitrales de la superficie ampliamente distribuidas, no alineadas e intercaladas con otras puntuaciones diminutas en todo el cuerpo y separadas 1.0 veces su diámetro. Cabeza: ojos grandes y abultados, distancia interocular 1.1 veces el diámetro vertical de un ojo. Clava antenal ligeramente mayor (1.1 veces) que el resto de los segmentos; 9º segmento de la clava antenal ligeramente más largo que los segmentos 10º y 11º (fig. 6). Pronoto: acampanado, 1.9 veces más ancho que largo; borde anterior curvo y márgenes laterales redondeados. Superficie densamente punteada y pilosa, con las puntuaciones laterales equidistantes y separadas en general el equivalente a su diámetro; en el disco las puntuaciones son más separadas (1-2 veces su diámetro). Élitro: puntuaciones del disco y laterales separadas de 1 a 2 veces su diámetro (algunas veces un poco más separadas y alargadas); puntuaciones más cercanas a la base elitral más aglutinadas y puntuaciones laterales hacia la parte distal del élitro más alargadas; ranura lateral visible después de la base del tercer esternito hasta el ápice (fig. 4), abarcando menos de la mitad del élitro. Metasterno: convexo, más ancho que largo, carinas bien delimitadas; puntuaciones cercanas al proceso metasternal más pequeñas, separadas 1.0 veces su diámetro; puntuaciones se agrandan más hacia la parte media y a los lados, separadas de 1.0 a 1.5 veces su diámetro; en la parte media y hasta el borde posterior son más pequeñas y menos densas; surco longitudinal corto y no muy marcado (fig. 5). Abdomen: primero, segundo y quinto esternitos más o menos del mismo largo; segundo con borde posterior ligeramente curvo en centro; tercero un poco más corto que anteriores, y cuarto más corto que el resto (fig. 3). Edeago: longitud: 1.1 mm; anchura 0.48 mm. Parámeros bifurcados apicalmente, con borde apical redondeado; piezas accesorias de los parámeros 4.2 veces más largos que su ancho, con pilosidad larga desde la mitad hasta su extremo. Endófalo: ápice más esbelto que la base, terminando en punta con un diente curvo en forma de gancho, saco interno provisto de por lo menos doce espinas transversales a lo largo; las 2 más cercanas a la base 2 veces más largas que las demás y de posición paralela; 2 espinas al centro más pequeñas y entrecruzadas con las espinas basales más largas (fig. 14).
Paratipo ♀. Aspecto general del cuerpo similar al macho. Largo 4.1 ancho 2.3 mm, ojos evidentemente más grandes y abultados que el macho, distancia interocular 1.3 veces el diámetro vertical de un ojo. Tercera y cuarta sutura de los esternitos curvada a los lados.
Resumen taxonómico
Etimología. El epíteto de la especie robustus deriva de la forma robusta del tórax en vista lateral (mucho más alta que el abdomen), que caracteriza y diferencia a los ejemplares de esta especie en comparación con las especies conocidas.
Material examinado. Holotipo ♂: CIFBUM-XIL Núm. 224. México: Michoacán. Taretan. 19.VII.2017. C. Jurado Col. Trampa de luz blanca, madera estructural de pino. 19°20’3.32” N. 101°55’3.02” O. 1,140 m snm. Paratipos: 28; 13 ♂, 17 ♀. CIFBUM-XIL Núms. 226-252, con los mismos datos del holotipo.
Comentarios taxonómicos
Variabilidad: largo 3.1-4.2 mm (media 3.72) ancho 1.7-2.3 mm (media 2.08). Macho más pequeño que la hembra (de 3.1 a 3.7 mm; tabla 1). Ojos más pequeños, distancia interocular de 1.0 a 1.1 veces del diámetro vertical del ojo; último esternito normal, con sutura recta. Hembra: 3.8 a 4.2 mm, ojos más grandes y abultados que el macho, distancia interocular de 1.2 a 1.3 veces el diámetro vertical de un ojo; último esternito con sutura ligeramente curvada en el centro. Especie con morfología poco variable; color general negruzco mate, pubescencia blanquecina uniforme, algunas veces con pubescencia menos abundante en el metasterno.
Figuras 2-6. Calymmaderus robustus sp. nov. 2) Vista dorsal; 3) vista ventral; 4) vista lateral; 5) metasterno; 6) antena.
Especie de hábitos nocturnos asociada con madera estructural de Pinus sp.; los ejemplares se capturaron en el interior de la techumbre de madera del templo de “San Ildefonso” Taretan, con trampa de luz. La emergencia de adultos inicia la última semana de junio, con máximo a mediados de julio y disminuye la última semana de julio; la emergencia es rara en agosto. Cohabita con otras especies de Ptinidae y termes, reinfestando durante muchos años la madera del mismo sitio (fig. 7).
Figura 7. Emergencia adultos de Calymmaderus robustus sp. nov., en 2 ciclos anuales.
Tabla 1
Medidas y variación de largo y ancho de machos y hembras adultos de Calymmaderus robustus sp. nov.
Medidas
Promedio (mm)
Error estándar
Rango (mm)
N (hembras) = 13 N (machos) = 17
Machos
Hembras
Machos
Hembras
Machos
Hembras
Longitud
3.438
3.947
0.055
0.032
3.1 – 3.7
3.8 – 4.2
Ancho
1.931
2.194
0.036
0.020
1.2 – 2.1
2.1 – 2.3
De acuerdo con la clave de identificación usada para especies de Calymmaderus (White, 1983), los ejemplares son definitivamente diferentes a las descripciones de las especies mexicanas descritas, considerando la variación en el conjunto de los siguientes caracteres. Todas las especies citadas para México presentan cuerpo oblongo o semiesférico (C. sharpi) en vista lateral; en cuanto al color, los ejemplares descritos de todas las especies van de café rojizo o café oscuro a casi negro, mientras que la coloración del integumento de la especie que se describe es negro mate uniforme. En cuanto a la pubescencia, a diferencia de las especies conocidas en las que tiene tonalidades amarillentas a grisáceas, la especie propuesta presenta pubescencia blanquecina, que contrasta fuertemente con el color del cuerpo. La mayoría de las poblaciones de las especies comparten un tamaño de longitud y ancho similares, excepto C. donckieri y C. subvestitus, que son notablemente más pequeñas. La carencia de información acerca de la armadura genital de las especies no permite hacer comparaciones al respecto. Sin embargo, se presenta la comparación de la armadura genital del macho de las 2 especies propuestas en este documento y C. oblongus, especie mejor conocida de amplia distribución en México (figs. 14-16), lo que respalda la diferenciación entre ellas.
Diagnosis. Forma oblonga, esbelto en vista dorsal, 2.1 veces más largo que ancho, élitros paralelos después de la base hasta 3/4 partes de su extensión; superficie del cuerpo de coloración homogénea de café oscuro a casi negro; pubescencia amarillenta densa y decumbente, separada menos del largo de su longitud; puntuaciones laterales de élitros más agrandadas en la base que en el resto del élitro.
Holotipo ♂, largo 3.8 mm, ancho 1.8 mm. Coloración de café oscuro a casi negro; superficie brillante; antenas y tarsos con la misma coloración del cuerpo; palpos labiales y palpos maxilares café rojizo. Cuerpo oblongo y alargado, 2.1 veces más largo que ancho (figs. 8, 9). Vestidura: pubescencia amarillenta, densa, decumbente y abundante en todo el cuerpo, puntuaciones uniformes en todo el cuerpo, excepto las puntuaciones laterales del élitro que se presentan de forma aglutinada e irregular (fig. 10). Cabeza: ojos pequeños separados 1.4 veces el diámetro vertical de un ojo. Clava antenal 1.3 veces más larga que el resto de los segmentos, noveno segmento de la clava antenal del mismo largo que el décimo y undécimo (fig. 12). Pronoto: acampanado 1.6 veces más largo que ancho, convexo dorsalmente; margen lateralmente redondeado, con un reborde lateral y borde anterior regularmente curvo, no proyectado; disco no prominente; pubescencia uniforme, superficie densamente punteada. Élitro: puntuaciones elitrales irregulares, no alineadas en hileras, separadas de 1 a 2 veces su diámetro, en el disco elitral también a la misma distancia; puntuaciones laterales de la base un poco más grandes y algunas están separadas el equivalente a su diámetro; en el tercio posterior del élitro las puntuaciones son más pequeñas; puntuaciones basales laterales aglutinadas formando una estría a la altura del segundo esternito, que continua hasta el ápice ya bien marcada como ranura basal; por encima otra línea no muy marcada forma otra estría también a nivel del segundo esternito, la ranura ocupa ligeramente más de la mitad del élitro hasta el ápice. Metasterno: ancho del lóbulo metasternal, escasamente mayor que su longitud, muesca profunda, ápice del lóbulo muy arqueado en forma de V; puntuaciones más grandes cerca del lóbulo y a lo largo del borde anterior del metasterno, separadas el equivalente a su diámetro; a los lados las puntuaciones son más espaciadas de 1.0 a 1.5 veces su diámetro, algunas separadas hasta 2 veces su diámetro; del centro hasta el borde posterior, las puntuaciones son más pequeñas y escasas, separadas de 1.0 a 2.0 veces su diámetro; surco longitudinal ligeramente marcado y extendido hasta la mitad del metasterno (fig. 11). Abdomen: segundo ventrito más largo que el resto; el primero y tercero de largo similar, el cuarto es el más estrecho, el quinto presenta una concavidad paralela al ventrito cerca del borde posterior (fig. 9). Edeago: longitud 0.65 mm; anchura 0.41 mm, parámeros bifurcados apicalmente, el más grande de apariencia bilobulada en el extremo; piezas accesorias de los parámeros 4.5 veces más largos que anchos, con pilosidades desde la mitad hasta el ápice. Endofalo: ápice redondeado, saco interno con un par de dientes paralelos al endofalo en la base; sobre estos dientes, hay 2 dientes adicionales curvos con aspecto de media luna (fig. 15).
Figuras 8-12. Calymmaderus semioblongus sp. nov. 8) Vista dorsal; 9) vista ventral; 10) vista lateral; 11) metasterno; 12) antena.
Paratipo ♀. Aspecto general del cuerpo similar al macho. Largo 4.1 mm. Ancho 1.9 mm. Distancia interocular 1.4 veces el diámetro vertical del ojo, segunda y tercera suturas abdominales curvadas en el centro, quinta sutura ligeramente curvada a los lados.
Resumen taxonómico
Etimología. El epíteto semioblongus es aplicado por la similitud morfológica externa con la especie oblongus, conocida para varias localidades de México.
Material examinado. Holotipo ♂: CIFBUM-XIL No. 253, Michoacán, Taretan. 18.VIII.2017. C. Jurado Col. Trampa de luz blanca, madera estructural de pino. Col. C. Jurado. 19°20’3.32” N. 101°55’3.02” 0. 1,150 m.snm. Paratipos: 29 individuos CIFBUM-XIL Núms. 255 a 282 (14 ♂ y 14 ♀), mismos datos que el holotipo.
Comentarios taxonómicos
Variabilidad: largo: 3.0-4.8 mm; ancho 1.4- 2.1 mm. Especie muy homogénea. Los machos notablemente menores que las hembras, con tamaño que varía de 3.0 a 3.7 mm (a veces hasta 3.8 mm), con ojos más pequeños y menos separados que en las hembras (distancia interocular de 0.8 a 1.2 el diámetro vertical de un ojo); área frontal algo más aplanada que la hembra, surco longitudinal del metasterno más largo que en la hembra.
Figura 13. Emergencia de Calymmaderus semioblongus sp. nov., en 2 ciclos anuales.
Tabla 2
Medidas y variación de largo y ancho de machos y hembras adultos de Calymmaderus semioblongus sp. nov.
Medidas
Promedio (mm)
Error estándar
Rango (mm)
N (machos) = 15 N (hembras) = 15
Machos
Hembras
Machos
Hembras
Machos
Hembras
Longitud
3.507
4.133
0.059
0.070
3.0-3.8
3.8-4.8
Ancho
1.627
1.886
0.025
0.026
1.4-1.7
1.7-2.1
Tabla 3. Medidas y variación de largo y ancho de machos y hembras adultos de Calymmaderus oblongus de la localidad de Tacícuaro, Michoacán.
Medidas
Medidas
Promedio (mm)
Error estándar
Rango (mm)
N (machos) = 15 N (hembras) = 15
n♂= 15 n♀= 15
♂
♀
♂
♀
♂
♀
Longitud
Longitud
3.507
4.133
0.060
0.070
3.0-3.8
3.8-4.8
Ancho
Ancho
1.627
1.887
0.025
0.026
1.4-1.7
1.7-2.1
Figura 14-16. Estructura genital de machos de las 3 especies de Calymmaderus vistas al microscopio compuesto 100X: 14) C. robustus sp. nov; 15) C.semioblongus sp. nov; 16) C.oblongus.
Hembra: cuerpo más grande que el macho, de 3.9 a 4.8 mm, ojos más grandes y separados que el macho (distancia interocular de 1.4 a 1.6 veces el diámetro vertical del ojo), última sutura esternal más curva a los lados que en el macho.
Especie de hábitos nocturnos asociada con madera estructural de Pinus sp. Se capturó en el interior de la techumbre de madera del templo de San Ildefonso en Taretan, Michoacán, con trampa de luz. La emergencia de los adultos inicia la última semana del mes de junio, en el mes de julio se registra la máxima emergencia con el inicio del verano, hasta disminuir en agosto con pocos ejemplares y en septiembre su emergencia es rara. Cohabita con otras especies xilófagas de Ptinidae y de termitas. Reinfesta las estructuras de madera por muchos años en el mismo sitio (fig. 13).
Calymmaderussemioblongus sp. nov. es una especie diferente a las otras especies mexicanas del género (White, 1983). Muestra similitud morfológica con la especie oblongus, pero con diferencias evidentes como la coloración del integumento (café oscuro en la especie descrita, a diferencia de oblongus que tiende más a café rojizo; sus medidas de longitud y ancho del cuerpo son menores (3.0 a 4.5 mm de longitud y ancho 1.4 a 2.1 mm, tabla 2), en comparación con C. oblongus (de 3.3 a 5.2 mm de largo y ancho de 1.6 a 2.4 mm, tabla 3). Ambas especies presentan de 2 a 3 hileras de puntuaciones laterales desde la base elitral que forman estrías; en oblongus, la estría más externa y cercana a la ranura elitral es más corta y las otras 2 estrías son menos marcadas que en la especie que se describe. La comparación de la estructura genital de machos de C. oblongus y C. semioblongus sp. nov. también mostró diferencias claras en el número y posición de espinas en el endofalo de estas 2 especies; C.oblongus presenta 2 espinas en forma de cornamenta en la parte más alejada de la base (figs. 14-16).
Agradecimientos
Al Laboratorio de Investigación en Invertebrados de la Facultad de Biología y a la División de Estudios de Posgrado de la Facultad de Ingeniería en Tecnología de la Madera de la UMSNH, por apoyar el proyecto de insectos xilófagos en madera estructural en Michoacán. A Mauricio Quesada, jefe del laboratorio Nacional de Síntesis Ecológica, ENES, UNAM, Unidad Morelia, por facilitar el uso del microscopio Axiostar Zoom V16, para la toma de imágenes de ejemplares. A las autoridades eclesiásticas del Templo de la “Asunción” de Taretan (en especial al párroco Francisco Javier Valencia Durón), por permitir el trabajo de campo en el inmueble. A Roberto Sibaja por la elaboración y ubicación del mapa del sitio. Finalmente agradecer a José Fernando Villaseñor Gómez, de la Facultad de Biología, quien colaboró en la última revisión del texto, con sugerencias acertadas y positivas.
Referencias
Arango, R. A. y Young, D. K. (2012). Death-watch and spider beetles of Wisconsin—Coleoptera: Ptinidae. USDA Forest Service, Forest Products Laboratory, General Technical Report FPL-GTR-209. https://doi.org/10.2737/FPL-GTR-209
Bercedo, P., García, B. R. y Arnaiz, L. (2008). El género Calymmaderus Solier, 1849 nuevo para Canarias y descripción de una nueva especie (Coleoptera: Ptinidae: Dorcatominae). Boletín de la Sociedad Entomológica Aragonesa, 42, 33–35.
Blackwelder, R. E. (1945). Checklist of the coleopterous insects of México, Central America, The West Indies, and South America (Ptinidae, Gnostidae and Anobiidae). Bulletin of the United States National Museum, 185, 401–406. https://doi.org/10.5479/si.03629236.185.3
Cibrián, T. D., Méndez M. J. T., Campos, B. R., Harry, O. Y. y Flores, L. J. (1995). Insectos forestales de México. Texcoco, Estado de México: Universidad Autónoma Chapingo.
Español, C. F. (1992). Coleoptera: Anobiidae. Fauna Ibérica, Vol. 2. Museo Nacional de Ciencias Naturales. Madrid: CSIC.
Gaviño, G., Juárez, L. C. y Figueroa, T. H. (2004). Técnicas biológicas selectas de laboratorio y campo. México D.F.: Limusa.
Halffter, G. (2017). La Zona de Transición Mexicana y la megadiversidad de México: del marco histórico a la riqueza actual. Dugesiana, 2, 77–89. https://doi.org/10.32870/dugesiana.v24i2.6572
INEGI (Instituto Nacional de Geografía y Estadística). (2010). Compendio de información geográfica municipal. Taretan, Michoacán de Ocampo. Clave geoestadística 16087. Instituto Nacional de Geografía y Estadística. Recuperado el 17 diciembre, 2024 de: https://www.inegi.org.mx/contenidos/app/mexicocifras/datos_geograficos/16/16087.pdf
Jurado-Vargas, C. M. A. (2020). Incidencia y daño de insectos en la techumbre de madera de cinco edificios históricos (Templos) de Michoacán (Tesis doctoral). Facultad de Ingeniería en Tecnología de la madera, Universidad Michoacana de San Nicolás de Hidalgo. Morelia, Michoacán.
Jurado-Vargas, C. M. A., Campos, B. R. y Cruz-de León, J. (2003). Anóbidos asociados a la madera en uso en dos monumentos históricos de Michoacán. Entomología Mexicana, 2, 803–806.
Jurado-Vargas, C. M. A. y Cruz-de León, J. (2010). Insectos que dañan la madera de edificios históricos de Morelia, Michoacán. Entomología Mexicana, 9, 103–110.
Jurado-Vargas, C. M. A. y Cruz-de León, J. (2020). Evaluación de la incidencia de insectos xilófagos en la madera estructural del Templo de Ucareo en Michoacán. Entomología Mexicana, 7, 389–395.
Lüher, A. H. y Honour, R. (2017). Descripción de dos especies nuevas de Calymmaderus Solier, 1849 (Coleoptera: Ptinidae) de Chile. Boletín de la Sociedad Entomológica Aragonesa, 60, 105–110.
Pichardo, S. L., San Marino, C. A., Jiménez, Q. E. y Torres, H. B. (2017). Familia Ptinidae. En D. Cibrian-Tovar (Ed.), Fundamentos de entomología forestal (pp. 268–272). Texcoco, Estado de México: Universidad Autónoma Chapingo.
Toskina, I. N. (2000). New wood-boring beetles (Coleoptera: Anobiidae) from Paraguay. Russian Entomological Journal, 9, 199–240.
Viñolas, A. (2018). Nuevos datos sobre la validez específica de Ernobius vinolasi Novoa y Baselga, 2000 (Coleoptera: Ptinidae: Ernobiinae). Arquivos Entomoloxicos, 19, 75–80. https://doi.org/10.5281/zenodo.12767756
White, R. E. (1971). Key to North American genera of Anobiidae, with phylogenetic and synonymic notes (Coleoptera). Annals of the Entomological Society of America, 64, 179–191. https://doi.org/10.1093/aesa/64.1.179
White, R. E. (1974). The Dorcatominae and Tricoryninae of Chile (Coleoptera: Anobiidae). Transactions of the American Entomological Society, 100, 191–253.
White, R. E. (1982). A catalog of the Coleoptera of America North of Mexico. Family Anobiidae. Systematic Entomology Laboratory, Agricultural Research Service, U.S. Dept. of Agriculture, U.S.A.
White, R. E. (1983). Keys to Neotropical species of Calymmaderus Solier and species of Calytheca White, taxonomic notes (Coleoptera: Anobiidae). Proceedings of the Entomological Society of Washington, 85, 229–250.
White, R. E. (1984). Eight new species of Anobiidae (Coleoptera) from Jamaica. The Coleopterists Bulletin, 38, 240–248.
Instituto de Ecología, A.C., Carretera antigua a Coatepec 351, Col. El Haya, 91073 Xalapa, Veracruz, Mexico
*Corresponding author: francisco.lorea@inecol.mx (F. Lorea-Hernández)
Received: 27 February 2024; accepted: 21 January 2025
Abstract
Following a detailed morphological survey of the Licaria collections in several herbaria, various taxonomic entities not recognized before were detected. Here, 11 new species of Licaria from Mesoamerica are described and illustrated. Possible relations to other species in the genus are commented.
Keywords: Lauraceae of Central America; Lauraceae of Mexico; Licaria of Central America; Licaria of Mexico
Nuevas especies de Licaria (Lauraceae) de Mesoamérica
Resumen
Como resultado de un análisis morfológico detallado de las colecciones del género Licaria en diferentes herbarios, se detectaron varias entidades taxonómicas no reconocidas previamente. Aquí se describen e ilustran 11 especies nuevas del género Licaria de la región mesoamericana. Se comentan además las posibles relaciones con otras especies del género.
Palabras clave: Lauraceae de Centroamérica; Lauraceae de México; Licaria de Centroamérica; Licaria de México
Introduction
Licaria is an endemic genus to the Americas represented mostly by medium-sized to large tree species that grow principally in the intertropical region of this part of the world. The hermaphrodite, perigynous flowers with only the third whorl of stamens fertile, whose anthers are bisporangiate, as well as the fruit often seated on a double rimmed cupule, constitute the combination of characters that distinguishes the genus among the Lauraceae. Licaria was last revised by Kurz (2000), who recognized 38 species, including 12 in the Mesoamerican area. That work is an adaptation with minor changes of Kurz doctoral dissertation (Kurz, 1983). Since then, in the lapse of 40 years, subtracting new combinations and synonyms, 31 new species have been described, adding 9 to the flora of Mesoamerica (Burger & van der Werff, 1990; Gómez-Laurito & Cascante, 1999; Gómez-Laurito & Estrada, 2002; Hammel, 1986; van der Werff, 1988, 2009). The impulse given to field work with the onset of the Flora Mesoamericana project resulted in a significant increment of herbarium specimens during the last 2 decades of the past century, but Kurz did not see most of them; those specimens have been frequently the source of new species described afterwards in Licaria. Furthermore, the expanded collections have improved our knowledge about variation of morphology within species and consequently have led to better circumscriptions of them. On the other hand, it is important to say that Kurz missed part of the diversity of Licaria because he relied mainly on what the big museums of Europe and the USA have, but did not search in several of the smaller regional herbaria; some of which preserve important specimens that support the recognition of several species that have elsewhere been synonymized or validate larger geographic distributions of taxa.
Contrary to what is found in most American genera of the Lauracae, Licaria presents a rather wide variation in flower morphology, e.g., in orientation of tepals, extent of stamens fusion, presence and extent of fusion of glands, presence of staminodes, and shape and position of anther openings. These features, together with the presence and type of hairiness on flower parts, as well as position and structure of inflorescence, constitute the basis for the recognition of species in the genus (Kostermans, 1937; Kurz, 2000; Mez, 1889). In the course of the revision of Licaria for the Flora Mesoamericana project, a number of herbarium specimens with distinctive character combinations were found, which had not been recorded previously in the genus. Differences are mainly in flower morphology, but complementary vegetative features or other data emphasize their singularity. In several cases, there are no additional specimens, but the collection on which the description is based. This situation has not been considered a drawback since, as is discussed in every case, the peculiarity of the plants is so patent that there is little chance to think they represent part of the variability of any other known species. The case strengthens the idea that we have as yet an incomplete picture of the extent of diversity and distribution in many taxa. Field work is still important and necessary.
Materials and methods
Specimens identified as Licaria (as well as unidentified, putative lauraceous material) collected in the Mesoamerican area from different herbaria (A, CAS, DS, ENCB, F, GH, HEM, K, MEXU, MICH, MO, NY, P, TEX, US, XAL) were carefully analyzed, both for vegetative and reproductive morphology. Particular attention was paid to floral characters; flowers were dissected using a Zeiss, Stemi DV4 stereomicroscope. Information of vegetative characters was collected directly from dry specimens, while floral morphology was surveyed in rehydrated material. Groups of specimens sharing similar morphology were matched with keys and descriptions of currently accepted species, in order to apply the correct names to them. To prevent misinterpretations, all available type specimens (either from herbaria cited above or accesible on Global Plants database (http://plants.jstor.org/search?plantNam) were also considered during the process of identification. Specimens that did not fit any of the known species were evaluated to determine their singularity; those whose floral and vegetative features combined do not overlap with that of accepted taxa are here proposed as new species. Following the methodology mentioned above, description of vegetative characters is based on dry specimens, while floral characters are described as they look in rehydrated material. In order to apply a standardized nomenclature to characters, applicable information in Radford et al. (1974) was used; particularly, base and apex of leaves, pubescence, tridimensional form of flowers, and shape of tepals were described according to that text.
Diagnosis. Trees similar to L. alata Miranda, but different because of the convex flanks of the base of the leaves, sparsely sericeous lower leaf surface, obloid flowers, densely tomentose tepals abaxially, partially pubescent staminal filaments abaxially and adaxially, densely tomentose hypanthium outside, densely hirsute-tomentose inside, and sparsely puberulent style.
Trees up to 15 m tall; twigs sericeous, soon glabrate, brownish gray or dark brown, lenticellate, conspicuously ridged, the ridges narrow, wing-like (at least when dry), each ridge originates at one extreme of petiole insertion, acropetal. Buds densely sericeous-tomentose. Leaves alternate, petioles 9-10.5(-12) mm long, bi-marginate above, glabrous, round below, sericeous, glabrescent, blades (17.5-)23-28 × (3.5-)4.5-7 cm, narrowly elliptic, pinninerved, secondary veins 11-13 pairs, upper leaf surface glabrous, lower surface sparsely sericeous, glabrescent, leaf apex acuminate, leaf base obtuse, somewhat conduplicate, the basal flanks of the blade convex and projected above the midvein. Inflorescences (7.5-)10-16.5 cm long, axillary to tiny, deciduous bracts, on the proximal section of new twigs, paniculate, sericeous-tomentose, peduncle (2.5-)4-6.5 cm long, sometimes glabrescent, pedicels 0.5-1.2(-2.5) mm long, densely tomentose, hairs yellowish-gray to yellowish-brown. Flowers obloid, tepals conspicuously inflexed, outer tepals 0.8-1 × 1.7-2 mm, very widely ovate, densely tomentose abaxially, slightly papillose toward the apex, glabrous or sometimes with scattered sericeous hairs at the base adaxially, inner tepals 0.6 × 1-1.1 mm, ovate or elliptic, tomentose abaxially, glabrous adaxially, staminodes of whorls I and II absent, stamens of whorl III 1-1.1 mm long, fused throughout, filaments pubescent at the base abaxially, glabrous adaxially or pubescent on the upper section, anthers 0.2-0.3 mm long, glabrous, with apical openings, glands ca. 0.2 mm, free, compressed, glabrous, sometimes reduced or absent, hypanthium ca. 0.8 mm deep, densely tomentose outside, hirsute-tomentose inside, pistil 1.3-1.4 mm long, ovary 0.8-1 mm long, glabrous, style sparsely puberulent. Fruits unknown.
Taxonomic summary
Type. Mexico. Chiapas: municipality of Petalcingo (actually municipality of Tila), steep slope of Ahk’ulbal Nab above Petalcingo, 1,700 m, 28 March 1981, D. E. Breedlove 50394 (holotype CAS; isotype MO 6485834).
Etymology. This species is dedicated to Dr. Dennis E. Breedlove, who spent so much effort in field work documenting the flora of Chiapas, pursuing the aim of elaborating a plant species compendium for that region of Mexico.
Distribution and habitat. So far the species is known only from the type collection, in an area covered by montane rain forest which, according to Breedlove (data from label of type specimen), had a canopy layer reaching 25 – 35 m, and species of the genera Alfaroa, Brunellia, Calatola, Hedyosmum, Matudea, Meliosma, Nectandra, Oreopanax, Quercus, and Turpinia, among others.
Phenology. Regarding the date when the plant was collected, it must have flowers around the end of winter and early days of spring; fruit season is not known, but possibly occurs during winter, for it has been observed that maturation of fruits in most Lauraceae takes around a year after flowering. It seems that the species is not deciduous.
Conservation status. Given the deep environmental degradation that currently prevails in the region where the species is only known, it is suspected that it is critically endangered.
Remarks
The presence of erect, concave tepals, and stamens with extrorse sporangia places L. breedlovei in subgenus Licaria. It is one element in the group (here called Licaria excelsa species group) constituted by L. alata, L. excelsa Kosterm., L. minutiflora (here described), L. pergamentacea W. C. Burger, L. sarukhanii (here described), and L. tomentulosa (here described), as it shares with them morphological features like ridged twigs, large narrow-elliptic leaves (frequently reaching 28-30 cm long), and anthers with sporangia opening apically. Within the group, L. breedlovei is distinguished from the other species by the combination of somewhat conduplicate leaf-base, lower leaf surface persistently sericeous, stamens fused throughout, and sparsely pubescent style. In addition, it differs particularly from L. alata for the obloid flowers (vs. ellipsoid), tepals densely tomentose abaxially (vs. tepals glabrous abaxially), filaments pubescent abaxially and adaxially (vs. filaments glabrous), and hypanthium densely tomentose outside and inside (vs. hypanthium glabrous on both faces).
Diagnosis. Trees, similar to L. misantlae (Brandegee) Kosterm., glabrous throughout, leaves mostly caudate, inflorescences botryoid, flowers long-pedicellate, without staminodes, and fruit cupule thick, deeply crateriform, its outer rim slightly lobed.
Trees up to 25 m; twigs glabrous, smooth or slightly ribbed, reddish-brown or grayish-brown, sparsely lenticellate. Buds glabrous. Leaves alternate, petioles (3.5-)6.5-9(-11) mm long, slightly sulcate above, rounded and smooth or slightly ribbed below, glabrous, blades (4.5-)7-11(-13) × (1.5-)2.5-4(-5) cm, elliptic or narrowly elliptic, pinninerved, secondary veins 6-11 pairs, both upper and lower leaf surfaces glabrous, leaf apex caudate, sometimes acuminate, base cuneate to obtuse. Inflorescences 2.5-5 cm long, axillary to tiny, decidous bracts, disposed on very short shoots axillary to leaves, botryoid, or apparently paniculate, due to suppression of terminal bud of the floriferous branchlet, glabrous throughout, peduncle 0.2-1.7 cm long, pedicels (6-)10-13(-16) mm long, glabrous. Flowers widely obovoid to turbinate, greenish-yellow, tepals concave, conspicuously inflexed, outer tepals 0.9-1.3 × 1.1-1.7 mm, widely ovate, blunt cuspidate, glabrous abaxially and adaxially, short-ciliate, inner tepals 0.75-1.1 × 1.1-1.2 mm, ovate to widely ovate, glabrous abaxially and adaxially, short-ciliate, staminodes of whorls I and II absent, stamens of whorl III 0.6-1 mm long, fused throughout, filaments glabrous abaxially and adaxially, sometimes with a few hairs at the base abaxially, anthers ca. 0.1 mm, glabrous, with apical openings, glands ca. 0.4 mm, free, oblong, sometimes almost square, obtuse or sub-acute, glabrous, hypanthium 0.6-0.9 mm deep, glabrous outside and inside, pistil ca. 1.5 mm long, glabrous throughout, ovary 0.7-0.9 mm long. Fruits ca. 27 × 21 mm, ovoid or ellipsoid, cupule ca. 15 × 20 mm, crateriform, clearly bimarginate, inner margin ca. 2 mm tall, erect, outer margin ca. 3.5 mm tall, oblique to slightly reflexed, shallowly lobed, thick, pedicel ca. 5.5 × 4.5 (at the base) and 7 (at the apex) mm, obconic, continuous with the cupule.
Taxonomic summary
Type. Costa Rica. Puntarenas: Reserva Forestal Golfo Dulce, Osa Peninsula, Rancho Quemado, 8°44’ N, 83°36’ W, 200-300 m, 2 May 1988, B. Hammel et al. 16790 (holotype MO; isotypes MEXU, TEX).
Figure 1. Licaria breedlovei Lorea-Hern. sp. nov., general view.
Paratypes. Costa Rica. Guanacaste: Cantón de Tilarán, San Gerardo Abajo, río Caño Negro, Fincas Quesada y Arce, 10°18’40’’ N, 84°50’02’’ W, 1,100-1,200 m, 5 December 1991, E. Bello & E. Cruz 4262 (XAL). Puntarenas: Cantón de Osa, Rincón, filas al margen izquierdo de Quebrada Vaquedano, 8°38’45’’ N, 83°35’25’’ W, 400 m, 21 July 1990, G. Herrera 4000 (XAL); Cantón de Osa, Aguabuena, cuenca media y superior de Quebrada Orito, Rincón, 8°42’40’’ N, 83°31’40’’ W, 400 m, 25 October 1990, G. Herrera 4510 (MEXU); Cantón de Osa, Rancho Quemado, sector oeste, Sierpe, 8°41’00’’ N, 83°35’40’’ W, 350 m, 25 August 1982, J. Marín & G. Marín 499 (MO, XAL).
Figure 2. Licaria dolichopoda Lorea-Hern. sp. nov., general view.
Etymology. The name of this species alludes to the distinctive long pedicels that bear the flowers.
Distribution and habitat. Currently the species is known from 2 rather distant areas in Costa Rica that differ in ecological conditions. One of them, in the province of Guanacaste, is located in the Pacific foothills of the southern end of the Sierra de Guanacaste, while the other, in the province of Puntarenas, is in the lowlands of the Peninsula de Osa toward the southeastern extreme of the country. The first one is covered by pre-montane humid forest, and the second by humid tropical forest.
Phenology. Flowering is apparently distributed in 2 peaks: May-July and October-December. Fruits are only known from October.
Conservation status. There is no information about the abundance of the species in the places where it has been collected, neither about the ecological conditions of the vegetation there. However, the distribution range in the southeast is embedded in the Reserva Forestal Golfo Dulce, by the boundaries with the Parque Nacional Corcovado. Thus, there might not be problems with the persistence of the species in that region. The other point of the species distribution is, according to satellite images, within a region with deeply transformed vegetation, although not too far from the Parque Nacional Volcán Arenal, which could hold the species in its flora.
Because of the erect, concave tepals, and extrorse sporangia of stamens in the flowers, L. dolichopoda must be also considered in the subgenus Licaria. The glabrous condition found in every structure of the plant body (stem, leaves, and flowers), as well as the apical openings of stamens, and the lack of staminodes found in this species places it beside L. eurypaniculata (here described), from which it differs in the botryoid architecture of the inflorescence, and the conspicuous caudate leaves. Collection duplicates of L. dolichopoda have been previously distributed as L. cufodontisii Kosterm. (Herrera 4000), and as L. misantlae (Herrera 4510).
Diagnosis. Among the species with glabrous leaves, inflexed tepals, lacking staminodes, as well as apical anther openings, this species is distinguished by paniculate inflorescences where the flowers are not aggregate on the floriferous axes, orbicular flowers, tepal surface glabrous abaxially and adaxially, fused stamens throughout, glabrous hypanthium outside and inside, and glabrous pistil.
Trees 6-7 m tall; twigs glabrous, smooth or slightly ribbed, reddish-brown, sparsely lenticellate. Buds glabrous. Leaves alternate, petioles (5.5-)7-9(-10.5) mm long, slightly sulcate above, glabrous, blades (7-)11-16(-19.5) × (2-)3-4.5(-6) cm, narrowly elliptic to lanceolate or elliptic, pinninerved, secondary veins 7-9 pairs, both upper and lower leaf surfaces glabrous, leaf apex acuminate to short caudate, base obtuse to cuneate. Inflorescences 10-11 cm long, apparently terminal, if it is axillary to a bract, this one is inconspicuous, paniculate, basal axes longer than the peduncle, glabrous throughout or sparsely puberulent toward the end of the secondary axes, flowers spaced, not aggregate on the axes, peduncle ca. 3 cm long, pedicels 2-3.2 mm long, glabrous or sparsely puberulent. Flowers spheroidal, greenish, tepals conspicuously inflexed, outer tepals ca. 0.5 × 0.9-1.0 mm, widely ovate to depressed ovate, glabrous abaxially and adaxially, inner tepals ca. 0.4 × 0.6-0.7 mm, ovate or almost orbicular, glabrous abaxially and adaxially, staminodes of whorls I and II absent, stamens of whorl III 0.5-0.6 mm long, fused throughout, filaments glabrous outside, sparsely tomentose inside, anthers ca. 0.1 mm, glabrous, with apical openings, glands ca. 0.1 mm, free, widely elliptic or orbicular, glabrous, hypanthium ca. 0.7 mm deep, glabrous outside, glabrous or sparsely pubescent on the distal section inside, pistil ca. 1.1-1.2 mm long, glabrous throughout, ovary ca. 0.6-0.7 mm long. Fruits (not wholly ripe) 15-17 × 12-12.5 mm, ovoid or ellipsoid, cupule 10-11 × 14-15 mm, crateriform, clearly bimarginate, inner margin 1.1-1.3 mm tall, erect, outer margin 0.5-0.7 mm tall, perpendicular to the inner one, pedicel 3-3.6 × 2-2.2 (at the base) and 3.6-4 (at the apex) mm, obconic.
Taxonomic summary
Type. Panama. Bocas del Toro: along road to Chiriquí Grande, c. 10 road miles from continental divide and about 2 miles along road east of highway, 8°45’ N, 82°15’ W, 300 m, 15 April 1987, G. McPherson 10830 (holotype MO; isotype XAL 124596).
Paratype. Panama. Bocas del Toro: along road to Chiriquí Grande, 10 road-miles from continental divide, ca. 2 road-miles along road east of highway, 8°55’04’’ N, 82°10’04’’ W, 300 m, 9 February 1987, G. McPherson 10453 (MO 5048286).
Etymology. The name of this species alludes to the very long basal secondary axes of the inflorescence, which give a broad triangular profile to the panicle.
Distribution and habitat. The only 2 known collections of the species come from the same area in the Atlantic lowlands of western Panama. No information about the vegetation found at the site was recorded, but considering the geographical factors of the place, it is expected to be tropical rain forest.
Phenology. Flowers in spring, and fruits mature in winter or early spring. The plant is not deciduous.
Conservation status. It seems that the species is not frequent in the area where it was found, for it has been collected only twice. On the other hand, the view of the area from satellite images shows that most of the original vegetation has been cleared; therefore, the species might be endangered.
Remarks
There are no species that come close morphologically to L. eurypaniculata. The other species with a general glabrous condition almost throughout the plant body, L. dolichopoda, is very different, in the shape of the leaves and the structure of the inflorescence. Given the erect, concave tepals, and stamens with extrorse sporangia that L. eurypaniculata presents, it is also a member of the subgenus Licaria.
Diagnosis. Trees similar to L. excelsa, but distinguished by the obovate to oblanceolate leaves, densely yellowish to orange-brown puberulent inflorescences, tepals with basal half conspicuously swollen, puberulent abaxial surface, sericeous adaxial surface at the base, apically pubescent ovary, and pubescent style.
Trees 15-20 m tall, trunk ca. 25 cm DBH, bark smooth, fragrant; twigs hollow, inhabited by ants, glabrous, sparsely lenticellate, slightly ridged, each ridge originating at one extreme of petiole insertion, acropetal. Buds glabrous or partially pubescent. Leaves alternate, petioles 10-12(-14) mm long, bimarginate above, glabrous, blades (20-)24-30 × (9-)11-13 cm, obovate or oblanceolate, sometimes elliptic, pinninerved, secondary veins (12)14-16 pairs, leaf surface glabrous above and below, leaf apex apiculate, sometimes apiculate-acuminate, leaf base obtuse or rounded. Inflorescences 9-15 cm, seemingly terminal, but actually axillary to tiny, deciduous bracts, on the proximal section of new twigs, paniculate, conspicuously puberulent along all axes, hairs yellowish to orange-brown, peduncle (1-)3.5-4.5 cm, sparsely puberulent, glabrescent, pedicels 2.5-5.5(-7) mm, densely puberulent. Flowers widely obovoid, yellowish-green, fragrant, perianth thick, coriaceous, tepals clearly inflexed, their base conspicuously swollen, outer tepals 1.2-1.4 × 1.6-1.9 mm, widely ovate, puberulent abaxially, sericeous-tomentose at the base and toward the margins adaxially, hairs orange-brown, inner tepals 0.8-1 × 1-1.2 mm, ovate, puberulent abaxially, sericeous-tomentose at the base and tomentose at the middle adaxially, staminodes of whorls I and II absent, stamens of whorl III 0.7-0.8 mm long, fused along their filaments, filaments tomentose at the base outside, tomentose throughout inside, hairs orange-brown, anthers ca. 0.2 mm, free or fused just at the base, glabrous, with apical openings, glands ca. 0.3 mm, only 3 given the fusion of adjoining glands, widely oblong, glabrous, hypanthium 1-1.2 mm deep, obconic, densely puberulent outside, hairs yellowish to orange-brown, sericeous-tomentose inside, hairs reddish-brown, pistil 1.6-1.8 mm long, top of the ovary and style pubescent, ovary 0.8-1.2 mm long. Fruits (nearly ripe) 19-23 × 15.5-16.5 mm, ellipsoid, cupule ca. 16.5 × 18.5 mm, cotyliform, sparsely lenticellate, seemingly tri-margined, the 2 regular margins plus the swollen projections of the tepals, inner margin ca. 1.6 mm tall, erect, outer margin 2.2-2.5 mm tall, erect, pedicel 4.5-7 mm long, continuous with the base of the cupule, 3.5 mm diam. at the base.
Taxonomic summary
Type. Costa Rica. Limón: Reserva Biológica Hitoy Cerere, 300 m aguas abajo de la confluencia del río Hitoy con el río Cerere, margen izquierda por la fila que lleva al cerro Bobócora, 9°39’00’’ N, 83°02’45’’ W, 200 m, 20 February 1989, G. Herrera & A. Chacón 2427 (holotype MO, isotype XAL 124445).
Etymology. The name is derived from the conspicuous swollen condition of the base of the tepals; the feature is distinctive.
Distribution and habitat. So far, this species is known only from the southwestern end of Costa Rica. Although no information about the habitat was recorded, there is no doubt that the place lies within the tropical rain forest territory.
Figure 4. Licaria eurypaniculata Lorea-Hern. sp. nov., general view.
Phenology. With flowers and ripe fruits around the end of winter. The species has perennial leaves.
Conservation status. There is no information about the abundance or extent of distribution of the species, but as it is known to grow in the grounds of a nature reserve, it can be expected that it is not under high risk of extinction but certainly endangered.
Figure 5. Licaria gibbitepala Lorea-Hern. sp. nov., general view.
Remarks
Licaria gibbitepala seems to be closely related to L. tomentulosa and, at the same time, to the group of species around L. excelsa. All of them have ridged twigs, large leaves, flowers with erect, concave tepals, no staminodes, and sporangia with apical openings. The hollow twigs, along with the obovate to oblanceolate leaves, and the conspicuous gibbous base of the tepals distinguish L. gibbitepala.
Trees to 6 m tall; twigs smooth, dark brown to reddish brown, pruinose, puberulent, glabrescent, sparsely lenticellate. Buds glabrous. Leaves alternate, petioles (4-)8-11 mm long, puberulent, soon glabrous, canaliculate above, blades 8.5-13 × 3.5-5.5 cm, elliptic or narrowly elliptic, pinninerved, secondary veins 5-7 pairs, leaf surface glabrous above and below, but the lower surface puberulent in the beginning, leaf apex caudate, sometimes just acuminate, base obtuse to cuneate. Inflorescences 2.5-3.5 cm long, axillary to leaves and to tiny, deciduous bracts, on the proximal section of new twigs, botryoid, racemiform, few-flowered (less than 10 flowers), glabrous throughout or with some hairs toward the end of the peduncle, peduncle 1.8-2 cm long, pedicels 3-4.5 mm long, glabrous. Flowers obovoid, pale yellow, tepals erect to slightly inflexed, concave, outer tepals ca. 0.8 × 1.3 mm, very widely ovate to depressed ovate, glabrous abaxially, with some long, appressed hairs ascending from the base adaxially, inner tepals ca. 0.5 × 0.8 mm, ovate or widely ovate, glabrous abaxially, adaxially like the outer tepals, staminodes of whorls I and II absent, stamens of whorl III ca. 0.7 mm long, free, but very close one to each other, widely ovate in outline, filaments sparsely tomentulose outside and inside, anthers ca. 0.4 mm, tomentulose at the base outside, tomentulose inside along the central line, openings lateral, oblique, glands ca. 0.4 mm, rounded, glabrous, hypanthium ca. 0.7 mm deep, obconic, glabrous inside and outside, pistil ca. 1.7 mm long, glabrous, ovary ca. 0.8 mm long. Fruit unknown.
Figure 7. Licaria gracilis Lorea-Hern. sp. nov., general view.
Taxonomic summary
Type. Panama. Chiriquí: Punta Burica, El Chorogo, alrededores de la finca de Fernando Chavarría, adyacente al límite fronterizo, cabecera del río San Bartolo, 8°17’07’’ N, 82°58’56’’ W, 395 m, 15 May 2007, J. E. Aranda et al. 3912 (holotype MO 6456198).
Etymology. The name of the species is derived from the attractive view that the slender inflorescences give to the plant.
Distribution and habitat. The species is known only from the location where it was first and last collected. No information about the habitat is mentioned in the data-label of the specimen, except that was collected nearby a ranch. The original vegetation must have been tropical evergreen forest or semi-evergreen forest.
Phenology. Flowers during spring; ripe fruits expected during winter or early spring, since maturation of fruits in most Lauraceae takes around a year after flowering.
Conservation status. The species might be (critically) endangered, for most of the land in the area where it was collected has been transformed for diverse agricultural purposes.
Remarks
The few-flowered, botryoid inflorescence, tiny flowers, and very oblique, lateral openings of the sporangia distinguish this species straightaway. There is no species whose general morphology indicates association with L. gracilis. The singular way that the openings of the stamens are displayed resemble that found in Licaria cogolloi van der Werff, and L. caribaea Gómez-Lau. & Cascante, but besides this, there is no other feature that might suggest a relationship to those species. For the features of its flowers, Licaria gracilis belongs to subgenus Licaria.
Figure 8. Licaria minutiflora Lorea-Hern. sp. nov., general view.
Diagnosis. Trees similar to L. pergamentacea, but distinct by the presence of hollow twigs, glabrous buds, abaxially densely tomentulose tepals, internally pubescent hypanthium, apically pubescent ovary, and pubescent style.
Trees up to 20 m tall, trunk ca. 30 cm DBH; twigs hollow, inhabited by ants, glabrous, smooth or slightly ridged, each ridge originates at one extreme of petiole insertion, acropetal, sparsely lenticellate. Buds glabrous. Leaves alternate, petioles (7-)15-20(-30) mm, glabrous, bimarginate above, blades (11-)20-28(-34.5) × (3-)5-9(-13) cm, narrowly elliptic or narrowly ovate, pinninerved, secondary veins 9-12 pairs, leaf surface glabrous on both sides, leaf apex acute, slightly apiculate, base acute or obtuse. Inflorescences (6-)9-12(-15) cm long, axillary to tiny, deciduous bracts, on the proximal section of new twigs or axillary to leaves, paniculate, tomentulose, peduncle (0.5-)1.5-3(-4) cm long, pedicels (1.2-)2.5-4(-6) mm long, densely tomentulose. Flowers obovoid or ellipsoid, yellowish-green, tepals inflexed, outer tepals 0.5-0.8 × 0.8-1 mm, widely ovate, densely tomentulose abaxially, tepal surface concealed or almost so by hairs, glabrous adaxially, inner tepals 0.5-0.7 × 0.5-0.6 mm, ovate, densely tomentulose abaxially, glabrous adaxially, staminodes of whorls I and II absent, stamens of whorl III 0.5-0.6 mm long, free or barely united by filament base, filaments tomentose at base outside, glabrous or sparsely pubescent along the medial line inside, anthers ca. 0.2 mm, glabrous, openings apical, glands ca. 0.2 mm, free, rounded, hypanthium 0.6-0.8 mm deep, obconic, densely tomentulose outside, sericeous on upper half inside, hairs yellowish or reddish, pistil ca. 1.4 mm long, top of the ovary and style pubescent, ovary 0.8-1 mm long. Fruits ca. 19.5 × 15-16.5 mm, ellipsoid, cupule 15-16 × 18-20 mm, urceolate, lenticellate, conspicuously bimarginate, inner margin 1.2-1.5 mm tall, outer margin 1-1.2 mm, extended, pedicel 6.5-9 mm long, continuous with the cupule, 2.8-3.6 mm diameter at base.
Taxonomic summary
Type. Costa Rica. Alajuela: camino entre la estación de la Reserva Forestal de San Ramón y el camino a la colonia Palmareña, finca de don Bolívar Ruiz, margen derecha río San Lorencito, 10°12’53’’ N, 84°36’28’’ W, February 1987, G. Herrera 500 (holotype MO 3587621; isotypes MEXU 638804, TEX).
Paratypes. Costa Rica. Alajuela: Reserva Biológica Monteverde, Poco Sol, La Cutacha de San Bosco, 10°22’ N, 84°40’ W, 900 m, 1 April 1989, E. Bello 784 (MEXU 1304162; MO 6142952; XAL 124442); Bosque Eterno de los Niños, Reserva de Arenal, río Peñas Blancas, Quebrada Agua Gata, Finca Villalobos, 10°23’ N, 84°42’ W, 1,000 m, 20 April 1990, E. Bello 2208 (MO 6130824; XAL 124446); Cantón de Upala, Colonia La Libertad, 10°52’ N, 85°17’ W, 300 m, 3 August 1991, Q. Jiménez & G. Rivera 1011 (MO 6117397; XAL 124597). Guanacaste: Parque Nacional Guanacaste, Estación Pitilla, 10°00’15’’ N, 85°25.2’ W, 500 m, 27 May 1989, G. Herrera et al. 2942 (MO; XAL 124428).
Figure 9. Inflorescence detail of Licaria gracilis Lorea-Hern. sp. nov. (above), and Licaria minutiflora Lorea-Hern. sp. nov. (below). Scale bars 1 mm.
Etymology. The very small flowers, whose tepals are less than 1 mm long, is the feature on which the species name is based.
Distribution and habitat. This species is known from the northern hills of the Cordillera de Guanacaste (Guanacaste Mountain Range) and the western part of the Cordillera Central (Central Mountain Range), between 200 and1,000 m asl. Prevailing vegetation in the region is tropical evergreen forest and montane rain forest. The species has been collected also in pasture fields. There is a fruiting specimen from the Osa Peninsula (Hammel et al. 16984) that seems to belong to L. minutiflora but until confirmed with a flowering specimen, the presence of the species in this part of the country remains uncertain.
Phenology. Flowers toward the end of winter and early spring; fruits must be ripe around the end of autumn or early winter.
Conservation status. Most specimens of this species have been collected within nature reserves. Therefore, it is considered not threatened, even though its abundance is still unknown.
Remarks
As has been mentioned elsewhere in this paper, Licaria minutiflora is part of the L. excelsa species group. Its general appearance resembles that of L. pergamentacea, for the size and shape of the leaves, structure and hairiness of the inflorescence, and for having small oblong-ellipsoid, not coriaceous flowers. However, besides the presence of hollow twigs, it differs by having flowers with the upper part of the hypanthium homogeneously pubescent inside, and a pubescent pistil.
Figure 10. Licaria ochracea Lorea-Hern. sp. nov., general view.
Diagnosis. Trees similar to L. multinervis H. W. Kurz, but differing by lower surface indument of leaves composed by 2 types of hairs, the most numerous tomentulose, the fewer sericeous, long inflorescences, terminal or axillary to leaves, with rachis up to 15 cm, fully exserted anthers, clearly stalked glands, conspicuous hypanthium tube projected beyond the insertion point of stamens.
Trees up to 22 m tall, twigs smooth, densely tomentose, hairs initially yellowish-brown, then greysh, sparsely and inconspicuously lenticellate. Buds tomentose. Leaves alternate, petioles (10-)15-20 mm long, tomentose, glabrescent, channeled above, blades 12.5-18.5 × (2.5)3.5-4.5 cm, narrowly elliptic, sometimes narrowly oblanceolate, pinninerved, secondary veins (9)10-13 pairs, leaf surface glabrous above, tomentose below, most hairs sinuous, rather appressed, or patent, fewer hairs straight, appressed, leaf apex acuminate, base narrowly cuneate. Inflorescences (7-)10-18 cm long, axillary to leaves, less frequently terminal, paniculate, densely tomentose, hairs like on twigs, flowers agglomerate at the end of terminal axes, peduncle 0.2-1.5(-3.5) cm long, pedicels (1-)1.5-2 mm long, tomentose. Flowers narrowly oblong, tepals erect, concave, outer tepals, 1-1.3(-1.5) × (1-)1.1-1.3 mm, widely ovate, tomentose abaxially, glabrous adaxially, except for a few long, appressed hairs, coming from the base, inner tepals 1-1.1(-1.4) × 0.8-0.9 mm, ovate, with a pattern of pubescence similar to that of outer tepals, staminodes of whorls I and II absent, stamens of whorl III 3-3.3(-3.8) mm long, coherent along their filaments or even at the base of the anthers, easily separable, filaments tomentose on both faces, anthers 0.9-1.1 mm long, free or coherent at the base, glabrous, completely exserted, openings dorsolateral, glands 0.7-0.8 mm, free, oblanceolate, glabrous, clearly stalked, stalk pubescent, hypanthium 1.2-1.3(-1.6) mm deep, extended 0.3 mm beyond the insertion point of stamens, tomentose outside, densely hirsute-tomentose inside, hairs golden-brown, pistil 3.6-3.9 mm long, sparsely pubescent, at least some hairs on the upper half of the ovary and lower half of the style, ovary 0.9-1.1 mm long. Fruits unknown.
Figure 11. Licaria rufotricha Lorea-Hern. sp. nov., general view.
Taxonomic summary
Type. Nicaragua. Matagalpa (according to current maps it should be Jinotega): pasture and small woods, tropical premontane forest, Hacienda Santa María del Ostuma, 10 km N of Matagalpa, 1,300 m, 17 July 1978, P. C. Vincelli 756 (holotype MO 2984723; isotypes LL, MEXU 691292).
Etymology. The name refers to the conspicuous orange-brown pubescence of the species on young twigs and main axes of inflorescences.
Distribution and habitat. Only known from the place of type collection, where the Cordillera Isabelia and Cordillera Dariense meet.
Phenology. Flowers in summer; fruit season is not known, but since it has been observed that maturation of fruits in most Lauraceae takes around a year after flowering, possibly ripe fruits are present during spring or early summer.
Conservation status. There is no certainty on the conditions that might be affecting the survival of the species. The type was collected in a private property that used to be preserved for ecotourism activities, but its current situation is unknown. However, since the species has not been collected again, it is suspected to be endangered.
Remarks
The collection on which the description of this species is based was initially identified by Kurz (2000) as L. multinervis; actually it is cited as a paratype of this species. But the impression of being conspecific with this taxon disappears with a detailed survey of the morphology. Important differences are the pubescence on the lower surface of the leaves (simple in L. multinervis vs. made of 2 types of hairs in L. ochracea), position of the inflorescences (axillary to small bracts in the proximal section of new branches in L. multinervis vs. axillary to leaves or terminal in L. ochracea), length of inflorescences (up to 3.5 cm long in L. multinervis vs. 5-7 times longer in L. ochracea), protrusion of anthers (partially exserted in L. multinervis vs. fully exerted in L. ochracea), and projection of hypanthium tube beyond the insertion point of stamens (short in L. multinervis vs. conspicuous in L. ochracea). However, L. multinervis and L. ochracea seem to be more closely related to each other than to the rest of species in the area that present fully exserted stamens, namely L. agglomerata van der Werff, L. capitata (Schltdl. et Cham.) Kosterm., L. nitida van der Werff, and L. vanderwerffii (here described).
Diagnosis. Small trees, distinct for the conspicuously obovoid flowers, aggregate toward the end of the secondary floriferous axes, with inflexed tepals, glabrous abaxially, reddish-brown hirsute-sericeous adaxially, lacking staminodes, stamens fused throughout, reddish-brown hirsute, anther openings apical, hypanthium mostly glabrous outside, reddish-brown hirsute inside, and ovary distally pubescent.
Trees to 12 m tall; twigs smooth or inconspicuously ridged, each ridge originating at one extreme of petiole insertion, acropetal, lenticellate, grayish, densely puberulent, glabrescent. Buds glabrous. Leaves alternate, petioles 10-13 (-17) mm long, slightly channeled above, puberulent, blades (14.5-)16.5-20(-23) × 4-5.5(-9) cm, elliptic or narrowly elliptic, pinninerved, secondary veins 6-7 pairs, leaf surface densely puberulent above when young, glabrescent, rather persistently puberulent below, leaf apex acuminate, base cuneate, sometimes obtuse or narrowly cuneate to indistinctly attenuate. Inflorescences (3-)5-8(-10.5) cm, axillary to tiny, deciduous bracts, on the proximal section of new twigs, or axillary to new leaves, paniculate, flowers aggregate at the end of secondary axes, densely puberulent on peduncle and rachis, glabrate toward the ultimate axes, peduncle (2-)3.5-5.5(-7.5) cm long, pedicels 2-3.5(-4.5) mm long, glabrous or sparsely puberulent. Flowers obovoid or obconic, pale yellow, tepals conspicuously inflexed, outer tepals 1-1.2 × 2-2.4 mm, widely ovate, glabrous abaxially, hirsute-sericeous adaxially, hairs reddish-brown, inner tepals 0.8-1 × 0.8-0.9 mm, ovate or elliptic, glabrous abaxially, generally mostly hirsute adaxially, hairs reddish-brown, surpassing the apical margin of the tepals, making them appear fimbriate, staminodes of whorls I and II absent, stamens of whorl III, 0.6-0.7 mm long, fused throughout, filaments hirsute on both faces, hairs reddish-brown, anthers ca. 0.2 mm, pubescent, except around the margin of the openings, hairs like those of the filaments, glands ca. 0.4 mm, free, rounded or oblate, glabrous, hypanthium 0.8-0.9 mm deep, glabrous or sparsely puberulent outside, hirsute inside, hairs like those of the filaments, pistil 1.7-2 mm long, ovary ca. 0.8 mm long, sparsely pubescent distally, hairs whitish. Fruits unknown.
Figure 12. Inflorescence detail of Licaria ochracea Lorea-Hern. sp. nov. (above), and Licaria rufotricha Lorea-Hern. sp. nov. (below). Scale bars 1 mm.
Taxonomic summary
Type. Panama. Panama: 5-10 km NE of Altos de Pacora, on trail at end of road, ca. 750 m, 7 March 1975, S. Mori & J. Kallunki 4977 (holotype MO 2992664).
Etymology. The name given to this species refers to the dense red-brown pubescence in the interior of the flowers, covering the adaxial surface of tepals, stamen filaments, anthers, and hypanthium inside.
Distribution and habitat. Just known from the place where the type was collected (around 25-30 km NE of Panama City), with tropical evergreen forest or semi-evergreen forest as original vegetation.
Phenology. Flowers around the end of winter or early spring; ripe fruits expected during winter, since maturation of fruits in most Lauraceae takes around a year after flowering.
Conservation status. Probably the species is endangered. Most of the vegetation in the surroundings of the place where the species was collected has been cut down for cattle raising or agricultural purposes. But the southern boundary of the Parque Nacional Chagres (Chagres National Park) is very close to that place, and the Nature Reserve Cocobolo is a few kilometers ENE of it as well. So, even it has not been collected again, it is hoped the species is still around there.
Remarks
There is no other species in the Mesoamerican area with the distinctive reddish-brown pubescence found in the interior of the Licaria rufotricha flowers. Yellowish to reddish-brown pubescence is present on the filaments of stamens and/or inside the hypanthium of several species, like L. agglomerata, L. excelsa, L. gibbitepala, and L. tomentulosa, but it is never found on the tepals surface. In fact, its general morphology does not suggest a relation to any species in the region.
Diagnosis. Trees similar to L. alata, but differing by terminal, subsessile inflorescences, longer pedicels (up to 10.5 mm), flowers widely ellipsoid, abaxial tepal surface tomentose at the base and papillose toward the apex, hypanthium densely tomentose outside, sericeous-tomentose inside, and style pubescent.
Trees to 20 m tall, twigs glabrous, grayish to grayish-brown, slightly ridged, each ridge originating at one extreme of petiole insertion, acropetal, sparsely lenticellate. Buds glabrous or pubescent at the apex of the bud scales. Leaves alternate, petioles (11-)13-17(-20) mm long, slightly bimarginate, glabrous, blades (12.5-)20-32(-37) × (5-)7-10(11.5) cm, narrowly elliptic, occasionally oblanceolate, pinninerved, secondary veins (12)14-18 pairs, leaf surface glabrous on both sides, leaf apex acuminate, sometimes acute, base obtuse or acute. Inflorescences 12-22 cm long, terminal, paniculate, tomentose, soon glabrescent, hairs patent or oblique, grey or yellowish-grey, peduncle 0.2-0.4 cm long, pedicels (3-)5-8(-10.5) mm long, glabrous or sparsely tomentose. Flowers broadly ellipsoid, pale green, tepals inflexed, outer tepals 0.8-0.9 × 1.8-2 mm, very widely ovate, concave, tomentose over the basal half, and papillose-pubescent over the distal half abaxially, glabrous or with few straight hairs at base adaxially, inner tepals 0.7-0.9 × 0.4-0.8 mm, ovate, pubescence pattern abaxially like that of outer tepals, but less papillose, glabrous adaxially, staminodes of whorls I and II absent, stamens of whorl III 0.7-0.9 mm long, fused along their filaments, filaments tomentose along the central line on both faces, anthers 0.2-0.4 mm long, glabrous, openings apical, glands ca. 0.4 mm, oblong, flattened, frequently reduced or absent, glabrous or tomentose on the base abaxially, hypanthium ca. 1 mm deep, densely tomentose outside, hairs sinuous, sericeous-tomentose inside, pistil 1.3-1.6 mm long, ovary 0.8-1.2 mm long, glabrous, style rather densely pubescent. Fruits 27-30 × 17-18 mm, ellipsoid, cupule 15-17.5 × 18-19.5 mm, urceolate, bimarginate, but the margins barely discernible, ca. 0.5 mm, erect, pedicel 4-5 × 3.5-4.5 mm.
Figure 13. Licaria sarukhanii Lorea-Hern. sp. nov., general view.
Taxonomic summary
Type. Mexico. Chiapas: municipio de Ángel Albino Corzo, Reserva de la Biosfera El Triunfo, aprox. 1.5 km al E de Campamento El Triunfo, sobre el Sendero Bandera, 15°36’ N, 92°50’ W, 1,850 m, 27 April 1993, F. Lorea 5522 (holotype XAL 151063; isotypes [to be distributed]).
Paratypes. Mexico. Chiapas: municipio de Ángel Albino Corzo, Polígono I de la Reserva de la Biosfera El Triunfo, 15°39’ N, 92°48’ W, 1,900 m, 21 February 1993, S. Solórzano 67 (MEXU 754117); Reserva El Triunfo, camino a Cerro de la Bandera, 25 March 1986, M. L. Ávila and V. H. Hernández s/n (MEXU 877857, TEX 146383); Reserva de la Biosfera El Triunfo, sendero Palo Gordo, 15°40’10’’ N, 92°48’42’’ W, 1,990 m, 22 March 2006, F. González-García s/n (XAL 113841).
Etymology. The species is dedicated to José Sarukhán, a Mexican plant ecologist who has played an important role in making a huge amount of information about Mexico’s biodiversity, ecosystem conservation, and sustainable development accessible to the public.
Distribution and habitat. So far, the species is known only from the central region of the Sierra Madre de Chiapas, from 1,800 to 2,000 m asl where the montane rain forest is the dominant type of vegetation.
Phenology. Flowers toward the end of winter and early spring; ripe fruits were found in the same interval of time.
Conservation status. All the collections of the species come from the nature reserve El Triunfo, located in the Sierra Madre de Chiapas, which has persisted largely undisturbed for its almost forty years of existence. Thus, considering the size of the area covered with montane rain forest in the reserve, the species might be regarded as vulnerable.
Remarks
Licaria sarukhanii is part of the L. excelsa species group, with a closer relation to L. breedlovei, because they share tomentose inflorescences and flowers rather widely ellipsoid to obloid. They differ by the conduplicate leaf bases, sparsely sericeous lower leaf surface, conspicuously pedunculate inflorescences axillary to small bracts or leaves, fused anthers, and style sparsely pubescent present in L. breedlovei, in contrast to flat leaf base, glabrous lower leaf surface, terminal, sub-sessile inflorescences, free anthers, and conspicuously pubescent style in L. sarukhanii.
Figure 14. Licaria tomentulosa Lorea-Hern. sp. nov., general view.
Diagnosis. Trees similar to L. excelsa, but distinguished by presenting hollow twigs, inflorescences yellowish-brown tomentulose, flowers conspicuously obovoid, tepals densely tomentulose abaxially, and apex of the ovary and style conspicuously pubescent.
Trees up to 25 m tall, and trunk 50 cm DBH, twigs hollow, inhabited by ants, smooth or slightly ridged, glabrous, grayish-brown, sparsely lenticellate. Buds glabrous. Leaves alternate, petioles (14-)17-22(-24) mm long, bimarginate above, glabrous, blades (22-)25-30(-34) × (6-)8-10(-12) cm, narrowly elliptic or elliptic, pinninerved, secondary veins (9)11-13 pairs, leaf surface glabrous on both sides, leaf apex acute or short acuminate, base obtuse, rounded or shortly attenuate, particularly in leaves close to the twig tips. Inflorescences 6.5-9.5(13.5) cm long, axillary to tiny, deciduous bracts, on very short branches axillary to leaves, paniculate, tomentulose, hairs yellowish-brown, peduncle 2.5-4 cm long, pedicels (1-)2-3.5 mm long, densely tomentulose. Flowers obovoid, thick, coriaceous, greenish-yellow, tepals inflexed, concave, outer tepals 0.7-1 × 1.4-1.7 mm, widely ovate, densely tomentulose abaxially, hairs almost concealing the surface, marginal tomentose bands and some long, appressed hairs at the base adaxially, inner tepals 0.6-0.9 × 0.8-0.9 mm, ovate, sometimes slightly conduplicate, densely tomentulose abaxially, pattern of pubescence adaxially like in the outer tepals, staminodes of whorls I and II absent, stamens of whorl III 0.8-1.1 mm long, fused throughout, filaments tomentose outside on lower half, densely tomentose all over the inner face, hairs reddish-brown, anthers ca. 0.2 mm, glabrous outside, densely tomentose inside, openings apical, glands 0.3-0.4 mm, frequently fused between adyacent stamens, transversely oblong, oblong when free, hypanthium 1-1.2 mm deep, densely tomentulose outside, tomentulose inside, sometimes only in the upper half, hairs mainly reddish-brown, pistil 2-2.3 mm long, ovary 1.1-1.4 mm long, apex of the ovary and style conspicuously pubescent. Fruits (not fully ripe) ca. 13 × 13 mm, spheroidal, cupule 13-14 × 17-18 mm, crateriform, lenticellate, bimarginate, inner margin 0.7-1 mm tall, erect, outer margin 0.5-0.7 mm, erect to spreading, pedicel 4-6 × 3-4 (apex) and 2 mm (base).
Taxonomic summary
Type. Costa Rica. Limón: Cordillera de Talamanca, Matina, intersección de río Barbilla y quebrada Cañabral, por la fila al norte, 10°01’ N, 83°24’ W, 100-200 m, 11 October 1988, G. Herrera 2165 (holotype MO 3693485; isotypes MEXU 529888, 529889, 717774, and 718334; TEX).
Paratypes. Costa Rica. Alajuela: Upala, Bijagua, El Pilón, Cerro La Carmela, entre río Celeste y cabeceras del río Chimurria, 10°43’15’’ N, 84°59’45’’ W, 1,000 m, 11 July 1988, G. Herrera 2056 (MEXU 529875, 717781; MO 3693486; US 3655515). Limón: Reserva Biológica Hitoy Cerere, Valle de la Estrella, sendero a Cerro Bobócara, 9°41’00’’ N, 83°04’20’’ W, 798 m, 17 August 1990, G. Herrera 4115 (MEXU 1304090; MO 6142953; XAL 124444); Reserva Indígena Talamanca, camino a Soki entre la Quebrada Amubri, margen izquierda de río Lari, 9°29’40’’ N, 82°89’40’’ W, 200 m, 29 June 1989, A. Chacón 25 (MO; XAL 124437).
Etymology. The name is for the abundant tomentulose pubescence that covers the axes of the inflorescence, as well as the abaxial surface of tepals and hypanthium.
Distribution and habitat. Known only from Costa Rica, along the Atlantic lowlands adjacent to the Sierra de Talamanca, and the Sierra de Guanacaste. Tropical rain forest used to be the predominant vegetation there, but currently a big amount of land has been changed to agricultural activities or other affairs.
Phenology. Flowers in summer and early autumn; ripe fruits in summer.
Conservation status. Given the deterioration of the habitat, the species might be considered vulnerable or endangered, in spite of its wide range of distribution.
Remarks
Licaria excelsa and L. tomentulosa are much alike. Considering the available material, distinguishing characters seem to work well to separate both species; hollow twigs, as well as type and distribution of pubescence on vegetative and floral parts, are consistently present in all the specimens considered as L. tomentulosa, making it a clear morphological unit, distinct from L. excelsa.
Figure 15. Inflorescence detail of Licaria sarukhanii Lorea-Hern. sp. nov. (above), and Licaria tomentulosa Lorea-Hern. sp. nov. (below). Scale bars 1 mm.
Diagnosis. Similar to L. agglomerata, but different by the free stamens, white pubescence of stamens, hypanthium densely white tomentose inside, and pistil glabrous.
Shrubs or small trees 1-3 m tall, twigs hollow, smooth, sparsely lenticellate, glabrous, reddish-brown. Buds glabrous. Leaves alternate, petioles ca. 12.5-15 mm long, slightly channeled and bimarginate above, glabrous, blades ca. 15-23 × 6-7.5 cm, narrowly elliptic, pinninerved, secondary veins 9-11 pairs, leaf surface glabrous on both sides, leaf apex acuminate, base obtuse or cuneate. Inflorescences ca. 1.5-2 cm long, axillary to leaves, axillary to tiny, deciduous bracts, on the proximal sections of new twigs too, paniculate, but strongly condensed, with very short rachis and secondary axes, peduncle ca. 0.5 cm long, glabrous, pedicels (1.2-)1.5-2.5(-3) mm long, glabrous. Flowers ellipsoid, slightly swollen in the middle of the hypanthium, greenish, tepals erect, outer tepals 0.5-0.6 × 0.5-0.6 mm, ovate, glabrous abaxially, glabrous adaxially except for some sericeous hairs at the base, inner tepals 0.4-0.5 × 0.2-0.3 mm, ovate, glabrous abaxially, glabrous adaxially or with some sericeous hairs at the base, staminodes of whorls I and II absent, stamens of whorl III 1-1.2 mm long, free, filaments white-tomentose throughout, denser on inside, anthers 0.3-0.4 mm, wholly exserted, glabrous or sparsely tomentose at the base outside, tomentose on lower half inside, openings dorsal, glands absent, hypanthium 1.1-1.3 mm deep, narrowly rhomboid, extending a little beyond the insertion point of stamens, glabrous outside, densely white-tomentose inside, pistil 2-2.3 mm long, glabrous, ovary 1-1.2 mm. Fruit unknown.
Figure 16. Licaria vanderwerffii Lorea-Hern. sp. nov., general view.
Taxonomic summary
Type. Panama. Darién: Cerro Tacarcuna S slope, 1,250-1,450 m, 26 January 1975, A. Gentry & S. Mori 13920 (holotype MO 2300651; isotype F 1763407).
Etymology. The species is named after Hendrik (Henk) Hessel van der Werff, a prolific scholar of the family Lauraceae in the Neotropics.
Distribution and habitat. So far, only known from the type collection, in the mountains of the southeastern edge of Panama, where premontane rain forest prevails.
Phenology. Flowers in winter; probably ripe fruits expected during autumn or early winter, since maturation of fruits in most Lauraceae takes around a year after flowering.
Conservation status. The place of the type collection is within the boundaries of the nature reserve Parque Nacional del Darién, but the altitudinal range within which the specimen was collected stretches barely for 40 km along the reserve. So, the species should be considered endangered.
Remarks
The collection on which the description of L. vanderwerffii is based was cited by Kurz (2000) as L. triandra, but there are several features that separate the former from this species. Whereas L. triandra presents branchlets solid, paniculate inflorescences (up to 6 cm long), stamens fused throughout (or almost so), glands at the base of filaments, anthers partially exserted, and hypanthium glabrous inside, L. vanderwerffii has hollow branchlets, sub-capitate inflorescences (up to 2 cm long), stamens free, no glands at the base of filaments, anthers wholly exserted, and hypanthium densely white tomentose inside.
Figure 17. Inflorescence detail of Licaria vanderwerffii Lorea-Hern. sp. nov. Scale bar 1 mm.
This species is closely related to L. agglomerata; both present small, glomerate inflorescences, ellipsoid to narrowly rhomboid flowers with erect tepals, no staminodes, fully exserted stamens, no glands on filaments, pubescent stamens, and hypanthium tomentose within. However, L. vanderwerffii differs by having stamens free throughout, white tomentum on stamens and (densely on) inner face of hypanthium, and glabrous pistil, against stamens fused by their filaments, brownish-orange tomentum on stamens and upper part of hypanthium inside (sometimes completely glabrous), and puberulent style in L. agglomerata. It is worth to mention that they differ in ecological conditions as well; while L. agglomerata grows in lowland habitats (200-700 m), L. vanderwerffii is a mountain dweller above 1,200 m.
Acknowledgements
I would like to thank the curators of the herbaria cited in the Materials and methods section for allowing the study of specimens of Licaria in their collections. I also thank Jens Rohwer and an anonymous reviewer for their comments and calling my attention to several slips and wrong phrasing in some paragraphs. Eva Piedra assisted me with the preparation of figures. Phil Brewster kindly reviewed the final english version of the manuscript. I thank one of the reviewers who suggested to include the following exsiccata as part of the studied material for several of the species described here, however, it was not possible to see the specimens. So even they correspond to duplicates of the studied material, they are cited here just as a reference for researchers who might need to study them.
L. breedlovei; D. Breedlove 50394, isotype TEX 472525.
L. dolichopoda; B. Hammel et al. 16790, isotypes CR 147811 and CR 2918355; E. Bello & E. Cruz 4262, paratype CR 1596155; G. Herrera 4000, paratype CR 1596509; G. Herrera 4510, paratypes CR 159602, CR 176525 and CR 1561583; J. Marín & G. Marín 499, paratype CR 1596363.
L. gibbitepala; G. Herrera & A. Chacón 2427, isotype CR 1596536.
L. minutiflora; G. Herrera 500, isotype CR 151205; E. Bello 784, paratype CR 1513414; E. Bello 2208, paratype CR 1596135; Q. Jiménez & G Rivera 1011, paratypes CR 1561584 and CR 157780; G. Herrera 2942, paratype CR 1596539.
L. tomentulosa; G. Herrera 2165, isotypes CR 146925 and CR 2921047; G. Herrera 2056, paratypes CR 147034, and CR 2920969; G. Herrera 4115, paratypes CR 1596519, and CR 207025; A. Chacón 25, paratype CR 1596195.
References
Burger, W., & van der Werff, H. (1990). Flora Costaricensis. Family 80 Lauraceae. Fieldiana, Botany, n. s., 23, 1–129.
Gómez-Laurito, J., & Cascante, A. (1999). Licaria caribaea (Lauraceae): a new species from the Caribbean lowlands of Costa Rica. Novon, 9, 199–201. https://doi.org/10.2307/3391798
Gómez-Laurito, J., & Estrada, A. (2002). Licaria leonis (Lauraceae), una nueva especie del Pacífico costarricense, y algunas notas sobre Licaria multinervis H. Kurz. Lankesteriana, 3, 5–9. https://doi.org/10.15517/lank.v2i1.23136
Hammel, B. E. (1986). New species and notes on Lauraceae from the Caribbean lowlands of Costa Rica. Journal of the Arnold Arboretum, 67, 123–136. https://doi.org/10.5962/bhl.part.27389
Kostermans, A. J. G. H. (1937). Revision of the Lauraceae II. The genera Endlicheria, Cryptocarya (American species) and Licaria. Recueil des Travaux Botaniques Néerlandais, 34, 500–609.
Kurz, H. W. (1983). Fortpflanzungsbiologie einiger Gattungen neotropischer Lauraceen und Revision der Gattung Licaria (Lauraceae) (Ph.D. Thesis). University of Hamburg, Germany.
Kurz, H. W. (2000). Revision der Gattung Licaria (Lauraceae). Mitteilungen aus dem Institut für Allgemeine Botanik in Hamburg, 28/29, 89–221.
Mez, C. (1889). Lauraceae americanae. Jahrbuch des Königlichen Botanischen Gartens und des Botanischen Museums zu Berlin, 5, 1–556.
Radford, A. E., Dickison, W. C., Massey, J. R., & Bell, C. R. (1974). Vascular plant systematics. New York: Harper & Row.
Van der Werff, H. (1988). Eight new species and one new combination of Neotropical Lauraceae. Annals of the Missouri Botanical Garden, 75, 402–419. https://doi.org/10.2307/2399431
Van der Werff, H. (2009). Nine new species of Licaria (Lauraceae) from tropical America. Harvard Papers in Botany, 14, 145–159. https://doi.org/10.3100/025.014.0206
José Ángel Zamarripa-Fernández a, b, *, Ismael Hinojosa-Díaz c, Moisés Armando Luis-Martínez d, Ricardo Ayala a
a Universidad Nacional Autónoma de México, Instituto de Biología, Estación de Biología Chamela (Sede Colima), Km 59, Carr. Fed. 200, Melaque – Pto. Vallarta, La Huerta, 48895 Chamela, Jalisco, Mexico
b Universidad Nacional Autónoma de México, Posgrado en Ciencias Biológicas, Edificio D, 1°Piso, Circuito de Posgrados, Ciudad Universitaria, Coyoacán, 04510 Ciudad de México, Mexico
c Universidad Nacional Autónoma de México, Instituto de Biología, Departamento de Zoología, 3er. Circuito Exterior s/n, Ciudad Universitaria, Coyoacán, 04510 Ciudad de México, Mexico
d Universidad Nacional Autónoma de México, Facultad de Ciencias, Departamento de Biología Evolutiva, Museo de Zoología “Alonso L. Herrera”, Circuito Exterior s/n, Ciudad Universitaria, Coyoacán, 04510 Ciudad de México, Mexico
A taxonomic revision of the cleptoparasitic bee genus Mesoplia Lepeletier, 1841 from Mexico and Central America is presented. We recognize 4 new species, resulting in a total of 10 species for the study area: Mesoplia (Mesoplia) insignis (Smith, 1879), M. (M.) sapphirina Melo & Rocha-Filho, 2011, M. (M.) regalis (Smith, 1854), M. (M.) dugesi (Cockerell, 1917), M. (M.) rufipes (Perty, 1933), M. (M.) veracruzana sp. nov., M. (M.) oaxacana sp. nov., M. (M.) tica sp. nov., M.(Eumelissa) ornata (Spinola, 1841)and M.(E.) carmelitae sp. nov. We propose the following synonymies: M. imperatrix (Friese, 1913) = M. (M.) insignis, and M. guatemalensis (Cockerell, 1912) = M. (M.) rufipes. We describe the previously unknown female of M. (M.) dugesi and provide diagnoses for both sexes based on the holotype. An identification key for the species, illustrations, distributional records (available as supplementary material), and lists of hosts and floral associations are provided.
Revisión taxonómica y distribución de las abejas cleptoparásitas del género Mesoplia (Apidae: Ericrocidini) de México y Centroamérica
Resumen
Se presenta una revisión taxonómica del género de abejas cleptoparásitas Mesoplia Lepeletier de México y Centroamérica. Se reconocen 4 especies nuevas, dando un total de 10 especies para el área en estudio: Mesoplia (Mesoplia) insignis (Smith, 1879), M. (M.) sapphirina Melo & Rocha-Filho, 2011, M. (M.) regalis (Smith, 1854), M. (M.) dugesi (Cockerell, 1917), M. (M.) rufipes (Perty, 1933), M. (M.) veracruzana sp. nov., M. (M.) oaxacana sp. nov., M. (M.) tica sp. nov., M. (Eumelissa) ornata (Spinola, 1841) y M. (E.) carmelitae sp. nov. Se encontraron las siguientes sinonimias: M. imperatrix (Friese, 1913) = M. (M.) insignis y M. guatemalensis (Cockerell, 1912) = M. (M.) rufipes. Se describe la hembra de M. (M.) dugesi, previamente desconocida, y se proporcionan las diagnosis para ambos sexos basados en el tipo. Se aportan una clave de identificación de las especies, ilustraciones, registros de distribución (disponible como material complementario), una lista de huéspedes y asociaciones florales.
The tribe Ericrocidini is composed mainly of cleptoparasitic bees that have Neotropical affinity, with the exception of the genus Ericrocis Cresson, 1887, which is Nearctic (Martins et al., 2018). The greatest diversity occurs in the Amazon region (Silveira et al., 2002; Snelling & Brooks, 1985). Their known hosts are species of the tribe Centridini (Rocha-Filho et al., 2009). The most easily recognizable morphological character of the tribe is the large, bifurcate or multidentate apex of the middle tibial spur (Michener, 2007).
The genus Mesoplia Lepeletier, 1841 is the richest in the tribe with 19 described species (Table 1), although it is estimated that it could include more species (Rozen et al., 2011). It is distributed from northern Mexico (Sinaloa and Tamaulipas) to Argentina (Snelling & Brooks, 1985). Mesoplia is recognized by the following characters: internal orbits more or less parallel; presence of 2 tubercles on the scutellum of variable development; meso and metabasitarsus without lateral patches of short, flattened setae; tiny metallic scales blue or green, mainly in the dorsal area of the metasoma, frequently also with patches of yellowish or whitish pubescence; S5 of male evidently emarginated and hidden under S4 (Genaro & Breto, 2022; Michener, 2007; Snelling & Brooks, 1985; Vivallo, 2010).
The subgeneric classification was proposed by Snelling and Brooks (1985). They proposed 2 subgenera based on morphological characters, Mesoplia and Eumelissa. Males of the former have posterior tibial spurs that do not extend beyond the basal third of the basitarsus, the posterior tibia has an internal distal patch of setae and S5 evidently emarginate and hidden under S4. Females of the same subgenus have a broad pygidial plate, which occupies the exposed dorsal surface of T6, covered with setae or scales and dorsal surface of posterior coxa angulate or carinate at the junction with the lateral surfaces. In contrast, males of the subgenus Eumelissa have long posterior tibial spurs reaching to or beyond middle of basitarsus. Females of the same subgenus have narrow pygidial plate, does not completely occupy the exposed dorsal surface of T6, without scales or setae and dorsal surface of posterior coxa abruptly rounded at the junction with lateral surfaces (Michener, 2007). Furthermore, Moure (1960a, b) recognizes 2 groups: bifrons and azurea, both of which are part of the subgenus Mesoplia s. str.Males of the bifrons grouphave conspicuous hind tibia setal brush, 2 spurs on the posterior tibia, ventral basal surface of posterior femur without a robust posterior projection. Females have pronotum without a carina extending laterally from the pronotal collar to the pronotal lobe.On the other hand, males of the azurea grouphave inconspicuous hind tibia setal brush, 1 spur on the posterior tibia and ventral basal surface of posterior femur with a robust posterior projection. Females of this group have pronotum with a carina extending laterally from the pronotal collar to the pronotal lobe.
The known hosts include several species of Centridini (Rocha-Filho et al., 2009). For Mesoplia, as in the rest of the tribe, the biology of most species is practically unknown and their geographical distribution uncertain, since some of the information available in the literature is based on mistaken identifications (Vivallo, 2014).
In this work we update the knowledge of the species of Mesoplia forMexico and Central America, providing diagnoses, descriptions, distributional data, identification keys, and a summary of floral and host records. We describe 4 new species and establish 2 new synonyms.
Materials and methods
We reviewed 363 specimens from the following collections where studied specimens are deposited (names of curators and/or collection managers are in parentheses): EBCh, Estación de Biología Chamela, IBUNAM, Jalisco, Mexico (R. Ayala Barajas); CNIN, Colección Nacional de Insectos, Instituto de Biología, UNAM, Mexico City (I.A. Hinojosa Díaz); MZFC, Museo de Zoología “Alfonso L. Herrera”, Facultad de Ciencias, UNAM, Mexico City (M.A. Luis Martínez); CZUG, Centro de Estudios en Zoología, CUCBA, Universidad de Guadalajara, UDG, Jalisco, Mexico (José Luis Navarrete, Hugo Fierros); HFL, Colección Particular de Hugo Eduardo Fierros López, Jalisco, Mexico (Hugo Fierros); IEXA, Colección Entomológica del Instituto de Ecología, A.C., INECOL, Veracruz, Mexico (Jorge E. Valenzuela, Viridiana Vega); ECOAB, Colección de Abejas de El Colegio de la Frontera Sur, Chiapas, Mexico (Rémy Vandame, Jorge A. Mérida Rivas, Philippe Sagot); CER-UADY, Colección Regional Entomológica de la Universidad Autónoma de Yucatán, UADY, Yucatán, Mexico, (Virginia Meléndez Ramírez, María José López Gómez); SEMC, Snow Entomological Collection, Division of Entomology, University of Kansas Natural History Museum, KU, Lawrence, Kansas, USA (Zachary Falin, Michael Engel, Rachel Osborn); MNCR, Museo Nacional de Costa Rica, Heredia, Costa Rica (Maricelle Méndez, Marcela Sánchez); MZUCR, Museo de Zoología, Universidad de Costa Rica, San José, Costa Rica (Mauricio Fernández, Paul Hanson); CINAT, Centro de Investigaciones Apícolas Tropicales, Universidad Nacional de Costa Rica, UNA, Heredia, Costa Rica (Mario Gallardo, Eduardo Herrera).
Table 1
Recognized species of Mesoplia Lepeletier, 1841. * New synonyms.
Dominica, Guadeloupe, Martinique and Saint Vincent
Mesoplia chalybaea (Friese, 1912)
Both
Brazil
Mesoplia dugesi (Cockerell, 1917)
Both
Mexico
Mesoplia guatemalensis (Cockerell, 1912)*
–
–
Mesoplia oaxacana sp. nov.
Female
Mexico
Mesoplia rufipes (Perty, 1833)
Both
Mexico to South America
Eumelissa
Mesoplia alboguttata (Ducke, 1905)
Both
Bolivia and Brazil
Mesoplia carmelitae sp. nov.
Both
México and Costa Rica
Mesoplia decorata (Smith, 1854)
Both
Brazil, Ecuador, Guatemala, Panama and Venezuela
Mesoplia friesei (Ducke, 1902)
Both
Brazil, Colombia and Paraguay
Mesoplia guedesii (Ducke, 1902)
Female
Brazil
Mesoplia ornata (Spinola, 1841)
Both
Mexico to French Guiana
Type specimens of M. sapphirina were studied. For the rest of the species high-resolution images of holotypes were available, which allowed verification of the species that were delimited and that had been previously described: for M. insignis (both sexes)and M. regalis on the website of the Natural History Museum (London, England); the holotype of M. dugesi on the website of the National Museum of Natural History, Smithsonian Institution (Washington D.C., USA); for M. imperatrix images of holotype from the Museum für Naturkunde (Berlin, Germany) were provided by Stefanie Krause; and the holotype images of M. guatemalensis from the American Museum of Natural History (New York, USA) were provided by Corey Smith. Delimitation of other species followed original descriptions and specimens previously identified by taxonomists who worked with the genus and compared their specimens with types deposited in the mentioned collections. Due to the morphological characteristics of the species of this genus, it is possible to be certain of their identification.
Morphological terminology follows Michener (2007); for integument sculpture we follow Harris (1979). Metasomal terga and sterna are designated as T and S respectively, numbered from anterior to posterior. We used F for antennal flagellum, with F1 following the pedicel. Male genitalia were dissected along with S7 and S8. The subgeneric classification follows Snelling and Brooks (1985) and the classification of groups follows Moure (1960a). All measurements are given in millimeters (mm). Images for most of the structures and habitus were taken with a Leica MC 170 HD camera adapted to a Leica M205C stereoscopic microscope except some of the habitus photographs were taken with a Cannon EOS 70D DSLR camera and a Canon EF-S 60 mm macro lens. For Mesoplia tica sp. nov., images were taken using an Olympus DP74 camera attached to an Olympus SZX16 stereoscopic microscope. Images were processed with Adobe Photoshop CS5®, Photopea.com, HeliconSoft and Leica Application Suite. The scale bar indicates 0.5 mm in the genitalia images. Distribution maps were produced from specimen locality data (available as supplementary material) using QGis software and the base map of Esri Physical and were prepared by the first author. Geospatial coordinates are presented in DMS. Plant associations were based on the information present in the specimen label. For the cleptoparasite-host associations we reviewed and compiled the published information categorized following Rocha-Filho et al. (2009).
Description
We recognize 10 species of Mesoplia for Mesoamerica; 4 are new to science herein described and illustrated. In addition, 2 synonyms are recognized, Mesoplia imperatrix (Friese, 1913) = M. insignis (Smith, 1854) and M. guatemalensis (Cockerell, 1912) = M. rufipes (Perty, 1833).
Genus Mesoplia Lepeletier, 1841
Mesoplia Lepeletier, 1841: 457. Type species: Mesocheira azurea Lepeletier & Serville, 1825: Museo Regionale di Scienze Naturale, Torino, Italy (♀♂), monobasic.
Melissa Smith, 1854: 279. Type species: Mesocheira azurea Lepeletier & Serville, 1825, designated by Sandhouse, 1943: 570.
Diagnosis. Maxillary palps elongated, with 3 or 4 segments; internal orbits more or less parallel; scutellum bituberculate (in some species not very evident); medial basitarsus with a flattened distal process on the posterior margin, more evident in females (Figs. 1, 2); dorsal region of the metasoma covered with tiny scales that give it a metallic blue or green color, regularly with small patches of yellow or white pubescence; S5 of the male evidently emarginate and hidden under S4; body length from 10 to 25 mm.
Subgenus Mesoplia Lepeletier, 1841
Diagnosis. Male: distal inner surface of the posterior tibia with a setal brush, not very evident in some species (Fig. 3A-E); hind tibial spurs not reaching beyond basal third of basitarsus, some species with only 1 spur present. Female: pygidial plate broad, occupying the exposed dorsal surface of T6; pygidial plate covered with scales or setae (Fig. 4A-G); dorsal surface of posterior coxa angulate or carinate at the junction with the lateral surfaces.
M. bifrons group(sensu Moure, 1960a, b)
Diagnosis. Male: hind tibia with setal brush conspicuous (Fig. 3A-C) and 2 spurs; posterior femur with ventral basal margin without a robust posterior projection; posterior basitarsus with inner surface without a longitudinal carina. Female: without a carina between pronotal collar and the pronotal lobe (Fig. 5A).
Mesoplia (Mesoplia) insignis (Smith, 1879)
(Figs. 3A, 4A, 5A, 6, 7A, 8-10, 35)
Melissa insignis Smith, 1879: 108. Syntypes: British Museum Natural History, London, England (♀♂). Type locality: Mexico, Veracruz, Orizaba.
Melissa imperialis Friese, 1912: 205. Holotype: Museum für Naturkunde, Berlin, Germany (♀). Type locality: Mexico, Morelos. New junior synonym.
Melissa imperatrix Friese, 1913: 89. nom. nov. for Melissa imperialis Friese, 1912. New junior synonym.
Melissa imperatrix Friese, 1921: 266. nom. nov. for Melissa imperialis Friese, 1912. New junior synonym.
Diagnosis. Male: metallic greenish body, with pubescence on head and mesosoma mostly bright yellow; integument of antenna, pronotal lobe, tegula and legs black; scutellar tubercles conical, inconspicuous due to dense pubescence (Fig. 6D), with perceptible cleft between them; robust forked medial tibial spur, with dark integument, wide anterior projection and with between 2 and 4 internal teeth; pubescence of the terga mainly whitish with a spot of bright yellow pubescence on both lateral margins of T1, at least also present in T2 (Fig. 6A); surface of T7 without scales but with black pubescence; apex of T7 slightly forked, both apices truncated and bare at tip (Fig. 7A); S4 shallowly emarginate, with several rows of compound pubescence on the apical margin, dark in color in the center and becoming light at the laterally; digitiform lobe of the gonostylus triangular and broad, projecting upwards (Fig. 8C, D).
Figure 1. Middle leg basitarsus, male: A, Mesoplia (M.) sapphirina. B, Mesoplia (M.) dugesi. C, Mesoplia (M.) rufipes. D, Mesoplia (E.) carmelitae sp. nov. E, Mesoplia (E.) ornata.
Female: body dark metallic blue and black pubescence, but with some small patches of whitish pubescence behind the antennal area, preoccipital area, lateral margins of the scutum to the level of tegula, and lateral margins of S2-S4 (Fig. 9A-C); black integument on antenna pronotal lobe, tegula and legs; scape with dark metallic blue; integument of scutum and tegula with scales that give a dark metallic blue appearance; scutellar tubercles mamilliform; tergal pubescence mainly dark; ventral surface of mesosoma and metasoma with metallic blue scales; middle tibial spur robust with black integument, forked, anterior projection with 1 to 4 internal teeth; pygidial plate with a broad and quadrangular apex, without scales on the surface, with blackish pubescence that does not reach the apex, black integument (Fig. 4A).
Variation. Some females from Morelos with white setae on lateral edges of the labrum and posterolateral edges of the propodeum. Pubescence and the presence of metallic scales in some body areas of males seem to be relatively variable, labral setae can be yellow, whitish or dark; the clypeus may have yellow setae or metallic blue scales, as well as the dorsal surface of the scutellar tubercles.
Material examined. Mexico: Jalisco: 22.5 km al NE de Magdalena, 20°58’46.17” N, 104°6’52.33” W, 1,066.8 m, 19-VII-1953, Univ. of Kans. Mex. Exped., 1♂ (SEMC 1254912); Tala, Bosque Escuela, 20°35’44.9988” N, 103°38’15” W, 1,499 m, 7-IX-2012, H. E. Fierros-López, 1♀ (CZUG); ANP Bosque la Primavera, S. Nopales, 20°36’3.4” N, 103°38’20.4” W, 1,500 m, 26-IX-2013, O. Serrano-Pineda, 1♀ (CZUG); Tequila, Volcán de Tequila, 20°51’52” N, 103°50’36” W, 1,300 m, 29-VII-1995, H. E. Fierros-López, 1♀ (CZUG 580); 20°49’36” N, 103°50’45” W, 1,300 m, 29-VIII-1995, H. E. Fierros-López, 1♀ 1♂ (HFL), 20°51’36” N, 103°51’0” W, 1,370 m, 12-VI-2022, K. Sanchez, 1♂ (ECOAB 87968); Tlajomulco de Zúñiga, Fraccionamiento Nueva Galicia coto Valencia, 20°34’39” N, 103°26’40” W, 1,618 m, 24-IX-2022, J. A. Zamarripa-Fernández, C. Sánchez-Bastidas e I. I. Alfaro-Ríos, 5♀ (CZUG); Zapopan, Barranca la Experiencia, 20°57’42.804” N, 103°24’5.292” W, 1,300 m, 14-IX-1996, G. Mercado, 1♀ (CZUG 1112), 1♂ (CZUG 1113), 22-VIII-2009, G. Mercado, 1♀ (CZUG EXP0440), 1♂ (CZUG EXP0446), 5-IX-2009, G. Mercado, 1♂ (CZUG EXP0445), 1,350 m, 29-VII-2009, G. Mercado, 1♂ (HFL), 29-VII-2009, G. Mercado, 1♂ (CZUG); Parque ecológico Huilotán, 20°57’42.804” N, 103°24’5.292” W, 1,121 m, 7-IX-2023, J. A. Zamarripa-Fernández, C. Morales & J. M. Sandoval, 3♀ 4♂ (CZUG). Morelos: Jojutla de Juárez, Cerro del Higuerón, 18°34’0.3876” N, 99°9’55.2816” W, 1,060 m, 26-VII-1981, C. Deloya, 1♀ (MZFC 28612); Yautepec de Zaragoza, 18°50’55.6116” N, 99°4’42.0888” W, 1,249 m, 15-XI-1980, J. M. Labougle, 4♀ (CNIN 3042-3045) 2♂ (CNIN 3046; 3047). Oaxaca: Santo Domingo Tehuantepec, 17 km W of Tehuantepec, 16°21’59.328” N, 95°22’59.088” W, 8-IX-1965, D. Janzen, 2♂ (SEMC 1254910; 1254911).
Distribution. This species is endemic to Mexico and distributed from the center of country to the north of the Isthmus of Tehuantepec (Fig. 10) between 1,060-1,616 m of altitude, a distribution that corresponds to the Trans-Mexican Volcanic Belt and Sierra Madre del Sur.
Figure 3. Hind leg, male: A, Mesoplia (M.) insignis. B, Mesoplia (M.) tica sp. nov. C, Mesoplia (M.) sapphirina. D, Mesoplia (M.) dugesi. E, Mesoplia (M.) rufipes. F, Mesoplia (E.) carmelitae sp. nov. G. Mesoplia (E.) ornata.
Taxonomic comments. This species is morphologically similar to Mesoplia tica sp. nov. Males differ in the apex of T7 slightly forked with both apices truncated and bare at tip (Fig. 7A), and the pubescence of the mesosoma almost entirely bright yellow (Fig. 6). The female pygidial plate has a broadly quadrangular apex, with blackish pubescence on the surface (Fig. 4A), and the scutellar tubercles are less projected upward than in Mesoplia tica sp. nov.
Diagnosis. Male: metallic greenish body, with bright yellow pubescence on the clypeus, anterior surface of the mesepisternum, pronotal lobe, anterior region of the scutellar disc, posterior region of the scutellum, scutellum and lateral areas of the propodeum (Fig. 11); tegula with black setae on inner anterior and posterior edge; scutellar tubercles conical and strongly projecting upwards, with a perceptible cleft between them; robust forked medial tibial spur, with blackish integument, wide anterior projection and with between 3 and 4 internal teeth; tergal pubescence mainly whitish, with a spot of bright yellowpubescence on both lateral margins of T1 (Fig. 11B); tergal scales metallic greenish-copper; apex of T7 noticeably forked, both apices rounded (Fig. 7B); dorsal lobe of gonostyle triangular and broad projected upwards (Fig. 12C, D).
Female: body dark metallic and blue pubescence, with scales blue-greenish on head and mesosoma, and metallic blue to the metasoma; with patches of whitish pubescence on labrum, anterior lateral edges of the clypeus, behind the antennal insertion, preoccipital region, upper region of the gena, lateral surface of the mesepisternum, lateral margins of the scutum at the level of the tegula, posterior region of the scutellum, lateral apex of T5 and lateral apices of S2-S4 (Fig. 13); black integument on antenna, pronotal lobe, tegula and legs; scape with blue-green scales; tegula with metallic blue scales; scutellar tubercles subconical, strongly projecting upwards (Figs. 13A, D, 35C); middle tibial spur robust with black integument, forked, anterior projection with 2 to 3 internal teeth; pygidial plate with apex more or less rounded, with scales on the surface that do not reach the apex, and black integument (Fig. 4B).
Figure 6. Mesoplia (M.) insignis, male. A, Lateral habitus; B, dorsal habitus; C, frontal habitus; D, posterior view of the scutellar tubercles.
Description. Holotype: male. Body length 17.5 mm, forewing length 13.4 mm, head length 4.2 mm, intertegular distance 4.3 mm, T2 length 2.5 mm. Head: mandible with an internal tooth. Labrum subrectangular, concave surface, with a very evident preapical margin. Ocelli aligned to the upper margin of the eyes, protruding above the head in lateral view. Mesosoma: convex scutum in lateral view. Scutellar tubercles conical, strongly projecting upwards, cleft between them evident. Vertical metanotum and propodeum. Middle tibial spine rounded and short. Medial tibial spur robust forked, anteriorly projecting with 3 to 4 internal teeth. Middle basitarsus with posterior margin smooth and with short and straight flattened distal process. Hind tibia with 2 short spurs at the inner apex. Metasoma: T7 with a flattened surface, noticeably forked apex, with a moderately deep central cleft, medium distance between the apices, both ends rounded. Color: in general, with black integument. Head: labrum, rostrum, scape, pedicel and f1 black, remainder of flagellum greyish. Mandible with apical third yellowish brown, the rest black. Mesosoma: pronotal lobe, tegula, wing veins, legs, middle tibial spur, black. With smoked wings. Forewings without dark spots evident. Metasoma: with black sternum. Surface sculpture: head, labrum with most of surface rugose, by basal edge polished. Mesosoma: tegula with stippling. The propodeum strigulate. Pubescence: black and bright yellow. Head: labrum central surface with white plumose setae and scattered simple black setae, lower edge with a pair of long black tufts, lateral edges with simple black setae, upper edge bare. Clypeus densely covered with bright yellow plumose setae. Supraclypeal area, forehead close to the lower edge of the ocelli and vertex with metallic bluish-green scales. Supraclypeal area with black setae. With a spot of bright yellow setae in the upper part of the paraocular area. Preoccipital region and upper gena region with bright yellow setae. Lower region of the gena with black setae. Mesosoma: anterior surface of the mesepisternum, pronotal lobe, region anterior to the central disc of the scutum, posterior region of the scutellum, metascutum and lateral areas of the propodeum covered almost exclusively by bright yellow setae. The rest covered by black setae. Central disc of the scutum and most of the surface of the tegula with metallic green scales. Both the anterior and posterior inner edges of the tegula with black setae. Naked propodeal triangle. Internal apex of posterior tibia with very evident short blackish setal brush (Fig. 3B). Metasoma: terga covered with metallic greenish-copper scales. Anterior edge of T1 with scattered simple black and white setae, with a spot of yellow pubescence on both lateral margins. Surfaces of T3 to T6 with several series of rows of simple black setae. S2 to S4 with a short white patch of pubescence on the lateral edges. Scattered black sternum setae. S4 with long, branched black setae near the posterior edge and with several rows of simple black setae on the surface. S2 to S4 with a more or less triangular white spot on the lateral margins; dorsal lobe of gonostyle triangular and broad projected upwards.
Allotype: female. Body length 16.8 mm, forewing length 12.6 mm, head length 4 mm, intertegular distance 4.5 mm, T2 length 2.3 mm. Head: mandible with an internal tooth; labrum subrectangular with flat surface, and with a very evident preapical margin; ocelli aligned to the upper margin of the eyes, protruding above the head in lateral view. Mesosoma: convex scutum in lateral view. Scutellar tubercles with the conical shape strongly projecting upwards, an evident cleft between them. Vertical metanotum and propodeum. Middle tibial spine pointed and short. Medial tibial spur robust forked, anteriorly projecting with 2 to 3 internal teeth. Medium basitarsus with slightly wavy posterior margin and a flattened curved distal process. Metasoma: pygidial plate with apex more or less rounded. Color: integument black. Head: labrum, rostrum, scape, pedicel and F1 black, remainder of flagellum greyish. Apical third of mandible dark reddish brown with nearby yellowish brown spot, basal half black. Mesosoma: pronotal lobe, tegula, wing veins, legs, middle tibial spur, black. Apex of distal process of middle basitarsus dark reddish brown. Evenly smoked wings. Forewings without obvious dark spots. Metasoma: black sternum. Surface sculpture: head. Rugulous labrum. Mesosoma: finely punctuate tegula. Dotted propodeum. Metasoma: dotted pigidial plate. Pubescence: mainly black, but head covered mainly with white setae. Head: labrum surface with white setae branched and few scattered simple black setae, with a pair of tufts of black setae on the anterior margin and with setae on the lateral edges. Scape almost entire surface of anterior area with metallic blue-green scales. Mesosoma: covered mainly with black setae, except for patches of white setae on the collar of the pronotum, lateral region of the mesepisternum, lateral edges of the scutum, near the tegula, posterior region of the scutellum. Scales of the central disc of the scutum and the pronotal lobe metallic blue-green, of the same tone as those of the face. Scales of the tegula, mesepisternum and scutellum metallic blue. Metasoma: virtually the entire surface covered with metallic blue scales and the setae present are almost exclusively black, except for a spot of branched white setae on the lateral edges of T1, several rows of simple white pubescence on the surface of T4 and T5, a triangular spot of short branched white pubescence on the lateral ends of S3 to S5 and another small spot on the lateral edge of T5. Sterna also with metallic blue scales. Pygidial plate with metallic scales on the surface.
Variation. Some males have bright yellow setae on the external surface of anterior tibia and little pale-yellow pubescence on the lateral edge of S4.
Figure 8. Mesoplia (M.) insignis, male: A, S7. B, S8. C and D, genital capsule, dorsal and lateral view, respectively.
Taxonomic summary
Type material. Holotype: ♂ MNCR INB0004333459, CR. CART (Costa Rica, Cartago), Ochomongo, San Nicolás, Finca Kirqua, 9°54’41.29” N, 83°56’1.81” W, 14-II-2010/1-III-2010, W. Porras (MNCR). Allotype: ♀ MNCR INB0004333299, CR. HER [Costa Rica, Heredia], Sarapiquí, La Isla, 10°24’50.79” N, 84°7’42.24” W, 100-200 m, 22-II-2017/17-IV-2017, I. A. Chacón (MNCR). Paratypes: same data as the holotype ♀ MNCR INB0004333460 (MNCR), ♀ MNCR A5002767; CR. ALAJ [Costa Rica, Alajuela], Virgen del Socorro, 10°17’0.20” N, 84°10’38.22” W, 750 m, 15-IX-1982, I. A. Chacón (MNCR); ♂ MNCR A5057872 CR. HER [Costa Rica, Heredia], Sarapiquí, Puerto Viejo, Estación Biológica La Selva, 10°25’50.61” N, 84°10’38.21” W, 61 m, 24-VI-1988, I. A. Chacón (MNCR), ♀ SEMC 1254906, 10°25’35.81” N, 84°1’1.16” W, 80 m, 19-V-1993, J. Ashe & A. Ashe (SEMC); ♀ MZUCR HY6823 CR. HER [Costa Rica, Heredia], Sarapiquí, Puerto Viejo, La Isla, 10°14’7.70” N, 83°54’43.45” W, 221 m, VI-2011/VII-2011, I. A. Chacón (MZUCR); ♀ CINAT JZ344 CR. HER [Costa Rica, Heredia], Sarapiquí, Puerto Viejo, La Tirimbina, 10°23’52.20” N, 84°8’9.16” W, 186 m, 1997, Sergio (CINAT), ♀ MNCR JZ357, same location as the previous one, 25-VI-1997, Posada (MNCR); ♀ MZUCR HY6827 CR. PUNT [Costa Rica, Puntarenas], Reserva Forestal Golfo Dulce, 24 km W. Piedras Blancas, 8°45’17.43” N, 83°29’5.51” W, 200 m, IV-1992/V-1992, P. Hanson (CINAT).
Etymology. The specific epithet tica refers to the demonym with which the inhabitants of Costa Rica recognize themselves.
Distribution. Registered only for Costa Rica and it is possible that this species be endemic to this country (Fig. 10), present between 61 to 750 m altitude.
Taxonomic comments. This species is morphologically like M. insignis, the main differences are that the female has the scutellar tubercles strongly projecting upwards (Fig. 6A), and the pygidial plate covered by metallic scales and its apex is rounded (Fig. 4B); and the male has the apex of T7 noticeably forked, both apices rounded (Fig. 7B).
Figure 9. Mesoplia (M.) insignis, female: A, lateral habitus; B, dorsal habitus; C, frontal habitus; D, posterior view of the scutellar tubercles.
Mesoplia (Mesoplia) regalis (Smith, 1854)
Melissa regalis Smith, 1854: 280. Syntypes: British Museum Natural History, London, England (♀♂). Type locality: Brazil, Pará, Santarém.
Diagnosis. Male: body metallic green and pubescence white and brown; reddish brown on antennal integument, pronotal lobe, tegula and legs; scutum and tegula with metallic green scales; scutellar tubercles with a flattened surface, median slit between them; bifurcated middle tibial spur, with integument brown; anterior projection with 2 to 4 internal teeth; anterior edge of T1 with scattered white setae, lateral edges with a brown and white spot; T7 with the flat tips, with setae below it that are noticeable in dorsal view.
Figure 10. Map with the known distribution of Mesoplia (Eumelissa) carmelitae sp. nov., M. (E.) ornata, M. (Mesoplia) dugesi, M. (M.) insignis, M. (M.) oaxacana sp. nov., M. (M.) regalis, M. (M.) tica nov. sp., and M. (M.) veracruzana sp. nov.
Female: body metallic green, with white pubescence; antennal integument, pronotal lobe, tegula and legs reddish brown; scutum and tegulas with scales metallic green; scutellar tubercles more developed than in M. sapphirina with a deep depression between them and tubercles conspicuously pointed the delimiting carina is more developed only along the tubercles gradually fading to the sides; bifurcated middle tibia spur, integument brown; anterior projection with 2 to 4 internal teeth; pygidial plate with rounded apex and metallic scales that do not reach the apex (Melo & Rocha-Filho, 2011).
Taxonomic summary
Material examined. 1♂: Panama: Islas de las Perlas, Isla del Rey, 8°23’34.70” N, 78°54’24.11” W, 139 m, 13-IV-1981, R. W. Brooks, 1♂ (SEMC 1254921).
Distribution. Mainly South American, with the northern limit in Panama (Moure & Melo, 2023).
Taxonomic comments. According with Melo and Rocha-Filho (2011), this is a species similar morphologically to M. sapphirina, the main difference is that in this species the tubercles of the scutellum have the distal edge projecting upwards, more evident in females; the dorsal surface of the T7 in males bulging, with flat apices and with setae inserted underneath, distinguishable even in dorsal view. Specimens from Brazil deposited in SEMC were analyzed, whose distribution data were not included because they are from a distribution area not included in this study.
Mesoplia sapphirina Melo & Rocha-Filho, 2011: 30. Holotype: Department of Zoology, Universidade Federal do Pará, Curitiba, Brazil (♀). Type locality: Panamá, ‘Old Panama’.
Figure 11. Mesoplia (M.) tica sp. nov. Holotype, male: A, lateral habitus; B, dorsal habitus; C, frontal habitus; D, posterior view of the scutellar tubercles.
Diagnosis. Male: body metallic blue, with whitish setae (Fig. 14); F1 light reddish brown; remainder of flagellum, pronotal lobe, tegula, most of legs and sterna dark reddish brown; scutum and tegula with metallic blue scales; scutellar tubercles poorly developed, posterior carina conspicuous; middle tibial spur forked, both apical branches with robust teeth, outer branch with 2 small internal teeth (Fig. 16A); dorsal surface of T7 bulging, its projected ventral portion conspicuously excavated; with a pair of apical projections of T7 with rounded apices, emargination between them relatively deep (Fig. 7C); dorsal and digitiform lobes of the gonostylus well developed (Fig. 15C, D).
Female: body metallic blue, with whitish setae (Fig. 17); F1 light reddish brown; remainder of flagellum, pronotal lobe, tegula, most of legs and sterna dark reddish brown; scutellar tubercles weakly developed, its surface only slightly convex and its tubercles low and broadly rounded; the carina that delimits the tubercles posteriorly well developed and runs continuously from one side of the scutellum to the other; middle tibial spur forked, both apical branches with robust teeth, outer branch with 2 small internal teeth (Fig. 18A); pygidial plate with oval apex and covered with decumbent bluish metallic scaly hairs, except for the apex which is naked (Fig. 4C).
Figure 12. Mesoplia (M.) tica sp. nov. Holotype male: A, S7. B, S8. C and D, genital capsule, dorsal and lateral view, respectively.
Variation. Some males have yellow setae on the posterior surface of the scutellar tubercles.
Taxonomic summary
Material examined. Costa Rica: Cartago: Cachí, 9°49’52.06” N, 83°48’18.12” W, 1,016 m, 28-V-1974, G. Rivera, 1♀ (MZUCR HY6608). Guanacaste: Bagaces: Barrio el Brasil, 10°32’57.36” N, 85°15’54.11” W, 114 m, 5-V-2022, K. Borbón, 1♀ (CINAT JZ340), 3♂ (CINAT JZ341 – CINAT JZ343). 10°32’58.60” N, 85°15’52.42” W, 110 m, 8-IV-2023, K. Borbón, 1♀ (MZUCR HY6131), 1♂ (MZUCR HY6131). Filadelfia, 10°26’51.27” N, 85°32’59.86” W, 22 m, 28-IX-1959, M. Leiva, 1♂ (MZUCR HY6816); La Cruz: Cuajiniquil, Bahía Tomás, Salinitas, in mangrove, 10°55’15.60” N, 85°42’57.96” W, 0 m, 28-I-2022, M. F. Otárola & J. Lobo, 1♀ (MZUCR HY2249), 7-II-2022/7-III-2022, M. M. Chavarría & P. Hanson, 2♀ (MZUCR HY5067), (MZUCR HY5068), 25-III-2021, M. F. Otárola & J. Lobo, 1♀ (MZUCR HY2345), V-2022, M. M. Chavarría & P. Hanson, 1♀ (MZUCR HY6838); Nicoya: Sámara, 9°52’51.60” N, 85°31’36.30” W, 17-I-2009, C. Reichie, 1♀ (MZUCR HY5051). San José: San Pedro de Montes de Oca, 9°56’11.41” N, 84°2’58.50” W, 1,201 m, 20-VI-1959, Y. Gómez, 1♀ (MZUCR HY5061). Mexico: Chiapas: La Concordia, 16°7’12.00” N, 92°39’0.00” W, 616 m, 1-IV-2016, P. Sagot, 1♀ (ECOAB 58710), 16°3’36.00” N, 92°33’36.00” W, 550 m, 5-III-2020, P. Sagot, 1♂ (ECOAB 134687); Mazatan, 14°55’12.00” N, 92°37’48.00” W, 6 m, 2-II-2019, P. Sagot, 1♂ (ECOAB 130647), 14°55’48.00” N, 92°37’12.00” W, 8 m, 2-II-2019, I. Pérez, 1♂ (ECOAB 130665); Tonalá, 15°30’0.00” N, 92°24’0.00” W, 3 m, 21-IV-2011, 1♀ (ECOAB 56616). Jalisco: La Huerta: Chamela, 19°29’54.77” N, 105°2’41.22” W, 10-IX-1981, S. Bullock, 1♀ (EBCH SB736), 19-X-1985, S. Bullock, 1♀ (SEMC 1451101), 27-IX-1985, R. Ayala, 1♀ (SEMC 1451080); Estación Biológica Chamela, 19°29’54.77” N, 105°2’41.22” W, 25-IX- 1985, C. D. Michener, 1♀ (EBCH JZ65); La Manzanilla, 19°17’0.03” N, 104°47’13.06” W, 1 m, 16-XI-1994, A. Moreno, 1♀ (HFL 302), 1♀ (CZUG 302), 16-XI-1994, H. E. Fierros-López, 1♀ (HFL JZ7), 1♂ (HFL JZ8), 1♀ (CZUG 309); Playa Careyitos, 19°29’36.18” N, 105°1’29.56” W, 27-X-1985, R. Ayala, 1♀ (EBCH RA219), 27-IX-1985, R. Ayala, 1♀ (EBCH RA218), 30-IX-1985, C. D. Michener, 1♀ (SEMC 1451078); Playa Careyitos 6 Km. South of Chamela, 19°29’36.18” N, 105°1’29.56” W, 27-IX-1985, A. Rodríguez P., 1♀ (EBCH JZ63), R. B. Roberts, 1♀ (EBCH JZ64); Playa Teopa, 19°23’48.69” N, 105°1’9.27” W, 4-X-1985, J. G. Rozen 1♀ (EBCH JZ62), R. Ayala, 1♀ (EBCH JZ69). Oaxaca: San Pedro Huamelula, 15°55’48.00” N, 95°46’48.00” W, 22 m, 21-XII-2019, P. Sagot, 1♂ (ECOAB 133378). Sinaloa: San Ignacio, Autopista 4 Río-Piaxtla, 23°55’59.28” N, 104°25’59.88” W, 1,184 m, 18-III-1990, W. Bell, D. Conlon & R. L. Mickley, 1♀ (SEMC 1451099). Tabasco: Tenosique, 17°18’0.00” N, 91°10’12.00” W, 126 m, 23-V-2018, A. Tapia, 1♀ (ECOAB 120153). Tamaulipas: Altamira, Playa Altamira, 22°29’59.53” N, 97°51’41.04” W, 3-VI-1985, M. S. Wasbauer & J. E. Slansky, 1♀ (SEMC 1442315); Llera de Canales, 23°19’24.79” N, 99°1’19.66” W, 267 m, 19-VII-1954, Univ. Of Kans. Mex. Exped., 1♂ (SEMC 1451076); Soto la Marina, La Pesca, 23°46’31.53” N, 97°44’21.63” W, 4 m, 1-VII-1981, B. Miller, B. Porter & L. Stage, 6♀ (SEMC 1451070 – SEMC1451075); Tampico, 22°13’57.47” N, 97°53’30.53” W, 2 m, 10-VI-1951, H.E. Evans, 6♀ (SEMC 1451089 – SEMC 1451094), 1♂ (SEMC 1451088). Veracruz: without coordinates, 25-VII- 1995, 1♀ (CERUADY 239ver). 25-VII-1995, 1♂ (CERUADY 230ver); Actopan: Cofre de Perote, 19°35’45.96” N, 96°22’47.28” W, 10 m, VI-2019, P. Luna & W. Dáttilo, 1♀ (IEXA JZ38); La Mancha, 19°21’12.60” N, 96°13’27.48” W, 3 m, VI-2022, B. Ratoni & W. Dáttilo, 1♂ (EBCH 622 1), 19°21’16.92” N, 96°13’29.64” W, 15 m, VI-2022, B. Ratoni & W. Dáttilo, 1♀ (EBCH 623 7), 1♂ (EBCH 623 6), V-2023, C. Pinilla, 2♂ (EBCH JZ355, EBCH JZ356). Boca del Río: 8 km SE of Boca del Río, 19°3’13.58” N, 96°2’42.53” W, 9 m, 22-VII-1990, W. Bell, D. Conlon & R. L. Mickley, 1♂ (SEMC 1451100); San Andrés Tuxtla: Estación biológica Los Tuxtlas, 18°31’0.00” N, 95°7’59.59” W, 136 m, 16-IX-2018, I. Huerta, 1♀ (CZUG JZ 13); Tecolutla: 20°28’47.00” N, 97°0’36.00” W, H. E. Evans, 1♀ (SEMC 1451095), 2.41402 km N of Tecolutla, 20°29’33.25” N, 97°1’34.21” W, 4.572 m, 12-VI-1985, Univ. of Kans. Mex. Exped., 1♂ (SEMC 1451077). Yucatán: Tizimín: El Cuyo, 21°31’5.99” N, 87°40’59.00” W, 25-VII-1995, H. Moo, 2♀ (CERUADY 009406(02450)), (009411(02477)), 1♂ (009414(02451)), R. Tut, 7♀ (CERUADY 009574(02453), (009546(02454)), (009543(02455)), (009539(02456)), (009541(02474)), (009545(02475)), (009536(02476)), 1♂ (009544(02461)), 14-VI-1995, R. Tut, 8♀ (CERUADY 007998(02452)), (007987(02462)), (007992(02457)), (007986(02465)), (007980(02466)), (007982(02467)), (008004(02469)), (008000(02473)), 5♂ (007996(02458)), (007979(02460)), (007994(02463)), (007983(02472)), (008006(02479)), 24-V-1995, R. Tut, 1♀ (006649(02468)), 1♂ (006651(02478)), H. Moo, 1♂ (006844(02464)), 4-IV-1995, R. Tut, 1♀ (005166(02470)), 1♂ (005175(02459)). Nicaragua: León: Campus Agropecuário UNAN-León, 12°25’22.14” N, 86°57’8.68” W, 16-V-2022, R. Varela, 1♀ (LEECAV JZ292). Panama: Chimán: Brujas: Punta Bruja, Zona del Canal, 8°35’6.51” N, 78°31’56.69” W, 4 m, 25-I-1929, C. H. Curran, 1♂ (SEMC 1451102). Panamá: Panamá Viejo, 9°0’22.09” N, 79°29’6.29” W, 5 m, 16-IV-1945, C. D. Michener, 1♂ (SEMC 1451079). Panamá Oeste: Fort Kobbe, 8°55’0.30” N, 79°34’59.59” W, 8 m, 11-I-1960, W. J. Hanson, 2♀ (SEMC 14510972), (SEMC 1451098), 2♂ (SEMC 1451096), (SEMC 1427034).
Figure 13. Mesoplia (M.) tica sp. nov. Allotype, female: A, lateral habitus; B, dorsal habitus; C, frontal habitus; D, posterior view of the scutellar tubercles.
Distribution. The northernmost distribution has been recorded in Sonora, along the Pacific Ocean slope and in Tamaulipas on the Gulf of Mexico slope, to the south the limit of its distribution it is in the center of Panama (Fig. 19).
Taxonomic comments. It is a species morphologically similar to M. regalis, the main difference is that the apices of the scutellar tubercles are rather flattened (Fig. 16A, D), not projected upwards (this character can be confused if the scales in this area of the body have been lost), while males do not present setae that protrude in dorsal view below T7 and the apices of this are rounded (Fig. 7C).
Diagnosis. Female: body metallic blue, with pubescence mostly blackish, but bright yellow setae on head and mesosoma, especially on the pronotum, mesepisternum, posterior region of the scutellum, metanotum and lateral areas of the propodeum (Fig. 20); integument black in antenna, pronotal lobe, tegula and legs; posterior apex of scutellar tubercles projecting upwards (Fig. 20C); middle tibial spur forked, with black integument, the anterior projection with 3 inner teeth; tergal pubescence mainly dark with a bright yellow spot on both lateral margins of T1 and T2 (Fig. 20A); pygidial plate with rounded apex, but with a notch in the medial part of the apex, with scales that does not reach the apex, and with black integument (Fig. 4D).
Figure 14. Mesoplia (M.) sapphirina, male: A, lateral habitus; B, dorsal habitus; C, frontal habitus; D, posterior view of the scutellar tubercles.
Description. Holotype: female. Body length 17.9 mm, forewing length 12.6 mm, head length 5 mm, intertegular distance 4.2 mm, T2 length 2.5 mm. Head: mandible with an internal tooth. Labrum subtriangular, surface slightly concave, with a raised preapical margin. Ocelli aligned to the upper margin of the eyes, protruding above the head in lateral view. Mesosoma: scutum convex in lateral view. Scutellar tubercles not very evident due to the large amount of pubescence, a noticeable cleft between them. Metanotum and propodeum vertical. Spine of the middle tibia long pointed. Medial tibial spur robust and forked, anterior projection with 3 internal teeth. Medial basitarsus with smooth posterior margin and a flattened distal process that is slightly curved externally. Metasoma: broad pygidial plate at the base, apex subtruncate with a slight central notch. Color: integument blackish. Head: black on face, labrum and antenna; the flagellum with integument opaque. Apical third of mandible yellowish brown, except for black teeth. Mesosoma: almost all black. Apex of distal process of middle basitarsus reddish brown. Wings overall evenly smoked (Fig. 20A, B); forewings with the anterior edge of the marginal cell darker. Veins dark. Metasoma: between the terga and sterna reddish brown. Surface sculpture: head. Labrum with most surface rugose, basal edge polished. Mesosoma: punctured tegula. Reticulated propodeum. Metasoma: dotted pigidial plate. Pubescence: mostly bright yellow and black. Head: labrum discal area with white plumose setae and scattered simple black setae, lower edge with a pair of long dark tufts, lateral edges with simple black setae, upper edge bare. Clypeus with lower margin with white plumose setae, sides with pale yellow plumose setae, central surface with light metallic blue scales. Suplaclypeal area with few long and scattered black simple setae and with scales equal to those of the clypeus. Frons with black setae and light metallic green scales near the lower edge of the ocelli. Paraocular area with pale yellow plumose setae. Vertex and preoccipital region with bright yellowcompound setae. Gena with setae bright yellow, except for the lower region that has black. Mesosoma: pronotal lobe with the anterior and external lateral margin with bright yellow setae, posterior margin with interspersed white and black setae, inner margin with mainly black setae, surface with dark metallic blue scales (Fig. 20). Mesepisternum upper region with bright yellow setae, lower region black. Scutum covered mainly by black setae, except for the lateral edges near the posterior two-thirds of the tegula that have interspersed bright yellow setae, central disc with light metallic green scales. Tegula black on the anterior and inner edge and with dark metallic blue scales on the surface. Upper of scutellum with few black setae and light metallic blue scales and bright yellow on posterior region, that projects a little between the tubercles. On the metanotum bright yellow. Propodeum upper region naked, posterolateral region bright yellow. Legs are mainly dark and with dark metallic blue scales on the external surfaces, with a tuft of white setae on the posterior margin of the femurs of the forelegs and on the external apices of the middle femurs. Metasoma: terga covered with metallic bluish-green scales. Anterior edge of T1 with scattered white setae, lateral edges with a bright yellow spot; T2 with a smaller pale-yellow spot in the lateral marginal area. T4 and T5 with few white simple setae in lateral view. T6 with thick black setae on the sides of the pygidial plate. Pygidial plate with light metallic green scales that do not reach the apex. Sterna with scattered black setae. S2 to S4 with a sub triangular white spot on the lateral margins.
Figure 15. Mesoplia (M.) sapphirina, male: A, S7. B, S8. C and D, genital capsule, dorsal and lateral view, respectively.
Male: unknown.
Taxonomic summary
Type material. Holotype: ♀ IEXA JZ39 MEX. VER [Mexico, Veracruz], Coatepec, 19°26’42.36” N, 96°57’52.13” W, 1,200 m, 6-VI-2020, G. Quintos-Andrade (IEXA). Paratypes: 3♀: UNAM-LT JZ352 MEX. VER [Mexico, Veracruz], San Andrés Tuxtla, Estación Biológica Los Tuxtlas, 18°35’5.50” N, 95°4’26.58” W, 160 m, 1985-VII-6, A. Ibarra (UNAM-LT). Same location as the previous one, 2♀ UNAM-LT JZ353, 1985-VI-2, P. Sinica. UNAM-LT JZ354, 1986-VII-20, P. Sinica.
Etymology. The name veracruzana refers to the known distribution of this species, the state of Veracruz, Mexico.
Distribution. Only known for the localities of Coatepec and San Andrés Tuxtla (Fig. 10), although there are photographic records in iNaturalist near Xalapa and Orizaba, localities with cloud forest and tropical forest.
Taxonomic comments. The female of this species has a pubescent color similar to that in the male of M. insignis, so they could be confused. In this species, the bright yellow pubescence on the metasoma is only located in the pronotum, mesepisternum, posterior region of the scutellum, metanotum and lateral areas of the propodeum (Fig. 20), unlike M. insignis whose metasoma is almost completely covered by yellow setae (Fig. 6).
M. azurea group(sensu Moure, 1960a, 1960b)
Diagnosis. Male: hind tibia with an inconspicuous setal brush and with 1 spur; ventral basal surface of posterior femur with a robust posterior projection (Fig. 3D, E); inner surface of basitarsus with a longitudinal carina. Female: with carina extending laterally from the pronotal collar, to the pronotal lobe (Fig. 5B).
Mesoplia (Mesoplia) dugesi (Cockerell, 1917)
(Figs. 1B, 3D, 4E, 5B, 7D, 10, 16B, 21-23, 35E)
Mesonychium dugesi Cockerell, 1917: 477. Holotype: National Museum of Natural History, Smithsonian Institution, Washington DC, United States of America (♂). Type locality: Mexico, Guanajuato.
Diagnosis. Male: body dark metallic blue, pubescence mainly black (Fig. 21), except for some white spots on the central surface of the labrum, anterior edge of the superior gena and clypeus; integument blackish on antenna, pronotal lobe, tegula and legs, except for the F1 which is usually dark reddish brown; tegula with metallic blue scales; wing with black veins; scutellar tubercles practically flattened and without a cleft between them; middle tibial spur forked with dark reddish-brown integument, anterior projection with 1 to 3 internal teeth (Fig. 16B); femur posterior with a robust posterior projection on the ventral basal surface (Fig. 3D); apex of T7 bifurcated, both with an acute angle and close to each other (Fig. 7D); dorsal lobe of gonostylus reduced (Fig. 22C, D).
Female: body dark metallic blue, with dark pubescence at first glance (Fig. 23), in a deeper examination some areas with whitish pubescence can be seen on labrum, superior area of the gena, internal margin of the pronotal lobe and a small spot on the posterior surface of the scutellum and between the tubercles; integument of antenna, pronotal lobe, tegula and legs blackish (dark reddish); labrum, vertex, preoccipital area and tegula with metallic blue scales; with a carina extending laterally from the pronotal collar to the pronotal lobe (Fig. 5B); wings with black veins (Fig. 23A, B); scutellar tubercles conical, slightly projecting with a shallow cleft between them (Fig. 23D); middle tibial spur forked with dark reddish-brown integument, anterior projection with 3 internal teeth; T1 with black setae; terga with metallic blue scales; pygidial plate with a narrow apex and completely covered by metallic bluish-green scales (Fig. 4E).
Description. Female: body length, 16.4 mm, forewing length 12.7 mm, head length 4.1 mm, intertegular distance 3.9 mm, T2 length 1.7 mm. Head: mandible with an internal tooth. Labrum subrectangular, surface slightly concave, with a raised preapical margin. Ocelli aligned with the upper margin of the eyes, protruding slightly above the head in lateral view. Mesosoma: with carina that runs laterally from the collar of the pronotum to the pronotal lobe. Convex scutum in lateral view. Scutellar tubercles rounded, without posterior carina, with a median slit between them. Metanotum and propodeum vertical. Medial tibial spine short rounded. Medial tibial spur bifurcated, anterior projection with 3 internal teeth. Medial basitarsus with pentadentate external margin and with a flattened distal process that is slightly curved externally. Metasoma: broad pygidial plate at the base, narrow rounded apex. Color: integument blackish to dark reddish brown. Head: labrum with reddish brown lateral and anterior edges, blackish surface. Apical region of mandible blackish (yellowish brown) reddish brown in basal region. Scape and pedicel blackish to reddish brown. F1 reddish brown, remainder of flagellum brown. Mesosoma: pronotal lobe and tegula dark reddish brown. Almost transparent wings. Forewings with the anterior edge and the distal apex of the marginal cell darker, also presenting a darker spot that goes from the external edge of the 2r-m to the wing apex (Fig. 23B). Dark veins. Inner surfaces of legs dark reddish brown, outer surfaces blackish. Apex of the distal process of the medial basitarsus ferruginous and medial tibial spur reddish brown. Metasoma: blackish sterna, except for S6 which is reddish brown. Surface sculpture: head. Labrum with most surface rugose, basal edge polished. Mesosoma: punctured tegula. Strigulate propodeum. Metasoma: dotted pigidial plate. Pubescence: mostly blackish. Head: labrum central surface with white feathery setae and scattered simple black setae, lower edge with a pair of long dark tufts, lateral edges with simple black setae, upper edge bare. Clypeus and supraclypeal area with metallic blue scales and long black simple setae. Scape with short black setae. Frons with black setae and metallic blue scales on the lower edge of the ocelli. Paraocular area mainly with simple black setae, with a tuft of setae near the antennal alveolus. Vertex and preoccipital region with simple black setae and metallic blue scales. Gena with black setae, except for the middle region near the eyes which has white setae. Mesosoma: with black setae except for the inner margin of the pronotal lobe and a small spot on the posterior surface of the scutellum and between the tubercles. Pronotal lobe with metallic blue scales. Anterior region of the scutum with dense setae coverage. Central disc with scattered setae and light metallic blue scales. Tegula with black setae on the anterior edge and metallic blue scales on the inner edge. Scutellum upper region with few black setae and metallic blue scales, posterior region also with metallic blue scales. Naked propodeal triangle. Legs are mainly black, with only a patch of white setae on the external apex of the anterior tibia and on the external apex of the middle femur. External surface of the tibiae of all legs with metallic blue scales and on the posterior basitarsus. Metasoma: with black setae except for the lateral margins of S2 to S4 which have a triangular spot of short white setae. Sterna with scattered black setae.
Variation. Some males have a greater proportion of white setae in some body regions, on all margins of the pronotal lobe, in the anterior region of the scutum, anterior and posterior apex of the tegula, between the tubercles and in the posterior region of the scutellum, metanotum and on the supralateral margins of the propodeum.
Taxonomic summary
Material exanimated. Mexico: Jalisco: Mazamitla, Puerta del Zapatero, 19°50’29.00” N, 103°5’52.00” W, 1,615 m, 27-VIII-2005, H. E. Fierros-López, 1♂ (HFL); Teocuitatlán: Laguna de Sayula, 19°56’55.00” N, 103°27’56.00” W, 1,350 m, 28-VIII-2011, A. Aguilar, 1♂ (HFL 1111); Zapopan: Barranca la Experiencia, 20°44’6.13” N, 103°19’38.38” W, 1,200 m, 23-VIII-1997, G. Mercado, 1♀ (HFL 1107), 23-VIII-1996, G. Mercado, 1♂ (HFL), 14-IX-1996, G. Mercado, 1♂ (CZUG 1108), 1,350 m, 27-IX-2009, G. Mercado, 1♀ (CZUG). Michoacán: Nahuatzen: Zacapu, 19°45’22.46” N, 101°46’52.61” W, 2,152 m, 10-IX-2014, G. Mérida, 1♂ (ECOAB 25661).
Distribution. Only known from Jalisco, Guanajuato and Michoacán in México, although there is at least one record in iNaturalist for Querétaro (Fig. 35E). Its distribution seems to be restricted to the center of the country (Fig. 10).
Taxonomic comments. Is the darkest species distributed in the region, both the general pubescence of the body and the integument of the legs are mainly blackish.
Mesoplia guatemalensis Cockerell, 1912: 567. Holotype: National Museum of Natural History, Smithsonian Institution, Washington D.C., United States of America (♀). Type locality: Guatemala, Gualan. New junior synonym.
Diagnosis. Male: body metallic blue-greenish coloration and with whitish pubescence (Fig. 24); integument of the scape, pedicel and f1 ferruginous (in some specimens inner margin of the scape darker); integument ferruginous on apical flagellomere in posterior view, pronotal lobe and tegula; integument of legs dark brown, on external surface and ferruginous on internal; tegula without scales (Fig. 24B); wing veins ferruginous; with rounded scutellar tubercles, with posterior carina and no cleft between them; femur posterior with a robust posterior projection on the ventral basal surface (Fig. 3E, 35F); terga with blue-green scales; apex of T7 bifurcated, both with an acute angle and close to each other (Fig. 7E); dorsal lobe of gonostylus reduced (Fig. 25C, D).
Female: body metallic blue-greenish coloration and with whitish pubescence (Fig. 26); integument ferruginous on scape, pedicel and f1, pronotal lobe, tegula and legs (some populations with dark brown integument); with a carina extending laterally from the pronotal collar to the pronotal lobe; tegula without metallic scales (Fig. 26B); wing veins ferruginous; conical tubercles slightly projected with a shallow cleft between them; terga with dorsal pubescence whitish; middle tibial spur bifurcated with ferruginous integument, anterior projection with 2 or 3 internal teeth (Fig. 18B); pubescence of the anterior edge of T1 whitish; terga with green scales; pygidial plate with a narrow apex and covered by metallic bluish-green scales (Fig. 4F).
Notes made by Moure (1960a) from the holotype: “The pubescence of the clypeus and paraocular area, especially in the upper part, tends to very pale yellow. With few dark hairs in the supraclipeal area, next to the ocelli and on the frons. The pubescence of the thorax is pale on the pronotum, with dark setae on the lobes. Dark setae in the anterior third of the mesoscutum, but divided in the middle by a line of white setae and bordered posteriorly by white setae. Mesoscutum disc with fine bronze-green scales and few setae; The punctuation is very evident there in two sizes, the small denser dots and the thick ones very dispersed. On the mesepisternum there is white pubescence above and below an irregular disc area of dark setae and ventrally the setae are also dark. The terga are covered with bronze-green scales and in certain light give the impression of being dark at the base of each tergum, each side of the terga with a small longitudinal line of white setae on the border with the ventral surface which is covered with setae quite short white ones. The long setae of T1 toT5 are white, in the last two black. The integument of mandibles, labrum and legs is rusty; the tegulae and pronotal lobes of a lighter rust color.
Figure 20. Mesoplia (M.) veracruzana sp. nov. Holotype, female: A, lateral habitus; B, dorsal habitus; C, frontal habitus; D, posterior view of the scutellar tubercles.
The spur of the middle tibia widened towards the apex and bifurcated, with the inner ramus having a single tooth and the outer ramus having a toothed inner edge. The middle basitarsus with the posterior angle between the external and internal surfaces only edged, not laminated. Hind femurs thickened near base projecting backwards at a large finger-like angle. The tibia moderately thickened at the apex, internally more or less flattened, distally on the internal surface a short imperfect tuft and with a relatively short spur. The posterior basitarsus with the inner side flattened and smooth, largely glabrous and separated from the posterior surface by a thin carina. T7 with the apex narrowly emarginated in a paraboloid shape, the tips relatively close together and strongly rounded. The S4 widely emarginated, procurved, with a wide short band ending at the level of the edge. S5 with deeper emargination, very pubescent, hairs curved towards the center. Approximate length 13.2 mm, forewings including tegula 13 mm; head width 4.28 mm, abdomen 5.45 mm.”
Variation.The shape of the S8 seems to be higly variable; and the shape of the basal projection of the posterior femur on males, in some individuals it is wider, while in others it is narrower.
Material examined. Costa Rica: no location data, 1♂ (MZUCR HY6836). Guanacaste: Bagaces, 8 km al NE de Bagaces, Pan Am Hwy, 10°32’17.67” N, 85°19’53.58” W, 116 m, 23-II-2000, P. Ronchi & G. W. Frankie, 1♂ (MZUCR HY5770), 24-II-2000, P. Ronchi & G. W. Frankie, 2♂ (MZUCR HY3446), (MZUCR HY3448), 12-II-2000, P. Ronchi & G. W. Frankie, 2♂ (MZUCR HY3450), (MZUCR HY3447), 9-III-2000, P. Ronchi & G. W. Frankie, 1♂ (MZUCR HY6835); Urban Bagaces, 10°31’39.84” N, 85°15’25.26” W, 83 m, 12-III-2004, L. Sandoval & G. W. Frankie, 2♂ (MZUCR HY6825), (MZUCR HY6824); Hacienda Monteverde 9 km NW Bagaces, 10°33’17.91” N, 85°16’12.50” W, 91 m, 24-II-1996, G. W. Frankie, 1♀ (MZUCR HY5697), 18-III- 2022, J. Lobo, 1♀ (MZUCR HY6828); Carrillo: Filadelfia, 11.2654 SW of Filadelfia, 10°22’21.18” N, 85°37’29.14” W, 85 m, 3-III-1954, A. Wille & H. Daly, 1♀ (SEMC 1451159); Hojancha: Lajas, 9°59’34.55” N, 85°27’5.06” W, 200 m, 18-V-2014, S. Galbraith, 2♀ (INB0004444317 – INB0004444319); La Cruz, Cuajiniquil, Bahía Tomás, Salinitas, in mangrove, 10°55’17.40” N, 85°42’57.96” W, 0 m, 25-III-2021, M. F. Otárola & J. Lobo, 1♀ (MZUCR HY2792), 7-II-2022/7-III-2022, M. F. Otárola & J. Lobo, 1♀ (MZUCR HY5064), 25-III-2021, M. F. Otárola & J. Lobo, 2♀ (MZUCR HY2348), (MZUCR HY2349), 18-III-2022/-IV-2022, M. M. Chavarría & P. Hanson, 1♀ (MZUCR HY5065), 9-IV-2022/7-V-2022, M. M. Chavarría & P. Hanson, 3♀ (MZUCR HY5063), (MZUCR HY5066), (MZUCR HY5066); Liberia, 10°38’55.46” N, 85°26’39.36” W, 149 m, 21-II-2013, 1♀ (MZUCR HY3449); Barrio La Arena, 10°36’21.96” N, 85°25’30.23” W, 142 m, 15-V-1980, E. Ponce, 1♂ (MZUCR HY6817); Pan Am Hwy, 10°38’32.38” N, 85°27’13.36” W, 132 m, 22-II-2004, G. W. Frankie & S. B. Vinson, 1♂ (MZUCR HY5696); Santa Cruz, Playa Junquillal, 10°10’7.04” N, 85°48’47.87” W, 3 m, 3-III-1976, R. M. Bohart, 1♀ (SEMC 1442317). Heredia: CINAT Lagunilla, 9°58’23.58” N, 84°7’45.55” W, 1,038 m, 30-VII-1997, A. Ortiz, 1♂ (CINAT JZ337), 27-III-2017, R. Díaz, 1♀ (CINAT JZ339); Sarapiquí: Puerto Viejo, Estación Biológica La Selva (OET), 10°25’49.70” N, 84°0’24.96” W, 50 m, 17-VII-1995, P. Hanson, 1♀ (MZUCR HY6826), 2-IV-1993, P. Hanson & C. Godoy, 1♀ (MZUCR HY6818). Puntarenas: Golfo Dulce, 8°42’13.42” N, 83°29’8.86” W, 10 m, XII-1989/III-1990, P. Hanson, 1♀ (MZUCR HY6821); Gromaco, 34 km S of Potrero Grande en río, 8°50’49.49” N, 83°2’41.43” W, 836 m, 21-VII-1963, C. D. Michener & W. Kerfoot, 1♀ (SEMC 1451161); Rincon, 5 km S of Rincon, 8°40’57.72” N, 83°28’24.94” W, 21 m, 15-III-1973, E. Borrows, 1♂ (SEMC 1451162). San José, 9°40’0.01” N, 84°0’0.00” W, C. D. Michener, 1♀ (SEMC 1451160); Pérez Zeledón, Esperanza, 9°16’30.64” N, 83°42’9.86” W, 807 m, II-1997, N. Siles, 1♂ (CINAT JZ336), 13-IX-1999, A. Ortiz, 1♂ (CINAT JZ338); San Antonio de Escazú, 9°53’23.88” N, 84°8’17.66” W, 1,454 m, W. Edward, 1♂ (MZUCR HY6834). Guatemala: without locality, 28-III-1923, 1♀ (SEMC 1451087). Huehuetenango: La Libertad, 15°34’12.00” N, 91°51’0.00” W, 915 m, 27-IV-2010, M. Hurtado, 1♂ (ECOAB 25637), 28-IV-2010, C. Balboa, 2♂ (ECOAB 25639), (ECOAB 38876), L. Aguilar, 1♂ (ECOAB 25642), 26-II-2010, C. Balboa 2♂ (ECOAB 25643), (ECOAB 25646); San Antonio Huista, 15°36’36.00” N, 91°44’24.00” W, 1,192 m, 23-II-2010, D. Sánchez, 1♂ (ECOAB 25645). Honduras: Ocotepeque: Lucerna, Autopista 4, 9 km N of Lucerna, 14°37’36.00” N, 89°3’42.00” W, 792.48 m, 26-V-2003, D. Brzoska, 1♀ (SMO 418386). Mexico: No location data, J. Mérida, 1♀ (ECOAB 25656). Campeche: Champotón, 18°33’0.00” N, 89°56’24.00” W, 155 m, 8-VI-2018, J. Mérida, 3♀ (ECOAB 121736 – ECOAB 121738), 18°27’0.00” N, 89°53’24.00” W, 168 m, 6-VI-2018, 7♀ (ECOAB 121803 – ECOAB 121806), (ECOAB 121813 – ECOAB 121816). Chiapas: Acacoyagua, 15°24’0.00” N, 92°39’0.00” W, 862 m, 15-V-2007, R. Ayala, 1♂ (ECOAB 56633); Arriaga: 16°19’12.00” N, 93°58’48.00” W, 367.5 m, 10-III-2009, M. Guzmán, 1♂ (ECOAB 25641), 19-V-2009, C. Balboa, 1♀ (ECOAB 25657); Ej. López Mateos, 16°20’46.60” N, 93°58’26.80” W, 255 m, 13-III-2009, C. Balboa, M. Guzmán y M. Cigarroa, 2♂ (EBCH ECO-TAB57347), (EBCH ECO-TAB57276); Cacahoatán, 5 km. sur de Cacahoatán, 14°57’0.00” N, 92°9’0.00” W, 340 m, 18-IV-1993, A. Rodríguez P., 2♀ (EBCH JZ70), (SMO 317151), 2♂ (EBCH JZ77), (SMO 317154); La Concordia, 15°45’0.00” N, 92°58’12.00” W, 921 m, 23-IV-2021, P. Sagot, 1♂ (ECOAB 125000), J. Mérida, 2♂ (ECOAB 125229), (ECOAB 125230), 5-III-2020, P. Sagot, 2♂ (ECOAB 134690), (ECOAB 134691), E. Gómez, 2♂ (ECOAB 134756), (ECOAB 134757), 16°2’24.00” N, 92°33’36.00” W, 580 m, 5-III-2020, P. Sagot, 1♂ (ECOAB 134785); Mapastepec, 15°31’12.00” N, 92°48’0.00” W, 316 m, 22-II-2006, J. Esponda, 1♂ (ECOAB 25644), 1-IV-2005, M. Rincón, 1♀ (ECOAB 25660); Motozintla de Mendoza, 15°22’48.00” N, 92°19’12.00” W, 1,230 m, 7-II-2011, P. Sagot, 1♂ (ECOAB 25638), 15°19’12.00” N, 92°20’24.00” W, 1,000 m, 3-II-2019, P. Sagot, 1♂ (ECOAB 131078); Ocosingo, 16°54’36.00” N, 93°40’48.00” W, 950 m, 15-IV-2010, J. Mérida, 1♂ (ECOAB 56637); San Juan Cancuc, 16°54’0.00” N, 92°21’36.00” W, 1,170 m, 6-IV-2010, J. Mérida, 1♂ (ECOAB 25654); Siltepec, 15°34’48.00” N, 92°39’0.00” W, 1,709 m, 9-III-2022, L. Arroyo, 1♀ (ECOAB 71706), 1♂ (ECOAB 71705); Tapachula, 14°53’24.00” N, 92°17’24.00” W, 127 m, 9-VI-1989, A. Aquino, 1♂ (ECOAB 25648), 14°54’0.00” N, 92°18’36.00” W, 102 m, 14-XII-1988, A. Aquino, 2♂ (ECOAB 25649), (ECOAB 25651), 18-I-1989, A. Aquino, 1♂ (ECOAB 25650), 1♀ (ECOAB 25658), M. Cigarroa, 2♂ (ECOAB 25652), (ECOAB 25653), 1♀ (ECOAB 25659); Tonalá, 16°8’24.00” N, 93°40’48.00” W, 407.5 m, 21-V-2009, C. Balboa, 1♂ (ECOAB 56635), 12-VII-2009, C. Balboa, 1♀ (ECOAB 56636), 9-III-2009, M. Guzmán, 1♀ (ECOAB 25655), 16°30’0.00” N, 93°40’48.00” W, 407.5 m, 12-II-2009, C. Balboa, 1♀ (ECOAB 61187), 15°56’24.00” N, 93°49’12.00” W, 6 m, 31-I-2019, I. Pérez, 1♂ (ECOAB 130806), 25-I-1989, M. Cigarroa, 1♂ (ECOAB:66072); Tuxtla Chico, 14°58’12.00” N, 92°10’48.00” W, 395 m, 18-II-1992, M. Medina, 1♀ (ECOAB 56638), 1♂ (ECOAB:25647); Venustiano Carranza, 16°18’60.00” N, 92°33’59.76” W, 570 m, 21-IV-1993, J. L. Neff, 1♀ (EBCH JZ71). Guerrero: Iguala, 18°20’37.00” N, 99°32’21.01” W, 731.52 m, 4-II-1954, R. R. Dreisbach, 1♂ (SEMC 1451084); Tlapa de Comonfort, 17°33’0.00” N, 98°34’48.00” W, 1,063 m, 17-IV-1989, A. Aquino, 1♂ (ECOAB 56634). Jalisco: Cabo Corrientes, 19°39’0.00” N, 105°10’48.00” W, 49 m, 8-IX-2018, J. Mérida 1♀ (ECOAB 121569); El Tuito, 20°21’20.50” N, 105°18’59.96” W, 18-VI-1989, A. Borquez, 1♂ (EBCH JZ79); Jardín Botánico, 20°27’57.64” N, 105°17’30.89” W, 360 m, 26-VII-2014, C. E. Alatorre-Bracamontes y M. Vásquez-Bolaños, 1♂ (CZUG JZ12); La Huerta: Chamela, 19°29’54.77” N, 105°2’41.22” W, 20-VII-1985, R. Ayala, 2♂ (EBCH RA178bis JZ73), 1♂ (EBCH RA178bis JZ76), 19-XI-1989, G. Rodríguez, 2♂ (EBCH JZ74), (EBCH JZ75); Tequila: Volcán de Tequila, 20°51’50.99” N, 103°50’35.00” W, 1,300 m, 15-III-1996, H. E. Fierros-López, 1♂ (HFL JZ11), 15-III-1995, H. E. Fierros-López, 1♂ (CZUG 344); Zapopan: Barranca la Experiencia, 20°44’6.13” N, 103°19’38.38” W, 30-I-1997, G. Mercado, 1♂ (CZUG 1110), 31-VII-1996, G. Mercado, 1♂ (CZUG 1109). Morelos: Temixo: Cuentepec, 18°51’38.16” N, 99°19’30.72” W, 1,485 m, 31-X-2019, D. A. Hernández-Márquez, 1♀ (MZFC 33199), 18°51’27.72” N, 99°19’40.80” W, 1,455 m, 22-XII-2018, D. A. Hernández-Márquez, 1♀ (MZFC 32554). Querétaro: Jalpan de Serra, 21°13’0.01” N, 99°28’21.00” W, 770 m, 24-V-1989, D. Yanega, 2♀ (SEMC 1451144), (SEMC 1451145). Nayarit: San Blas, 20 km al sur de San Blas, 21°23’25.00” N, 105°6’14.00” W, 10 m, 7-IV-1994, F. Noguera, 1♂ (SMO 328474). Oaxaca: San Pedro Totolapa, 8.04672 km al noroeste de San Pedro Totolapa, 16°43’23.12” N, 96°19’14.27” W, 1,158.24 m, 6-VII-1953, Univ. of Kans. Mex. Exped., 1♂ (SEMC 1451086); Putla Villa de Guerrero, 17°0’36.00” N, 97°57’0.00” W, 849 m, 24-V-2020, Wilebaldo, V., 1♀ (ECOAB 58886). Puebla: Cuetzalan del Progreso, 20°3’36.00” N, 97°28’12.00” W, 413 m, 26-III-2020, L. Arroyo, 1♂ (ECOAB 137985). Sonora: Álamos, La Aduana, 27°2’27.16” N, 109°0’57.91” W, 567 m, 15-III-1962, L. A. Stange, 1♀ (SEMC 1442316). Tabasco: Huimanguillo, 17°49’48.00” N, 93°55’12.00” W, 21 m, 3-VI-2015, P. Sagot, 1♂ (ECOAB 77134). Veracruz: without locality, 1♀ (CERUADY 037ver); Acayucan, 48.2803 km al sur de Acayucan, 17°38’6.41” N, 94°54’14.40” W, 56 m, 21-IV-1962, L. A. Stage, 1♀ (SEMC 1442318); Coatepec, 19°26’42.36” N, 96°57’52.13” W, 1,200 m, 1-VI- 2020, G. Quintos-Andrade, 3♀ (IEXA JZ40 – IEXA JZ42), 3-VI- 2020, G. Quintos-Andrade, 1♀ (IEXA JZ43). 4-VI- 2020, G. Quintos-Andrade, 1♀ (IEXA JZ44), 7-VI-2020, G. Quintos-Andrade, 1♀ (IEXA JZ45), 6-VI- 2020, G. Quintos-Andrade, 3♀ (IEXA JZ46 – IEXA JZ48); Medellín: Paso del Toro, 4.82803 km SW of Paso del Toro, 19°0’46.43” N, 96°8’39.30” W, 15.24 m, 23-VI-1961, Univ. of Kans. Mex. Exped., 1♂ (SEMC 1451081); Teocelo, Llano Gande, 19°22’13.01” N, 96°52’50.99” W, 833 m, 17-VI-1990, G. Rodríguez, 1♀ (SEMC1451143); Xalapa, 35.4056 km SW of Xalapa, 19°24’20.92” N, 96°38’46.46” W, 335.28 m, 29-VI-1953, Univ. of Kans. Mex. Exped., 1♂ (SEMC 1451176); Veracruz, 18°54’29.30” N, 96°8’16.01” W, 27-III-1951, W. P. Stephen, 1♂ (SEMC 1451083). Yucatán: Izamal, Plaza Izamal, 20°56’1.00” N, 89°1’5.00” W, 15 m, 24-V-1995, W. May, 1♀ (CERUADY 22841(02486)), 1♂ CERUADY 22838(02482), A. Canto, 2♂ (CERUADY 22488(02482)), (CERUADY:22481(02484)); Kinchil, Parque Central Kinchil, 20°55’1.23” N, 89°56’50.18” W, 8 m, 24-V-1995, F. León, 1♂ (CERUADY 019671(02480)), 8-V-1995, R. Rodríguez, 1♂ (CERUADY 021772(02481)); Xmatkuil, CCBA, 20°52’2.86” N, 89°37’28.10” W, 11 m, 18-V-2022, A. Sansores, 1♂ (CERUADY JZ206), 16-V-2022, 1♀ (CERUADY JZ211), 1♂ (CERUADY JZ207). Nicaragua: Rivas: Cárdenas, 11°14’24.00” N, 85°42’36.00” W, 90 m, 26-V-2015, E. Dorgay, 1♀ (ECOAB 66669); San Juan del Sur, 11°6’36.00” N, 85°45’36.00” W, 1 m, 6-IV-2017, M. Calero, 1♀ (ECOAB 80382), 0 m, 6-IV-2017, M. Calero, 1♂ (ECOAB 80393). Panama: Colón, 3.21869 km NW of Gamboa, 9°7’42.46” N, 79°42’55.28” W, 65 m, 21-I-1958, W. J. Hanson, 1♀ (SEMC 1451152); 8 km NW of Gamboa, pipeline road, 9°8’38.63” N, 79°43’38.22” W, 61 m, 12-I-1981, C. D. Michener, 1♀ (SEMC 1451153). Panamá: Zona del Canal, Juan Mina, 9°13’39.67” N, 79°57’2.59” W, 106 m, 22-VI-1945, C. D. Michener, 1♂ (SEMC 1451082); Curundú, 8°59’26.73” N, 79°32’27.29” W, 34 m, 31-III-1981, R. W. Brooks, 1♂ (SMO 725157), 19-V-1981, R. W. Brooks, 4♂ (SMO 725158), (SEMC 1254922 – SEMC1254924). Panamá Oeste: Laguna, Chame, 8°39’53.99” N, 80°6’10.90” W, 792.48 m, 29-IV-1945, C. D. Michener, 1♂ (SEMC1451085); Zona del Canal, Río Corona, 8°28’55.22” N, 80°1’42.15” W, 609.6 m, 3-V-1952, C. W. Rettenmeyer, 1♀ (SEMC 1451146); Isla Barro Colorado, 9°11’0.00” N, 79°51’0.00” W, 21-II-1956, C. W. Rettenmeyer, 1♀ (SEMC 1451147), 16-IV-1956, C. W. Rettenmeyer, 1♀ (SEMC 1451148), 15-II-1956, C. W. Rettenmeyer, 1♀ (SEMC 1254915), 19-II-1956, C. W. Rettenmeyer, 1♀ (SEMC 1254916), 7-III-1967, M. Naumann, 1♀ (SEMC 1451149); Fort Kobbe, 8°55’0.30” N, 79°34’59.59” W, 8 m, 11-I-1960, W. J. Hanson, 1♀ (SEMC 1451150), 1♂ (SEMC 1451151).
Figure 22. Mesoplia (M.) dugesi, male: A, S7. B, S8. C and D, genital capsule, dorsal and lateral view, respectively.
Distribution. Registered from south Sonora in northern Mexico, to Brazil, according to opinion of Melo and Genaro (Genaro & Franz, 2008), its distribution is restricted to continental America, so its presence on the islands of the continent would be ruled out (Fig. 27).
Taxonomic comments. Within the genus, it is the species with the widest distribution (Fig. 27), largest number of registered hosts (Table 2). This is possibly a species complex; we did not find morphological characters that allow us to delimit it in a group of species.
Diagnosis. Female: body metallic blue but black in face and mesosoma and metasoma (Fig. 28); scape with dark integument on the base and reddish brown on apex; pedicel with dark integument; integument of f1 ferruginous, remainder of flagellum dark brown; labrum, without metallic blue scales on vertex, occiput and tegula (or not very evident on tegula (Fig. 28B)); tegula integument dark brown; legs with integument on outer surface of blackish and inner surface dark reddish brown; with a carina extending laterally from the pronotal collar to the pronotal lobe; conical scutellar tubercles moderately projected, with a median cleft between them (Fig. 28D); tergal pubescence blackish; middle tibial spur forked with dark reddish-brown integument, anterior projection with 4 internal teeth; pygidial plate with a broad apex and almost completely covered by metallic bluish-green scales (Fig. 4G).
Figure 23. Mesoplia (M.) dugesi, female: A, lateral habitus; B, dorsal habitus; C, frontal habitus; D, posterior view of the scutellar tubercles.
Description. Holotype: female. Body length 13.5 mm, forewing length 12.5 mm, head length 3.5 mm, intertegular distance 4.4 mm, T2 length 2.8 mm. Head: mandible with an internal tooth. Labrum subrectangular, surface slightly concave, with a raised preapical margin. Ocelli aligned to the upper margin of the eyes, protruding above the head in lateral view. Mesosoma: with a carina extending laterally from the pronotal collar to the pronotal lobe. Scutum convex in lateral view. Scutellar tubercles conical, without posterior carina, with an evident cleft between them. Vertical metanotum and propodeum. Short pointed middle tibial spine. Medial tibial spur bifurcated, anterior projection with 4 internal teeth. Medium basitarsus with tridentate external margin and with a thin flattened distal process slightly curved externally. Metasoma: broad pygidial plate at the base, and with a broad rounded apex (Fig. 4G). Color: integument blackish to dark reddish brown. Head: scape mostly blackish, with dark reddish brown upper outer edge. Pedicel also bicolor. F1 ferruginous, remainder of flagellum brown. Basal and apical region of the mandible dark, with a yellowish brown area in the base of the teeth and reddish brown near the base. Mesosoma: pronotal lobe and tegula blackish. Wings almost transparent. Forewings with the anterior edge and the distal apex of the marginal cell darker, also presenting a darker spot that goes from the external edge of the 2r-m to the wing apex (Fig. 28B). Very dark veins. Inner surfaces of legs dark reddish brown, outer surfaces blackish. Apex of distal process of middle basitarsus blackish. Middle tibial spur reddish-brown. Metasoma: sterna blackish, except for S6 which is reddish brown. Surface sculpture: head. Labrum with most surface rugose, basal edge polished. Mesosoma: punctured tegula. Dotted propodeum. Metasoma: dotted pigidial plate. Pubescence: approximately the same proportion of blackish and whitish. Head: labrum discal area with white plumose setae and scattered simple black setae; lower edge with a pair of long dark tufts; lateral edges with simple black setae and upper edge bare. Clypeus and supraclypeal area, with lateral with white plumose setae, discal surface with little pubescence, some elongated black simple setae evident in lateral view. Frons with brown setae. Paraocular area with white plumose setae. Vertex and preoccipital region with white setae. Gena with white setae, except for the darks on lower area. Mesosoma: pronotal lobe, with the inner and posterior margins with white setae, rest with blackish setae, with light metallic green scales, only slightly evident in frontal view. Mesepisternum with blackish setae, with a thick longitudinal white line. Scutum covered mainly by black setae, except for the lateral edges near the posterior two-thirds of the tegula that have white setae, a central disc with light metallic green scales. Tegula with black setae on the anterior margin and white on the posterior, and with few light metallic green scales on the inner margin, only slightly evident in the opposite lateral view. Scutellum, upper area with few black setae and light metallic blue scales, posterior part with white setae project a little between the tubercles, also with light metallic blue scales in posterior view. Metanotum blackish. Propodeum upper region naked, posterolateral region blackish. Mainly black legs. Outer surface of anterior tibia with a few light metallic green scales, some white plumose setae and simple blackish elongated setae and also present on the basitarsus. With light metallic blue scales evident on the outer surface of the tibia and basitarsus of the middle and hind legs. Metasoma: terga covered with metallic blue-green scales and setae almost black and simple, except on the side of T5, S2 to S4. T6, with thick black setae on the sides; pygidial plate with light metallic green scales that do not reach the apex (Fig. 4G); sterna with scattered black setae.
Figure 24. Mesoplia (M.) rufipes, male: A, lateral habitus; B, dorsal habitus; C, frontal habitus; D, posterior view of the scutellar tubercles.
Male: unknown.
Taxonomic summary
Type material. Holotype: ♀ ECOAB 74052 MEX. OAX [Mexico, Oaxaca], Santiago Nacaltepec, 17°28’12.00” N, 96°49’12.00” W, 1,377 m, 4-XII-2014, L. M. Reyes (ECOAB).
Etymology. The name oaxacana makes reference to the known distribution of this species, the state of Oaxaca.
Distribution. It is only known from the type locality (Fig. 10).
Taxonomic comments. This species is similar to M. dugesi since the majority of the pubescence is dark. But this species has few metallic scales on the face (Fig. 28C) and tegula (Fig. 28B), and the apex of the pygidial plate is broad (Fig. 4G).
Subgenus Eumelissa Snelling & Brooks, 1985
Eumelissa Snelling & Brooks, 1985: 21. Type species: Melissa decorata Smith, 1854: British Museum Natural History, London, England (♀), by original designation.
Diagnosis. Male: posterior tibia, distal inner surface without a conspicuous setal brush (Fig. 3F, G); hind tibial spurs reaching to or beyond middle of basitarsus, both present. Female: pygidial plate narrow, does not completely occupy the exposed dorsal surface of T6; pygidial plate glabrous (Figs. 4H, 23D); dorsal surface of posterior coxa abruptly rounded at the junction with lateral surfaces.
Diagnosis. Male: body metallic blue, with mostly whitish pubescence; whitish-yellowish pubescence on the face, except for the frons, which has brown pubescence; scape and pedicel with integument dark; basal and apical flagellomere, pronotal lobe, tegula and legs with integument ferruginous; anterior region of the scutellar disc pubescence with a color pattern that goes from blackish in the anterior region, brownish-yellowish to whitish (Fig. 29B); scutellar tubercles flattened; forked spur of middle tibia ferruginous, becoming dark at apex, both branches short, external apex with 3 or 4 internal teeth (Fig. 16D). Terga pubescence whitish, with a pair of white spots with short pubescence in the marginal area of T2 to T6 (Fig. 29D); forked apex of T7, both tips truncated and bare, median cleft shallow (Fig. 7F); S4 bilobed, with a band of very short, dark hairs on the distal margin; dorsal lobe of the gonostylus elongated and projected towards the penis valvae (Fig. 30C, D).
Figure 25. Mesoplia (M.) rufipes, male: A, S7. B, S8. C and D, genital capsule, dorsal and lateral view, respectively.
Female: body metallic blue, with mostly whitish pubescence; F1 shorter than F2; scape and pedicel integument reddish brown; F1, pronotal lobe, tegula and legs integument ferruginous; pubescence of the anterior region of the scutum short and branched, with a characteristic pattern that transversely intersperses spots of whitish and blackish setae (Fig 20B); scutellar tubercles flattened with a superficial cleft between them and with short, bushy black pubescence on the apical edge; terga pubescence whitish; with a pair of white spots with short pubescence in the marginal area of T2 to T4 (Fig. 31A); mesosoma and metasoma, ventral surface with metallic blue scales; middle tibial spur forked with ferruginous integument, becoming dark at apex, both branches short, external apex with a series of 3 or 4 short internal teeth (Fig. 18D); pygidial plate narrow at the base, does not cover the entire posterior margin of T5, glabrous, without scales or hairs (Fig. 4H).
Description. Holotype: male. Body length, 11.3 mm (10.8-11.9; n = 4), forewing length 9.4 mm (9.1-10; n = 4), head length 3.4 mm (3.4-3.5; n = 4), intertegular distance 3.3 mm (2.8-3.5; n = 4), T2 length 1.729 mm (1.6-1.8; n = 4). Head: mandible with an internal tooth. Labrum subrectangular, flat surface, with a slightly elevated preapical margin. Ocelli aligned to the upper margin of the eyes, protruding only a little above the head in lateral view. Mesosoma: convex scutum in lateral view. Scutellar tubercles with a flattened surface, a superficial cleft between them. Vertical metanotum and propodeum. Medial tibial sine short pointed (Fig. 1D). Medial tibial spur bifurcated near the apex, noticeably elongated, internal tip with a single thin elongated tooth, external tip with a series of 3 or 4 internal teeth (Fig. 16D). Medial basitarsus with posterior margin smooth and with short and straight flattened distal process (Fig. 1D). Posterior femur thin. Posterior tibia with 2 spurs at the apex, the inner one longer than the outer one (Fig. 3F). Metasoma: T7 with a flattened surface, bifurcated, with a shallow central cleft, short distance between the apices, both ends truncated (Fig. 7F). Color: blackish to ferruginous integument. Head: ferruginous labrum. Blackish face. Ferruginous scape (some specimens with a reddish spot at the apex). Dark brown pedicel. Ferruginous F1 and F11, remainder of flagellum brown. Apical third of the mandible with apical third blackish (some specimens with yellowish-brown tints), rest dark reddish brown. Mesosoma: ferruginous pronotal lobe and tegula. Blackish mesepisternum. Apex of distal process of middle basitarsus reddish brown. Spur of the middle tibia mainly ferruginous, with blackish apices. Wings almost transparent. Forewings with the anterior edge of the marginal cell darker, also presenting a subtly darkened spot that goes from the outer apex of the marginal cell to the wing apex. Brown veins. Ferruginous legs. Blackish propodeum. Metasoma: ferruginous sterna. Surface sculpture: head. Labrum with most of the surface rugose, the basal edge polished. Mesosoma: punctured tegula. Dotted propodeum. Metasoma: polished T7 apical surface. Pubescence: mainly whitish. Head: labrum discal area with pale yellowish plumose setae; lower edge with a pair of long brown tufts; lateral edges with simple brown setae and upper edge bare. Clypeus and suplaclypeal area, with pale yellowish plumose setae. Frons with brown setae. Paraocular area with pale yellowish plumose and simple setae, some specimens with bright yellow setae in the upper region. Vertex and preoccipital region with white compound setae. Gena with white compound setae, except for the brown on lower area. Mesosoma: pronotal lobe, with yellowish anterior margins, white lateral and posterior margins, practically naked posterior surface. Mesepisternum anterior margin with bright yellow and brown setae, some specimens with the lower portion with a black spot, rest of the surface white except for a spot of black setae below the tegula. Scutum anterior area with a characteristic pattern that goes from blackish, passing through yellowish-brown, until reaching whitish in the region of the discal surface, the latter with metallic blue scales and scattered setae (Fig. 29B). Axila lateral edges with black setae. Tegula with white setae on the inner anterior edge and at the posterior apex, and black on the inner and outer anterior edge, rest of the surface bare. Scutellum upper region with few scattered short black setae and metallic blue scales, scutellar tubercles posterior apices with long black setae and with a line of short, branched white setae between them, posterior area with long white, branched setae (Fig. 29B). Metanotum with white setae. Propodeum upper region naked, posterolateral region whitish-light brown. Legs mainly dark. Anterior tibia outer surface scaleless, with a tuft of short plumose white setae on the outer basal surface, with long simple dark setae running from the outer apex of the tibia and extending along the basitarsus. External surface of middle and posterior tibia and basitarsus with metallic blue scales evident on the external surface. Coxa and trochanter with simple long white setae scattered. Metasoma: terga and sterna with metallic blue scales. Sternum disc with scattered long thin white setae. Anterior edge of T1 with thin white moderately bushy setae, lateral edges with a white patch of short plumose setae. Marginal zone of T2 to T4 with a pair of white spots with short pubescence, from T4 onwards they tend to merge with a lateral spot (Fig. 29D). T7 with simple black setae on the sides. T1 to T6 with a lateral stripe of short, branched setae. Sterna setae scattered black. S4 with short, branched brown setae near the apex and with several rows of simple black setae. S2 to S4 with a more or less triangular white spot on the lateral margins.
Figure 26. Mesoplia (M.) rufipes, female: A, lateral habitus; B, dorsal habitus; C, frontal habitus; D, posterior view of the scutellar tubercles.
Allotype: female. Body length 12.3 mm (11-14.3; n = 3), forewing length 12.3 mm (9.3-17.5; n = 3), head length 3.5 mm (n = 3), intertegular distance 3.5 mm (3.4-3.6; n = 3), T2 length 1.8 mm (1.6-1.9; n=3). Head: mandible with an internal tooth. Labrum subrectangular, surface flattened, with a subtly raised preapical margin. Ocelli aligned to the upper margin of the eyes, protruding only a little above the head in lateral view. Mesosoma: convex scutum in lateral view. Scutellar tubercles flattened, with a superficial cleft between them (Fig. 31A, D). Vertical metanotum and propodeum. Medial tibial spine short pointed. Medial tibial spur notably elongated bifurcated near apex, inner tip with a single slender tooth elongated and curved posteriorly, outer apex has a series of 3 or 4 short inner teeth curved anteriorly (Fig. 18D). Basitarsus medium with smooth posterior margin and with flattened distal process slightly curved externally (Fig. 2D). Metasoma: narrow pygidial plate at the base, forming an angle of approximately 30°, apex rounded (Fig. 4H). Color: blackish to ferruginous integument. Head: scape with dark brown inner edge, rest ferruginous. Pedicel also bicolor, dark brown and ferruginous. Flagellum goes from ferrugous in the basal region to dark brown in the distal region. Apical third of mandible blackish, base dark reddish brown, with a yellowish-brown region at base of teeth extending approximately to end of first third. Mesosoma: pronotal lobe, tegula, upper region of the mesepisternum ferruginous. Wings almost transparents; forewings with the anterior edge of the marginal cell darker, also presenting a subtly darkened spot that goes from the outer apex of the marginal cell to the wing apex. Brown veins. Ferruginous legs. Blackish propodeum. Metasoma: dark pygidial plate. Ferruginous sterna. Surface sculpture: head. Labrum with most of the surface rugose, basal edge polished. Mesosoma: punctured tegula. Dotted propodeum. Metasoma: polished pygidial plate. Pubescence: mostly whitish with some blackish areas. Head: labrum with a thick transverse central band of branched white setae and with few scattered brown simple setae; lower edge with a pair of long brown tufts and some short simple brown setae; lateral edges with simple short brown setae and upper edge bare. Clypeus and supraclypeal area with short white plumose setae, discal area with little pubescence, some simple elongated white setae evident in lateral view. Scape with a tuft of short white plumose setae at the outer edge. Frons with brown setae. Paraocular area with short white plumose setae and some long simple. Vertex and preoccipital region with white compound setae. Gena with white compound setae, except for the lower region that has brown. Mesosoma: pronotal lobe with lateral and posterior margins with short white compound setae, with scattered simple blackish setae (Fig. 31C); anterior surface with metallic blue scales, evident in frontal view; discal surface practically naked. Surface surrounding the pronotal lobe with a thick strip of light brown branched short pubescence. Mesepisternum upper surface mainly with white branched short setae, lower surface with metallic blue scales. Scutum anterior area with short and branched setae, with a characteristic pattern, central area with a thin whitish stripe, followed on both sides by a more or less rectangular blackish spot, these followed by a more or less rectangular whitish spot, after them, a quadrangular blackish spot bordered by whitish setae (the whitish areas have interspersed dark setae); discal area with scattered short simple white setae and metallic blue scales, lateral edges with branched short white setae. Tegula with white setae on the inner anterior edge and at the posterior apex, and black on the inner and outer anterior edge, rest of the surface bare. Scutellum upper region with few scattered short black setae and metallic blue scales; bushy black setae at the posterior apices of the tubercles and with a line of short, branched white setae between them, posterior region with long white, branched setae (Fig. 31B, D). Metanotum with white setae. Propodeum upper region naked, posterolateral region whitish-light brown. Legs mainly dark. Anterior tibia outer surface scaleless, with a tuft of short plumose white setae on the outer basal surface, with long simple dark setae running from the outer apex of the tibia and extending along the basitarsus. External surface of middle and posterior tibia and basitarsus with metallic blue scales evident on the external surface. Coxa and trochanter with simple long white setae scattered. Metasoma: terga and sterna with metallic blue scales. Anterior edge of T1 with white simple long setae, lateral apices with a whitish light brown spot. Marginal zone of T2 to T4 with a pair of white spots with short pubescence, in T4 they tend to merge with a lateral spot. Lateral margins of T2 toT5 and S2 to S4with a strip of short white setae (Fig. 31A). T6 with thick black setae on the sides of the naked pygidial plate. Sterna with scattered black setae.
Variation. Some males from Costa Rica also present yellow setae on the white spots of T4 to T6, the white pubescence spots appear from T1 and they all tend to be fused together.
Figure 27. Map with the known distribution of Mesoplia (M.) rufipes.
Taxonomic summary
Type material. Holotype: ♂ ECOAB 566228, MEX. CHIS [Mexico, Chiapas], Arriaga, 16°13’48.00” N, 93°58’48.00” W, 367.5 m, 10-III-2009, R. Vargas (ECOAB). Allotype: ♀ ECOAB 134689, MEX. CHIS [Mexico, Chiapas] La Concordia, 16°3’36.00” N, 92°34’48.00” W, 550 m, 5-III-2020 P. Sagot (ECOAB). Paratypes: ♀ MZUCR HY6837, CR. GUA [Costa Rica, Guanacaste], La Cruz, Cuajiniquil Bahía Tomás, Salinitas, in mangrove, 10°55’17.40” N, 85°42’57.96” W, 7-III-2022/18-III-2022, M. M. Chavarría & P. Hanson (MZUCR); ♂ MZUCR HY10213, CR. GUA [Costa Rica, Guanacaste], La Cruz, Cuajiniquil, Parque Nacional Santa Rosa, 10°54’19.51” N, 85°46’11.78” W, 80 m, 20-II-2024, M. F. Otárola, M. Solano & M. M. Chavarría (MZUCR), ♂ MZUCR HY10221, 10°54’49.68” N, 85°48’15.41” W, 33 m, 21-II-2024, M. F. Otárola, M. Solano & M. M. Chavarría (MZUCR), ♂ MZUCR HY10257, 10°50’20.40” N, 85°37’4.80” W, 295 m, 7-II-2019, J. Lobo (MZUCR), same data as the previous one, ♀ MZUCR HY10257; ♂ ECOAB 566230, GU. HUE [Guatemala, Huehuetenango], San Antonio Huista, 15°40’12.00” N, 91°57’36.00” W, 1,007 m, 20-II-2010, J. Mérida (ECOAB). Same locality as the holotype, 2♀ ECOAB 566231, 566232, 13-III-2009, C. Balboa (ECOAB); same data as the allotype, ♀ ECOAB 134688 (ECOAB); ♂ ECOAB 566229, MEX. CHIS [Mexico, Chiapas], Tonalá, 16°8’24.00” N, 93°40’48.00” W, 407.5 m, 19-I-2009, C. Balboa (ECOAB); ♂ ECOAB 67237, MEX. CHIS [Mexico, Chiapas], Chiapilla, 16°33’0.00” N, 92°0’0.00” W, 561 m, 1-I-2017, P. Sagot; ♂ ECOAB 67320, MEX. CHIS [Mexico, Chiapas], Venustiano Carranza, 16°21’0.00” N, 92°37’12.00” W, 597 m, 1-II-2017, P. Sagot (ECOAB); ♂ ECOAB 67390 MEX. CHIS [Mexico, Chiapas], Solcotenango, 16°9’0.00” N, 92°22’48.00” W, 723 m, 14-I-2017, P. Sagot. (ECOAB); ♂ ECOAB 125155, MEX. CHIS [Mexico, Chiapas], Nicolás Ruiz, 16°28’12.00” N, 92°36’0.00” W, 890 m, 8-III-2020, P. Sagot (ECOAB); ♀ ECO-TAE57096, MEX. CHIS [Mexico, Chiapas], Arriaga, ej. López Mateos, 16°20’46.60” N, 93°58’26.80” W, 255 m, 10-III-2009, C. Balboa, M. Guzmán & M. Cigarroa (EBCH). Same data as the previous one, 2♀ ECO-TAE57326, ECO-TAE57327, 3♂ ECO-TAE67405, ECO-TAE57406, ECO-TAE57407. ♀ HFL JZ5, MEX. JAL [Mexico, Jalisco], La Huerta, Chamela, Estación biológica, vereda Chachalaca, 19°29’37.20” N, 105°2’44.94” W, 300 m, 9-IV-2014/11-IV-2014, E. Ramírez & A. Estrada (CZUG); ♀ CNIN-AP 009852, MEX, OAX [Mexico, Oaxaca], Santa Maria Huatulco, Parque Nacional Huatulco, 15°45’59.40” N, 96°12’11.00” W, 14-IV-2022, A. Saldivar & P. Benítez (CNIN).
Other material examined. ♂ MZUCR HY5700, no collection data (MZUCR).
Etymology. This species is dedicated to Luz del Carmen Fernández Rodríguez, mother of the first author. The noun is feminine and declined in the genitive case.
Distribution. It is only known from Jalisco, Oaxaca and Chiapas in Mexico, Huehuetenango in Guatemala and Guanacaste in Costa Rica, it is highly probable that it is also found in Belize, El Salvador, Honduras and Nicaragua (Fig. 10).
Taxonomic comments. This species is easily recognizable by the middle tibial spur with 2 short arms in respect to the rest of the spur (Figs. 29D, 33D) and with spots of whitish setae on the sublateral area of T2 to T6 in males (Fig. 29D) and T2 to T4 in females (Fig. 31A).
Table 2
Known host associations for species of Mesoplia Lepeletier, 1841.
Cleptoparasite
Hosts
Relationship record
Type of evidence
Reference
Mesoplia (M.) bifrons (Fabricius, 1804)
Centris (Centris) caxiensis Ducke, 1907
Brazil
Confirmed
Rocha-Filho et al. (2009)
Mesoplia (M.) cubensis Genaro & Breto, 2022
Centris (Centris) poecila Lepeletier, 1841
Cuba
Probable
Genaro and Breto (2022)
Mesoplia (E.) decorata (Smith, 1854)
C. (Centris) flavofasciata Friese, 1900
Costa Rica, Guanacaste
Presumed
Vinson et al. (1987)
Mesoplia (M.) dugesi (Cockerell, 1917)
C. (Exallocentris) aterrima Smith, 1854
Mexico
Suspected
Snelling (1984)
Mesoplia (M.) insignis (Smith, 1879)
C. (Acritocentris) agilis Smith, 1874
Mexico, Jalisco
Probable
This work
Mesoplia (M.) regalis (Smith, 1854)
C. (Centris) flavofasciata Friese, 1900
Costa Rica, Guanacaste
Confirmed
Vinson et al. (1987)
C. (Centris) flavifrons (Fabricius 1775)
Brazil, Paraiba
Confirmed
Martins et al.(2014)
Mesoplia (M.) rufipes (Perty, 1833)
C. (Centris) aenea Lepeletier, 1841
Brazil, Cerrado
Probable
Aguiar and Gaglianone (2003); Rocha-Filho et al. (2009)
Mesocheira ornata Spinola, 1841: 145. Holotype: Museo Regionale di Scienze Naturale, Torino, Italy (♀). Type locality: French Guiana, Cayenne.
Diagnosis. Male: body metallic green, bright yellow and black pubescence (Fig. 32); integument of the antenna, pronotal lobe, tegula and legs black, except for some internal regions of the hind leg which are dark reddish; pubescence of the head and mesosoma mostly bright yellow; conical scutellar tubercles, with a noticeable cleft between them; short and wide forked medial tibial spur, with dark reddish integument that becomes blackish at the apex, wide anterior projection, with 2 to 3 internal teeth (Fig. 3G); pubescence of the terga mainly whitish with a bright yellow maculation on both lateral margins of T1 and T2 (Fig. 32A, B); apex of T7 forked, both pointed and bare at tip, median cleft shallow but fairly wide, separating apices considerably (Fig. 7G); S4 bilobed, with several rows of compound pubescence on the apical margin, dark in color in the center and becomes light in the middle of the apices and continues that color towards the lateral edges of the lobes; digitiform and dorsal lobe of the gonostylus of similar size (Fig. 33C, D).
Female: body metallic blue, black and pale yellow pubescence (Fig. 34); integument of antenna, pronotal lobe, tegula and legs black; F1 a little longer than F2; yellowish pubescence in preoccipital region, gena, collar of the pronotum, a broad band in the center of the mesepisternum, the posterior region of the scutellum and metascutum; conical scutellar tubercles, projecting upwards with an evident cleft between them; robust medial tibial spur, bifurcated practically in half, internal tip curved posteriorly, has an internal tooth that in some cases is located on the bifurcation, external apex wider, has 2 internal teeth; pygidial plate, narrow at the base, rounded apex, forming an angle of approximately 35°, glabrous, without scales or hairs (Fig. 34D).
Figure 29. Mesoplia (E.) carmelitae sp. nov. Holotype, male: A, lateral habitus; B, dorsal habitus; C, frontal habitus; D, detail of the metasoma.
Taxonomic summary
Material examined. Costa Rica: Guanacaste: Estación Biológica Maritza, 10°57’25.06” N, 85°29’42.01” W, 573 m, 1988/1999, 1♀ (MZUCR HY6820), 1990, 1♀ (MZUCR HY6822). Mexico: Chiapas: La Concordia, 15°58’48.00” N, 92°48’36.00” W, 581 m, 2-III-2016, P. Sagot, 1♂ (ECOAB 76697).
Distribution. Previously it had only been recorded in South America. If the identity of this species is confirmed, its distribution would expand to southern Mexico in Chiapas (Fig. 10).
Taxonomic comments. The male is similar to M. insignis due to the yellow coloration of the mesosoma. It is differentiated among other characters by the lack of pubescence brush on the inner margin of the posterior tibia (Fig. 3G) and by the shape of the T7 whose internal notch resembles a semicircle (Fig. 7G).
Key for species of Mesoplia Lepeletier, 1841 of Mexico and Central America.
Figure 30. Mesoplia (E.) carmelitae sp. nov. Holotype, male: A, S7. B, S8.C and D, genital capsule, dorsal and lateral view, respectively.
Males
1. Distal inner surface of the posterior tibia, with a setal brush (Fig. 3A-E); hind tibial spurs not reaching beyond basal third of basitarsus, some species with only 1 spur present [M. (Mesoplia)] ………………………………………………………………… 2
– Distal inner surface of the posterior tibia, without a setal brush (Fig. 3F, G); hind tibial spurs reaching to or beyond middle of basitarsus (Fig. 3F), both present M. (Eumelissa) …………………………………………………………………7
2(1). Inconspicuous hind tibia setal brush (Fig. 3D, E); 1 spur on the posterior tibia; ventral basal surface of posterior femur with a robust posterior projection; inner surface of posterior basitarsus with a longitudinal carina (Group azurea) ………………………………………………………………… 3
– Conspicuous hind tibia setal brush (Fig. 3 A-C); 2 spurs on the posterior tibia; ventral basal surface of posterior femur without a robust posterior projection; inner surface of posterior basitarsus without a longitudinal carina (Group bifrons) ………………………………………………………………… 4
3(2). Setae of most of the body mainly dark; metallic scales on the tegula present (Fig. 21B); integument of legs blackish (Mexico) Mesoplia dugesi (Cockerell, 1917)
– Setae of most of the body mainly whitish; metallic scales on the tegula ausent (Fig. 24B); integument of legs redish brown (Mexico to South America) Mesoplia rufipes (Perty, 1833)
– Pubescence of the mesosoma mainly blackish and whitish, if it presents yellowish setae they are restricted to the posterior region of the scutellum ………………………………………………………………… 6
Figure 31. Mesoplia (E.) carmelitae sp. nov. Allotype, female: A, lateral habitus; B, frontal habitus; C, dorsal habitus; D, posterior view of the scutellar tubercles.
5(4). Pubescence of the mesosoma almost exclusively bright yellow; central disc of scutum and dorsal surface of scutellar tubercles with yellow setae; metasoma with a spot of bright yellow pubescence on lateral margins of T1 and T2 (repeated in some specimens until T4) (Fig. 6A); T7 concavity shallow; T7 apices broadly rounded (Fig. 7A) (México) ………………………………………………………………… Mesoplia insignis (Smith, 1879)
– Pubescence of the mesosoma bright yellow interrupted by a broad transverse band in the anterior region; central disc of scutum and dorsal surface of scutellar tubercles with scattered black setae; metasoma with a bright yellow pubescent spot on both lateral margins of T1 (some specimens also with a very small spot on T2) (Fig. 11A); T7 concavity deep; T7 apices narrowly rounded (Fig. 7B) (Costa Rica) ………………………………………………………………… Mesoplia tica sp. nov.
6(4). T7 with apices rounded and setae on ventral side come out a little in dorsal view (Fig. 7C) (Mexico and Central America) ………………………………………………………………… Mesoplia sapphirina Melo & Rocha-Filho, 2011
– T7 with apices flat and with ventral setae below conspicuous in dorsal view (Panama and South America) ………………………………………………………………… Mesoplia regalis (Smith, 1854)
7(1). Pubescence of the head and mesosoma mainly bright yellow; metasoma with spots of pubescence bright yellowon lateral margins of T1 and T2 (Fig. 32A, B); without spots of short white pubescence on the marginal areas of T3 to T6; middle tibial spur with long branches (Fig. 16E) (South of Mexico, Chiapas, to South America) ………………………………………………………………… Mesopliaornata (Spinola, 1841)
Pubescence of the head and mesosoma mainly whitish; without yellow pubescence on the metasoma; with 2 spots of short white pubescence in the marginal zone of T2 to T6 (Fig. 29D); branches of the middle tibial spur short (Fig. 16D) (Mexico, Guatemala and Costa Rica) ………………………………………………………………… Mesoplia carmelitae sp. nov.
Figure 32. Mesoplia (E.) ornata, male: A, lateral habitus; B, dorsal habitus; C, frontal habitus; D, scutellar tubercles posterior view (photos A, B by Jorge Mérida).
Females
1. Pygidial plate broad, occupying the exposed dorsal surface of T6 and covered with scales or setae (Fig. 4A-G); dorsal surface of posterior coxa angulate or carinate at the junction with the lateral surfaces [M. (Mesoplia)] ………………………………………………………………… 2
– Pygidial plate narrow, does not completely occupy the exposed dorsal surface of T6 and without scales or setae (Figs. 4H, 23D); dorsal surface of posterior coxa abruptly rounded at the junction with lateral surfaces [M. (Eumelissa)] …………………………………………………………………9
2(1). Pronotum with a carina extending laterally from the pronotal collar to the pronotal lobe (Fig. 5B) (Group azurea) ………………………………………………………………… 3
– Pronotum without a carina extending laterally from the pronotal collar to the pronotal lobe (Fig. 5A) ………………………………………………………………… 5 Group bifrons (sensu Moure, 1960a, b)
3(2). With metallic scales evident on head and tegula (Mexico) (Fig. 23B) ………………………………………………………………… Mesoplia dugesi (Cockerell, 1917)
– Without metallic scales or inconspicuous on head and tegula ………………………………………………………………… 4
4(3). Setae on most of the body mainly dark; pygidial plate with broad apex (Fig. 4G) (Mexico, Oaxaca) ………………………………………………………………… Mesopliaoaxacana sp. nov.
– Setae of most of the body mainly whitish; pygidial plate with narrow apex (Fig. 4F) (Mexico to South America) ………………………………………………………………… Mesoplia rufipes (Perty, 1833)
5(2). With bright yellowpubescence on head, mesosoma and metasoma (Fig. 20) (Mexico, Veracruz) ………………………………………………………………… Mesoplia veracruzana sp. nov.
– Without bright yellow pubescence on head, mesosoma and metasoma ………………………………………………………………… 6
6(5). With metallic scales very evident on the scape and tegula; forewings evenly smoked ………………………………………………………………… 7
– Without metallic scales on the scape and tegula or not very evident; forewings with a darker spot at the apex ………………………………………………………………… 8
7(6). Head pubescence mainly black (Fig. 9C); scutellar tubercles moderately projecting upwards (Fig. 9D); truncated pygidial plate with dark setae on the surface (Fig. 4A) (Mexico) ………………………………………………………………… Mesoplia insignis (Smith, 1879)
– Head pubescence mainly whitish (Fig. 13C); scutellar tubercles strongly projecting upwards (Fig. 13A); rounded pygidial plate with scales on the surface, in some specimens they do not reach the apex due to the abrasion of these (Fig. 4B) (Costa Rica)………………………………………………………………… Mesoplia tica sp. nov.
Figure 33. Mesoplia (E.) ornata, male: A, S7. B, S8. C and D, genital capsule, dorsal and lateral view, respectively.
8(6). Poorly developed scutellum protuberances with a shallow depression between them and low tubercles (Fig. 16A, D); the carina of the scutellum runs continuously from one side to the other (Mexico and Central America) ………………………………………………………………… Mesoplia sapphirina Melo & Rocha-Filho, 2011
– Scutellum protuberances developed with a deep depression between them and conspicuously pointed tubercles; the carina of scutellum most developed along tubercles, gradually fading to sides (Panamá and South America) ………………………………………………………………… Mesoplia regalis (Smith, 1854)
9(1). With pale yellow pubescence on the mesosoma (Fig. 34A-C); T2 to T5 without white pubescent spots; long middle tibial spur branches (South of Mexico, Chiapas, to South America) ………………………………………………………………… Mesoplia ornata (Spinola, 1841)
– Without pale yellow pubescence on the mesosoma; T2 to T5 with a couple of spots of appressed white pubescence in the marginal zone (Fig. 31A); short middle tibial spur branches (Fig. 18D) (Mexico, Guatemala and Costa Rica) ………………………………………………………………… Mesoplia carmelitae sp. nov.
Hosts. Like the rest of the members of the Ericrocidini tribe, species of the genus Mesoplia are cleptoparasites of several species of the Centridini tribe (Table 2). It should be noted that M. rufipes is the only species of the tribe that has been recorded cleptoparasitizing species of Epicharis. The cleptoparasitism relationship between M. insignis and Centris agilis was recorded for the first time in Jalisco, Mexico. The first author of this work had the opportunity to collect some specimens of this species in an aggregation of C. agilis nests in a suburban site.
Floral asossitations. The floral records reported in this section are based on information extracted directly from the collection tags of the specimens reviewed in this study (Table 3).
Figure 35. Species of Mesoplia in nature. A-B, Mesoplia (M.) insignis on Ramirezella sp. in Jalisco, México. A, male; B, female (photos by the first author). C, Mesoplia (M.) tica sp. nov. female on Stachytarpheta sp. in Alajuela, Costa Rica (photo by Daniel Garrigues). D, Mesoplia (M.) veracruzana sp. nov. female on Ipomoea sp. in Veracruz, Mexico (photo by Gerardo Quintos-Andrade). E, Mesoplia (M.) dugesi male on Tecoma stans in Querétaro, Mexico (photo by Belem Hernández). F, Mesoplia (M.) rufipes male on Duranta sp. in San José, Costa Rica (photo by “Homúnculo Daimon”).
Discussion
The complexity of the genus Mesoplia has previously been recognized for regions like the Caribbean. There is inaccurate information on its distribution due to taxonomic problems, which has caused erroneous identifications (Genaro & Breto, 2022; Genaro & Franz, 2008). For Mexico, difficulty in accessing the primary types deposited in institutions outside the country complicates the taxonomic understanding of the group. However, there are quality images available that have allowed this review, obtaining a reliable list and synonymizing the names that were required v. gr. M. insignis (Smith, 1879) and M. imperatrix (Friese, 1912), a species easily recognizable in the end.
Most of the of the species in this study present morphological characters that make them easily differentiated. However, 2 pairs of species, M. regalis and M. sapphirina; as well as M. dugesi and M. oaxacana, are quite similar to each other, particularly the females, which complicates their differentiation. Here we provide characters that allow the unequivocal identification of the mentioned species, such as scutellar tubercles and pygidial plate. Additionally, variation in characters of the male of M. rufipes, including shape of S8 and shape of the basal projection of the posterior femur, hint to the possibility that M. rufipes is a species complex, but more evidence is needed including molecular studies.
Table 3
Floral records of the species of Mesoplia Lepeletier, 1841.
Species
Plant
Family
Mesoplia (M.) dugesi (Cockerell, 1917)
Tecoma stans
Bignoniaceae
Canavalia villosa
Fabaceae
Crotalaria sp.
Libidibia sclerocarpa
Macroptilium atropurpureum
Mesoplia (M.) insignis (Smith, 1879)
Eryngium sp.
Apiaceae
Macroptilium atropurpureum
Fabaceae
Ramirezella sp.
Vitex pyramidata
Lamiaceae
Cuphea lanceolata
Lythraceae
Hibiscus tiliaceus
Malvaceae
Mesoplia (M.) regalis (Smith, 1854)
Antigonon leptopus
Polygonaceae
Mesoplia (M.) rufipes (Perty, 1833)
Ipomoea violacea
Convolvulaceae
Tabebuia rosea
Bignoniaceae
Tecoma stans
Caesalpinia sp.
Fabaceae
Haematoxylon brasiletto
Hyptis albida
Lamiaceae
Cuphea sp.
Lythraceae
Genipa americana
Rubiaceae
The association of cleptoparasitism between M. insignis and Centris agilis supports the observations of Lim et al. (2022), they observed a considerable increase in the body size of Ericocidini that could be influenced by a change of host; and supports Harrison’s rule, since both species are of similar sizes (Harrison, 1915). Therefore, in some cases where the host is unknown, it could at least be inferred. For example, M. carmelitae sp. nov. is a relatively small bee within the genus, so it is expected that its host will be a bee from the Centridini tribe of similar size (approx. 11.395 mm) and distributed in the same geographical area. There is an opportunity to study cleptoparasite-host relationships between bees of the tribe Centridini and Ericrocidini, in sites where it is known that nest aggregations periodically occur, in addition to increasing information about the immature stages of both groups.
With this research, the region studied reaches South America with 10 species of Mesoplia, despite this it is expected that there are still several species to be described for that region since Ericrocidini is richer in that region (Snelling & Brooks, 1985). Furthermore, the distribution of some of the species recognized in this work could be broader, since there is a significant information gap across some Central American countries. The area included in this study has little diversity of species of the subgenus Eumelissa, with only 2 of the 10 known species. Furthermore, the data obtained extends the distribution of Eumelissa at least to Central Mexico on the Pacific Slope (particularly in Jalisco), far north of the previous northern limit in Costa Rica (Snelling & Brooks, 1985).
Acknowledgements
This article serves as fulfillment of the first author for obtaining the degree of M.Sc. degree with emphasis on Systematics of the Posgrado en Ciencias Biológicas at the UNAM. This study was financially supported by the student grants: Beca Nacional para Estudios de Posgrado 2022 – 1 Conahcyt No. 814906 and Programa de Apoyo a los Estudios de Posgrado (PAEP) 2023. We want to thank José Luis Navarrete(CZUG), Hugo Fierros (CZUG and HFL), Jorge E. Valenzuela, Viridiana Vega, Gerardo Quintos-Andrade (IEXA), Rémy Vandame, Jorge A. Mérida Rivas, Philippe Sagot (ECOAB), Virginia Meléndez Ramírez, María José López Gómez (CER-UADY), Zachary Falin, Michael Engel, Rachel Osborn (SEMC), Maricelle Méndez, Marcela Sánchez (MNCR), Mauricio Fernández, Paul Hanson (MZUCR), Mario Gallardo, Eduardo Herrera (CINAT) for the loan of specimens and/or for the information provided about the specimens of Mesoplia deposited in their collections. We thank Stefanie Krause (ZMB) and Corey Smith (AMNH), who sent us photographs of some type specimens. We thank again Jorge Mérida (ECOAB), Marcela Sánchez (MNCR), José Luis Navarrete (CZUG), Adam Karremans (Director of Jardín Botánico Lankaster, UCR) and Nicolás Rengifo Alfonso (MZUCR) for letting and helping us to use the imaging system to take the photographs. We want to thank Daniel Garrigues, Gerardo Quintos-Andrade, Belem Hernández and “Homúnculo Daimon” for the photographs of Mesoplia in nature. Finally, we thank the reviewers that helped to improve this article.
References
Aguiar, A. M. L., & Ganglianone, M. C. (2003). Nesting biology of Centris (Centris) aenea Lepeletier (Hymenoptera, Apidae, Centridini. Revista Brasileira de Zoologia, 20, 601–606. https://doi.org/10.1590/S0101-81752003000400006
Coville, R. E., Frenkie, G. W., & Vinson, S. B. (1983). Nests of Centris segregata (Hymenoptera: Anthophoridae) with a Review of the Nesting Habits of the Genus. Journal of the Kansas Entomological Society, 56, 109–122.
Gaglianone, M. C. (2005). Nesting biology, seasonality, and flower hosts of Epicharis nigrita (Friese, 1900) (Hymenoptera: Apidae: Centridini), with a comparative analysis for the genus. Studies on Neotropical Fauna and Environment, 40, 191–200. https://doi.org/10.1080/01650520500250145
Genaro, J. A., & Franz, N. M. (2008). The bees of Greater Puerto Rico (Hymenoptera: Apidae: Anthophila). Insecta Mundi, 40, 1–24.
Genaro, J. A., & Breto, D. (2022). Descripción de dos especies nuevas de Mesoplia Lepeletier (Hymenoptera: Apoidea: Apidae) para Cuba y Las Bahamas, con notas sobre taxonomía y distribución del género en las Antillas. Insecta Mundi, 929, 1–17.
Harris, R. A. (1979). A glossary of surface sculpturing. Occasional Papers in Entomology, 28, 1–32.
Harrison, L. (1915). Mallophaga from Apteryx, and their signifcance; with a note on the genus Rallicola. Parasitology, 8, 88–100.
Hiller, B., & Wittmann, D. (1994). Seasonality, nesting biology and mating behavior of the oil-collecting bee Epicharis dejeanii (Anthophoridae, Centridini). Biociências, 2, 107–124.
Lim, K., Lee, S., Orr, M., & Lee, S. (2022). Harrison´s rule corroborated for the body size of cleptoparasitic cuckoo bees (Hymenoptera: Apidae: Nomadinae) and their hosts. Scientific Reports, 12, 10984. https://doi.org/10.1038/s41598-022-14938-9
Lobo, J. A., Fernández-Otárola, M., Chavarría, M. M., & Agraz-Hernández, C. M. (2023). Nesting biology of Centris aethyctera (Centridini, Apidae) in an estuarine environment. Apidologie, 54, 58. https://doi.org/10.1007/s13592-023-01044-6
Martins, A. C., Luz, D. R., & Melo, G. A. R. (2018). Palaeocene origin of the Neotropical lineage of cleptoparasitic bees Ericrocidini-Rhathymini (Hymenoptera, Apidae). Systematic Entomology, 43, 510–521. https://doi.org/10.1111/syen.12286
Martins, C. F., Neto V. I. S., & Cruz, R. D. M. (2019). Nesting biology and mating behavior of the solitary bee Epicharis nigrita (Apoidea: Centridini). Journal of Apicultural Research, 58, 1–11. https://doi.org/10.1080/00218839.2019.1584963
Martins, C. F., Peixoto, M. P., & Aguiar, C. M. L. (2014). Plastic nesting behavior of Centris (Centris) flavifrons (Hymenoptera: Apidae: Centridini) in an urban area. Apidologie, 45, 156–171. https://doi.org/10.1007/s13592-013-0235-4
Michener, C. D. (2007). The bees of the World(2nd Edition). Baltimore, Maryland: The Johns Hopkins University Press.
Moure, J. S. (1960a). Notas sobre os tipos de abelhas do Brasil descritas por Perty em 1833 (Hymenoptera – Apoidea). Boletim da Universidade do Paraná, Zoologia, 1, 1–23.
Moure, J. S. (1960b). Notes on the types of the Neotropical bees described by Fabricius (Hymenoptera: Apoidea). Studia Entomologica, 3, 97–160.
Moure, J. S., & Melo, G. A. R. (2023). Mesoplia Lepeletier, 1841. In J. S. Moure, D. Urban, & G. A. R. Melo (Orgs.), Catalogue of bees (Hymenoptera, Apoidea) in the Neotropical Region. Retrieved on 30 May 2024 from: http://moure.cria.org.br/catalogue?id=113174
QGIS.org (2022). QGIS Geographic Information System. QGIS Association. http://www.qgis.org
Rocha-Filho, L. C., Morato, É. F., & Melo, G. A. R. (2009). New host records of Aglaomelissa duckei and a compilation of host associations of ericrocidini bees (hymenoptera: Apidae). Zoologia, 26, 299–304. http://dx.doi.org/10.1590/S198446702009000200012
Rocha-Filho, L. C., Silva, C. I., Gaglianone, M. C., & Augusto, S. C. (2008). Nesting behavior and natural enemies of Epicharis (Epicharis) bicolor Smith (Hymenoptera: Apidae). Tropical Zoology, 21, 227–242.
Rozen, J. G. (1969). The larvae of the Anthophoridae (Hymenoptera, Apoidea). Part 3. The Melectini, Ericrocidini, and Rhathymini. American Museum Novitates, 2382, 1–24.
Rozen, J. G. (2016). Nesting biology of the solitary bee Epicharis albofasciata (Apoidea: Apidae: Centridini). American Museum Novitates, 3869, 1–8. https://doi.org/10.1206/3869.1
Rozen, J. G., Vinson, S. B., Coville, R. E., & Frankie, G. W. (2011). Biology of the cleptoparasitic bee Mesoplia sapphirina (Ericrocidini) and its host Centris flavofasciata (Centridini) (Apidae: Apinae). American Museum Novitates, 3723, 1–36. https://doi.org/10.1206/3723.2
Silveira, F. A., Melo, G. A. R., & Almeida, E. A. B. (2002). Abelhas brasileiras: sistemática e identificação. Belo Horizonte, Minas Gerais: Ministério do Meio Ambiente & Fundação Araucária.
Snelling, R. R. (1984). Studies on the taxonomy and distribution of American Centridine bees (Hymenoptera: Anthophoridae). Contributions in Science, Natural History Museum of Los Angeles County, 347, 1–69.
Snelling, R. R., & Brooks, R. W. (1985). A review of the genera of cleptoparasitic bees of the Tribe Ericrocidini (Hymenoptera: Anthophoridae). Contributions in Science, Natural, History Museum of Los Angeles County, 369, 1–34.
Vinson, S. B., Frankie, G. W., & Coville, R. E. (1987). Nesting habits of Centris flavofasciata Friese (Hymenoptera: Apoidea: Anthophoridae) in Costa Rica. Journal of the Kansas Entomological Society, 60, 249–263.
Vivallo, F. (2010). Sistemática e filogenia da tribo de abelhas Centridini e suas relações filogenéticas com as tribos cleptoparasitas Ericrocidini e Rhathymini (Hymenoptera: Apidae)(Ph.D. Thesis). Universidade Federal do Paraná. Curitiba, Brazil.
Vivallo, F. (2014). Taxonomic revision of the cleptoparasitic bee genus Epiclopus Spinola, 1851 (Hymenoptera: Apidae: Ericrocidini). Zootaxa, 3857, 41–70. https://doi.org/10.11646/zootaxa.3857.1.2
Vivallo, F. (2021). Nesting behavior of the oil-collecting bee Epicharis (Triepicharis) analis Lepeletier (Hymenoptera: Apidae) in an urban area of Rio de Janeiro, RJ, Brazil. Journal of Apicultural Research, 60, 135–142. https://doi.org/10.1080/00218839.2020.1820150
Werneck, H. A., & Campos, L. A. O. (2020). A study of the biology of Epicharis (Epicharoides) picta using emergence-traps. Journal of Hymenoptera Research, 80, 147–167. https://doi.org/10.3897/jhr.80.56898
Victor Cuesta-Porta a, *, George Melika b, Juli Pujade-Villar a
a Universitat de Barcelona, Facultat de Biologia, Departament de Biologia Evolutiva, Ecologia i Ciències Ambientals, Avda. Diagonal 645, 08028-Barcelona, Spain
b National Food Chain Safety Office, Plant Health Diagnostic National Reference Laboratory, Budaörsi Str. 141-145, Budapest 1118, Hungary
The North American oak gall wasp genus Femuros Kinsey is revised after its re-establishment in 2015. Morphological evidence suggests that only 3 species described by Kinsey belong to this genus: F. repandae Kinsey, F. ocri Kinsey, and F. ruidum Kinsey. The rest of the species are transferred to the genus Andricus Hartig: A. geniale (Kinsey) comb. rev., A. integrum (Kinsey) comb. rev., A. lusum (Kinsey) comb. rev., and A. perfectum (Kinsey) comb. rev. A new species with slightly swollen femora but without an apical lobe and without internal tibial carina is described: A.calvoi sp. nov. We provide descriptions, redescriptions, diagnoses, keys to species, and information on biology, phenology, and distribution.
Keywords: Hymenoptera; Gall wasp; Nearctic; Taxonomy
Se revisa el género norteamericano Femuros Kinsey que fue restituido en 2015. Solo 3 especies descritas por Kinsey pertenecen a este género: F. repandae Kinsey, F. ocri Kinsey y F. ruidum Kinsey. El resto de las especies están incluidas en el género Andricus Hartig: A. geniale (Kinsey) comb. rev., A. integrum (Kinsey) comb. rev., A. lusum (Kinsey) comb. rev. y A. perfectum (Kinsey) comb. rev. Se describe una especie nueva con fémures ligeramente hinchados, pero sin lóbulo apical y sin carina tibial interna: A. calvoi sp. nov. Se proporcionan descripciones, redescripciones, diagnosis, una clave para las especies, información sobre biología, fenología y distribución.
Kinsey (1937a, b) described several oak gall wasp genera from the Nearctic and Neotropics related to Andricus, some of which were synonymized under Andricus by Weld (1952): Femuros Kinsey, 1937, Feron Kinsey, 1937, Druon Kinsey, 1937, and Conobius Kinsey, 1938. Later, Melika and Abrahamson (2002) increased the number of synonymies: Dros Kinsey, 1937 and Erythres Kinsey, 1937. Recently morphological and phylogenetic studies have revalidated some of these genera: Erythres Kinsey, 1937 (Pujade-Villar & Melika, 2014), Femuros Kinsey, 1937(Pujade-Villar & Ferrer-Suay, 2015), Antron Kinsey, 1930 (Melika et al.,2021), Dros Kinsey, 1937 (Pujade-Villar et al., 2017), Druon Kinsey, 1937 (Cuesta-Porta et al., 2022), and Feron (Cuesta-Porta et al., 2023).
Femuros was described by Kinsey (1937a) to include 2 species (F. repandae and F. ruidum) characterized as having …“the hind femur peculiarly broadened on ventral margin near distal end, […], although it is suddenly constricted where it joins the tibia”. Later, Kinsey (1937b) described the “geniale complex” to include several species with different gall morphologies and punctured metasoma (F. lusum, F. perfectum, F. geniale, and F.integrum), and a new species belonging to “repandae complex” (F. ocri). Recently, Pujade-Villar and Ferrer-Suay (2015) mentioned another character present in the genus Femuros, an internal carina on the hind tibia, thus re-establishing Femuros as valid.
In Kinsey’s descriptions (both generic and specific), many diagnostic characters are not mentioned. The study of the type material and of the samples collected in Mexico show 2 distinct morphological models and some errors in the description of the species. The aim of this study is to redescribe the genus Femuros to adjust the diagnostic characters to the new proposed generic limits of Femuros and redescribe the species that Kinsey (1937a, b) included. We transfer and redescribe the species belonging to the “genialecomplex” to the genus Andricus, and we describe a new species of Andricus with swollen femurs and internal tibial carina: A. calvoi sp. nov. Also, the species Femuros bracteatus comb. nov. is transferred from Andricus.
Materials and methods
Fresh material was obtained from galls collected in Mexico from multiple collecting events during 2009-2019. Site locations and other details are provided in the “Material examined” section for each species. Galls were reared at room temperature in plastic containers with mesh lids to ensure ventilation. Emerging adult wasps were preserved in 70% ethanol. Type materials of previously described species was also examined, both to confirm the identity of our recently collected specimens and to help define species limits.
Type specimens are deposited at the American Museum of Natural History (AMNH) in New York City, Hungarian Natural History Museum (HNHM) in Budapest, and JP-V collection of Barcelona University (UB).
Morphological descriptions
The terminology used to describe gall wasp morphology follows other recent cynipid studies (Liljeblad et al., 2008; Melika, 2006; Melika et al., 2010). Abbreviations for forewing venation follow Ronquist and Nordlander (1989), and cuticular surface terminology follows Harris (1979). Measurements and abbreviations used here include: F1-F12 for the 1st and subsequent flagellomeres; POL (post-ocellar distance) for the distance between the inner margins of the lateral ocelli; OOL (ocellar-ocular distance) for the distance from the outer edge of a lateral ocellus to the inner margin of the compound eye; and LOL (lateral-frontal ocelli distance) for the distance between lateral and frontal ocelli. The width of the forewing radial cell is measured from the margin of the wing to the Rs vein.
The information contained in the material examined sections is a verbatim transcription of the pinned labels attached to the adult wasps including symbols and abbreviations. Alfred Kinsey included the symbol “ꚛ” to indicate the specimens naturally emerged from galls. Also, Kinsey designated most holotypes using a “Paratype” red label and crossing out the “Para-” to handwrite “Holo-” on top. We use the term “HoloParatype” to better reflect the verbatim transcription of Kinsey’s holotype labels, and to follow the terms used in previous studies (Cuesta-Porta et al., 2022, 2023, 2024).
Bright-field images of adults were produced with a digital Leica DC500 camera attached to a Leica DM2700M compound microscope using the LAS Store&Recall software, followed by processing in Adobe Photoshop 6.0. SEM images of the new species were taken with the Stereoscan Leica-360 at low voltage (700V) and without coating, in order to preserve the specimens. For all species examined in this paper, descriptions are provided according to current morphological requirements as the original descriptions are often superficial.
Nomenclature of host plants
Denk et al. (2017) reorganized the classification of Quercus, dividing the genus into the subgenera Cerris and Quercus. Subgenus Cerris includes 3 sections: Cyclobalanopsis (previously considered a subgenus), and the sections Ilex and Cerris from Menitsky (1984). Subgenus Quercus includes 5 sections: Lobatae and Protobalanus as in Nixon (1993), with the old section Quercus divided into 3 new sections: Quercus ‘sensu stricto’, Virentes, and Ponticae. The gall wasp species listed herein are associated with section Quercus subsection Leucomexicanae: Q. arizonica Sarg. (= Q. sacame Trel.), Q. chihuahuensis Trel., Q. deserticola Trel. (= Q.texcocana Trell.), Q. glaucoides Mart. & Gal., Q. grisea Liebm., Q. laeta Liebm., Q. magnoliifolia Née (= Q. haemathophebia Trel., = Q. macrophylla Née), Q.obtusata Humb. & Bonpl., Q. potosina Trel., Q. repanda Bonpl., Q. rugosa Née (= conglomerata Trel., = reticulata Bonpl., = rhodophlebia Trel.), Q. repanda Bonpl., and Q. undata Trel. There is only one record of an association to an oak in section Lobatae, Q. crassifolia Bonpl.
Results
Below we present the formal redescriptions of 4 valid species of Femuros (Cynipini), all from the Nearctic or Neotropics: F. bracteatus (Weld) comb. nov., F. ocri Kinsey, F. repandae Kinsey, and F. ruidum Kinsey. Also, 4 species currently in Femuros are placed in the genus Andricus Hartig 1840: A. geniale (Kinsey) comb. rev., A. integrum (Kinsey) comb. rev., A. lusum (Kinsey) comb. rev., and A. perfectum (Kinsey) comb. rev., along with a new Andricus species with swollen hind femurs and internal tibial carina described here: A.calvoi sp. nov.
The following identification key includes 8 Cynipini species characterized by a conspicuous transscutal articulation, toothed tarsal claws, fully-developed wings, without malar sulcus, antenna with 11-12 flagellomeres, the hind femur with a distinct lobe in posterior margin, hind tibia with a strong longitudinal carina, the second metasomal tergite with sparse setae on anterolateral area, the third and subsequent metasomal tergites micropunctured, and the ventral spine of hypopygium needle-like with its sides gradually converging into a tip.
Key to asexual Andricus and Femuros females with broadened femur and tibial carina
1. Body chestnut to black (Fig. 24a-d); lower head in frontal view sculptured, with radiating striae, carina reaching margin of the eye (Fig. 1a); occipital carina absent; all metasomal segments micropunctured posteriorly (Figs. 2c, 9b, 11b, 14b) …………………………………………………………………………………… Andricus (2)
– Body red rufous (Fig. 25a-d); lower head in frontal view almost smooth, without striae radiating from clypeus or with very inconspicuous carinae only next to clypeus (Figs. 15a, 16a, 18a, 21a); occipital carina dorsally present (Figs. 18b, 21c); second metasomal tergum smooth, without micropunctures, subsequent terga micropunctured (Figs. 15d, 16e, 20a, 23b) …………………………………………………………………………………… Femuros (6)
2. LOL subequal or shorter than diameter of lateral ocellus (Figs. 1b, 10b, 12c); hind coxae and femora swollen, sometimes hind femora with strong distal lobe (Figs. 2e-f, 11b, 14b); propodeal carinae bent outwards or converging posteriorly (Figs. 1e, 10f, 14c) …………………………………………………………………………………… 3
– LOL more than 1.2× diameter of lateral ocelli (Figs. 7c, 12c); hind coxae and femora not swollen (Fig. 9a); propodeal carinae subparallel (Figs. 6b, 8d) …………………………………………………………………………………… 5
3. Lower face rugose-reticulate, dull, with vertical carinae radiating from clypeus towards toruli (Fig. 12a, c); pronotum completely striate, with parallel curved striae (Fig. 13c); notaulus weakly impressed, incomplete, reaching slightly more than 1/2 of mesonotum length (Figs. 12f, 13a) …………………………………………………………………………………… A. perfectum, comb. rev.
– Lower face faintly reticulate, shining, carinae radiating from clypeus not extending towards toruli (Figs. 1a-b, 10a, 10b); pronotum punctured with striae only on lateral margin (Figs. 1c, 10c); notaulus deep, complete or not (Figs. 1d, 10c) …………………………………………………………………………………… 4
4. Notauli incomplete not converging posteriorly, space between notauli subequal to space between notauli and parapsidal line (Fig. 10d-e), propodeal carinae subparallel slightly bent outwards (Fig. 10a) …………………………………………………………………………………… A. lusum, comb. rev.
– Notauli complete strongly converging posteriorly, space between notauli subequal to width of notauli on posterior margin (Fig. 1d); propodeal carinae strongly converging towards posterior end (Fig. 1e) …………………………………………………………………………………… A. calvoi, sp. nov.
5. Lower face reticulate, sometimes with some sparse striae (Fig. 4a); mesopleuron smooth with sparse striae across mid-height of mesopleuron (Fig. 5a) …………………………………………………………………………………… A. geniale, comb. rev.
– Lower face rugose-reticulate, dull, with vertical carinae radiating from clypeus towards toruli (Fig. 7a); mesopleuron completely striated, except for smooth speculum (Fig. 8a) …………………………………………………………………………………… A. integrum, comb. rev.
6. POL around 1.5× OOL, OOL 1.5× diameter of lateral ocellus (Fig. 18c); transfacial distance 1.3× as long as height of eye, and height of eye 2.0× as long as malar space (Figs. 15a, 18a) …………………………………………………………………………………… 7
– POL 2.0× OOL, OOL subequal to diameter of lateral ocellus (Figs. 16b, 21c); transfacial distance subequal to height of eye; and height of eye more than 2.4× as long as malar space (Figs. 16a, 21a) …………………………………………………………………………………… 8
7. Mesonotum with infuscate stripes along anterior parallel lines and parapsidal lines (Fig. 19b); mesoscutellar foveae divided by a thin carina (Fig. 19d) ……………………………………………………………………………………F. repandae
– Mesoscutum uniformly colored (Fig. 15b); mesoscutellar foveae divided by a broad rugose elevated area …………………………………………………………………………………… F. bracteatus
8. Mesopleuron densely pubescent with visible punctures and deep piliferous points, speculum mostly pubescent except for a small central glabrous smooth area (Fig. 22a); propodeal carinae bent outwards (Fig. 22c) …………………………………………………………………………………… F. ruidum
– Mesopleuron sparsely pubescent, mostly smooth with scattered delicate shallow piliferous points; speculum smooth and glabrous at least on median 1/2 length of speculum (Fig. 16c); propodeal carinae parallel (Fig. 17c) …………………………………………………………………………………… F. ocri
Diagnosis. Andricus calvoi sp. nov. differs from all Andricus species, except for the species here transferred to Andricus, by the hind femur swollen and by the presence of a tibial carina. This species differs from Andricus geniale comb. rev., A. integrum comb. rev., A. perfectum comb. rev., and A. lusum, comb. rev. by the parallel internal margins of the eyes and the body without dense pubescence, the mesopleuron only basally pubescent; the lower face is reticulate; differs from A. geniale, comb. rev. by the weakly reticulate mesopleuron, except for the smooth speculum; and the propodeal carinae strongly converging posteriorly.
Description. Asexual female (Figs. 1a-e, 2a-g, 3a). Head, mesosoma and metasoma black (with some brown areas in a specimen dissected from a gall); antenna light brown, last flagellomere darker; tegula yellowish; legs light brown, coxa, trochanter, femur brown to black, last tarsus darker than preceding (Fig 3a). Wing veins light brown.
Head (Fig. 1a-c) transversally ovate, broadest part below toruli, 1.4× as broad as high and narrower than mesosoma in frontal view, 1.5× as broad as long in dorsal view, uniformly coriaceous, lower face with short dense white setae; frons glabrous, without setae, 1.3× as broad as high in anterior view. Gena coriaceous to microreticulate, slightly broadened behind eye, 0.89× as broad as cross diameter of eye, measuring along transfacial line. Malar space coriaceous to microreticulate, with very few striae radiating from clypeus, malar sulcus absent; eye 1.7× as high as length of malar space. Inner margins of eyes parallel. POL 1.7× as long as OOL, OOL 1.7× as long as diameter of lateral ocellus and slightly longer than LOL, all ocelli rounded, of same size. Transfacial distance nearly equal to height of eye; torulus located above mid height of head, frons shorter than height of lower face, diameter of antennal torulus 2.8× as long as distance between them, distance between torulus and eye as long as diameter of torulus or very slightly shorter; lower face and slightly elevated median area delicately reticulate, pubescent. Clypeus impressed, coriaceous, rounded ventrally, medially not incised, anterior tentorial pits distinct; epistomal sulcus and clypeo-pleurostomal line distinctly impressed. Frons uniformly coriaceous to microreticulate, without striae, with few setae; interocellar area coriaceous. Vertex and occiput coriaceous, glabrous. Antenna (Fig. 2a) shorter than length of head + mesosoma, with 11 flagellomeres; pedicel subglobose, slightly longer than broad; flagellomeres subsequently broadening until apex; F1 slightly broader distally, subequal to F2 and 2.3× as long as pedicel; subsequent flagellomeres progressively shortened; F3 = F4, F5 = F6, F7 to F10 equal in length, F11 longer than F10, sometimes F11 with a very inconspicuous suture and thus antenna with 12 flagellomeres. Placodeal sensilla on F5-F11.
Mesosoma (Fig. 1c-e) 1.2× as long as high, concave in lateral view, with dense white setae. Sides of pronotum alutaceous, with denser white setae and weak, parallel carinae in upper lateroposterior part, anterolateral rim of pronotum inconspicuous. Mesoscutum as broad as long in dorsal view; coriaceous, without rugae, pubescent, with piliferous points denser in the posterior half. Notaulus complete, deep, straight, converging posteriorly, in most posterior part distance between notauli shorter than distance between notaulus and side of mesoscutum; median mesoscutal line absent; parapsidal and anterior parallel lines differentiated by delicate sculpture. Circumscutellar carina complete. Mesoscutellum as long as broad, uniformly rugose; overhanging metanotum, with sparse long setae. Mesoscutellar foveae differentiated, triangular, deep, with shining bottom, median carina short. Mesopleuron completely sculptured, coriaceous to weak reticulate with delicate carinae and sparse setae anteriorly, speculum smooth and shining; mesopleural triangle smooth, glabrous, with dense, long white setae, hiding the surface sculpture; dorsal and lateral axillar areas with delicate parallel longitudinal carinae, glabrous; axillula alutaceous, pubescent; subaxillular bar smooth, glabrous, triangular, short, posteriorly as high as height of metanotal trough; metapleural sulcus reaching mesopleuron in upper 2/3 of its height; upper part of sulcus distinct; lower part of sulcus delimiting broad area with dense long white setae. Metascutellum subrectangular, rugose, strongly incised ventrally; metanotal trough alutaceous, with dense setae; ventral bar of metanotal trough coriaceous-rugose; central propodeal area nearly smooth and glabrous; lateral propodeal carinae strongly converging toward posterior end; lateral parts of propodeum uniformly alutaceous, densely pubescent. Nucha almost smooth and shining dorsally, with parallel sulci laterally. Legs (Fig. 2e-g) with broad coxa, femur strongly broadened, without apical lobe, with some short teeth on the internal margin produced by marginal sculpture; hind tibia with ventral carina reaching almost to the base of tibia; base of tarsal claws with strong tooth (Fig. 2b).
Figure 1a-e. Andricus calvoi sp. nov., asexual female. a) Head in frontal view; b) head in dorsal view; c) mesosoma in lateral view; d) mesosoma in dorsal view; e) propodeum.
Forewing (Fig. 3c) hyaline, 1.1× as long as body, pubescent, with cilia on margins; radial cell opened, around 3.0× as long as broad; veins light brown; areolet absent or indistinct.
Metasoma (Fig 2c) shorter than head+mesosoma, longer than high. metasomal tergum 2 with lateral patch of white setae, punctate in posterior 1/2-1/3, all subsequent terga uniformly and entirely punctate. Prominent part of ventral spine of hypopygium needle-like, 4.5-5.0× as long as broad, with sparse setae laterally, without apical tuft of setae (Fig. 2d). Body length: 3.0-3.4 mm (n = 3).
Figure 2a-g. Andricus calvoi sp. nov., asexual female. a) Antenna; b) tarsal claw; c) metasoma in lateral view; d) ventral spine of the hypopygium; e-g) hind leg, longitudinal carina of hind tibia marked with a white arrow.
Galls are developing in thin branches (Fig. 3b). It is a unilocular bud gall, woody, more or less cylindrical or globular, 8-18 mm in length and 7-15 mm in diameter, composed of 2 subunits; the upper and the lower third are constricted; the upper end is open with a depression, the edge is continuous. The gall is brown; the surface is covered by fine short brownish pubescence, which remains on the mature gall. The inner larval chamber is located in the constricted part of the gall. The single larval chamber is globular, with a hard woody wall, which is connected to the tissue of the gall. The emergence hole is located inside the upper depression.
Taxonomic summary
Type material. Holotype, asexual female deposited in JP-V collection (UB), labeled as “MEX, Parque Nacional Bosque del Pedregal, Ciudad de México, Mexico, M. Serrano col. 206A, 2,437 m asl, [19°17.283’ N, 99°12.256’ W]” (white label), “Ex. Q. obtusata, (24.vi.2012) 26.vi.2012” (white label); “Holotype Korlevicandricus tlalpanus desig. JP-V 2013” (red label), “Andricus calvoi Pujade-Villar, Cuesta-Porta & Melika, JP-V det., asexual gen.” (white label). Paratypes (3 females): 1 female with the same data as the holotype; 2 females collected in the same place and host than the holotype, but with different collection dates (24.vi.2012) 27.vi.2012: 1 female; (3.x.2010) extr. vi.2011:1 female.
Additional material. Two females collected in the same place and from the same host plant as the holotype (20.vi.2011). Both females were dissected from the galls on 16.vii.2013 (damaged material). Eight females deposited in the JP-V col. (UB): 1 female “Parque Nacional bosque del Pedregal, Tlalpan, Ciudad de México, Mexico, (MEX096), Ex Quercus sp., (19.iv.12) 01.v.2012, M. Serrano leg.”; 1 female “Santa Fe, Denominación de Coajomulco, Ciudad de México, Mexico, (MEX362), Ex Quercus sp., (23.iv.2017): 1 female , D. Cibrián-Tovar leg.”; 5 females “ Santa Fe, Coajomulco, Ciudad de México, Mexico, (MEX473), Ex Q. laeta, (22.iii.2019) 14.v.2019: 5 females, U. Barrera-Ruíz & D. Cibrián-Tovar leg.”; 1 female “Sanctórum de Lázaro Cárdenas, Tlaxcala, Mexico, (MEX644), Ex Quercus sp., (22.vi.2022) 30.vi.2022: 1 female, JP-V, VC-P, A. Equihua & E. Estrada-Venegas leg.”; 1 female “Peñón Blanco, Sierra Fría, San José de Gracia, Aguascalientes, Mexico (MEX772), Ex Quercus sp., (12.ii.2022) extracted: 1 female, R. Clark leg.”; 1 female “Puente Roto, Santa Catarina Ixtepeji, Oaxaca, Mexico, (MEX834), Ex Q. glabrescens, (25.i.2023) extracted: 1 female, R. Clark leg.”; 1 female “Carretera Maravatio-Morelia (Km. 177-178), Michoacán, Mexico, (MEX841), Ex Q. obtusata (SR-R det.), (18.vi.2023) 16-31.vii.2023: 1 female, A. Equihua & J. Pujade-Villar leg.”; 1 female “Peñón Blanco, Sierra Fría, San José de Gracia, Aguascalientes, Mexico, (MEX973), Ex Q. chihuahuensis, (20.ii.2023) extracted: 1 female, R. Clark leg.”.
Figure 3a-c. Andricus calvoi sp. nov. a) Asexual female, habitus; b) galls, deposited in the JP-V col. (UB); c) asexual female, fore wing.
Etymology. Species is named after Mr. Oriol Calvo Verderes, accused in 2019, one month after the protests in Barcelona against the sentence of the Catalan political prisoners.
Biology. The asexual generation is only known to induce galls on Q. obtusata Humb. & Bonpl., and Q. laeta (section Quercus, subsection Leucomexicanae, white oaks). The galls were collected between March and June, adults emerged between May and June.
Distribution. Mexico: Ciudad de México, and Estado de México.
Diagnosis. Andricus geniale differs from all the Andricus species, except for the species here transferred to Andricus, which have tibial carina and the last femur swollen. It differs from A. lusum comb. rev. by having the body scarcely pubescent with the glabrous mesopleuron on all its surface, the internal margin of eyes parallel, hind femur without distal lobe; differs from A. calvoi sp. nov., A. lusum, comb. rev., and A. perfectum comb. rev. for the LOL more than 1.2× as long as the diameter of lateral ocellus, the hind coxae and femora not swollen, and the propodeal carinae subparallel. Differs from A. integrum, comb. rev. by having the reticulated lower face, the mesopleuron is smooth with sparse striae across mid-height of mesopleuron.
Redescription. Asexual female (Figs. 4a-e, 5a-d, 6a-c). Head, mesosoma dark brown to black, antenna dark brown; legs chestnut brown, except dark brown to black coxae; metasoma chestnut brown.
Figure 4a-e. Andricus geniale comb. rev., asexual female. a) Head in frontal view; b) head in posterior view; c) head in dorsal view; d) head in lateral view; e) antenna.
Head (Fig. 4a-d) trapezoid, broadest part on the toruli level, 1.2× as broad as high, or less, and slightly narrower than mesosoma in frontal view, with sparse setae, denser on lower face and postgena; 2.4× as broad as long in dorsal view. Gena alutaceous, broadened behind eye in frontal view, nearly as broad as cross diameter of eye in lateral view. Malar space alutaceous with distinct rugae radiating from clypeus and reaching eye; eye 1.7× as high as length of malar space. Inner margins of eyes parallel or only slightly converging ventrally. POL 2.0× as long as OOL, OOL 1.5× as long as diameter of lateral ocellus and 1.2× as long as LOL, all ocelli ovate, of same size. Transfacial distance 1.2× as long as height of eye; toruli located at mid height of eyes, frons shorter than height of lower face, diameter of antennal torulus 2.0× as long as distance between them, distance between torulus and eye 1.3× as long as diameter of torulus; lower face with sparse setae, rugoso-reticulate, rugae orientated mainly dorsoventrally and units of impressed areas slightly elongated, smooth; without setae; slightly elevated median area sculptured like rest of lower face. Clypeus impressed, flat, trapezoid, broader than high, smooth, glabrous, with few long setae along ventral edge; ventrally rounded, not emarginate and without median incision; anterior tentorial pit rounded, distinct, epistomal sulcus distinct, clypeo-pleurostomal line well impressed. Frons uniformly alutaceous, without striae and setae, area between toruli and eye alutaceous; interocellar area rugose. Vertex rugose, occiput alutaceous, glabrous, with white long setae; postocciput and postgena glabrous, alutaceous-reticulate, with concentric lines around occipital foramen and postgenal bridge; posterior tentorial pit large, elongated, area below impressed; occipital foramen as high as height of postgenal bridge; hypostomal carina emarginate, continuing into postgenal sulci, which diverge toward occipital foramen, postgenal bridge anteriorly slightly broader than occipital foramen. Antenna (Fig. 4e) as long as head+mesosoma, with 11 flagellomeres, scape 2.0× as long as pedicel, pedicel 1.4× as long as broad; flagellomeres subsequently broadening until apical end; all flagellomeres with sparse white short setae; F1 slightly longer than F2 and 1.8× as long as pedicel; F2 1.2× as long as F3; F3 slightly longer than F4, F5 = F6 = F7, F8 until F10 equal in length; F11 1.8× as long as F10; placodeal sensilla on F3-F11.
Figure 5a-d. Andricus geniale comb. rev., asexual female. a) Mesosoma in lateral view; b) mesosoma in frontal view; c) mesosoma in dorsal view; d) mesoscutellum.
Mesosoma (Figs. 5a-d, 6b) longer than high, with few white setae, setae denser along propleuron and on lateral propodeal area. Pronotum smooth, sparsely pubescent with delicate parallel striae; anterolateral impressed narrow area smooth, shining; propleuron coriaceous, smooth, shining in the dorsomedial part, with scattered white short setae. Mesoscutum uniformly alutaceous-reticulate, slightly broader than long (largest width measured across mesoscutum at level of base of tegulae), with white setae, denser along anterior parallel lines. Notaulus deep, distinct, complete, slightly obscured anteriorly; posteriorly converging; in most posterior part distance between notauli shorter than distance between notaulus and side of mesoscutum; anterior parallel line almost indistinct, slightly elevated, and finely alutaceous; parapsidal line impressed, extending well above tegula; median mesoscutal line absent or in a form of very short, impressed triangle; circumscutellar carina broad, reaching notaulus. Mesoscutellum elongated, longer than broad, trapezoid, broadest part in posterior 1/4 of its length; disk of mesoscutellum dull rugose laterally and posteriorly, coriaceous in anteromedian part, overhanging metanotum, with sparse setae. Mesoscutellar foveae transverse, with smooth, shining bottom, divided by narrow elevated coriaceous central area. Mesopleuron smooth, shining with delicate striae starting at ventrocentral part and going across mesopleuron to anterodorsal edge; lower half of anterior margin elevated into a strong carina, followed by impressed narrow furrow with striated bottom, speculum and posterior margin of mesopleuron smooth, glabrous, without longitudinal striae; mesopleural triangle smooth, glabrous, with dense, long white setae; dorsal and lateral axillar areas coriaceous, matt, with sparse white setae; axillula with delicate parallel longitudinal striae; subaxillular bar smooth, glabrous, with parallel sides, posteriorly as high as height of metanotal trough; metapleural sulcus reaching mesopleuron in upper 1/3 of its height, delimiting broad triangular smooth area with dense setae; upper part of sulcus distinct. Metascutellum coriaceous, higher than height of smooth, glabrous ventral impressed area; metanotal trough smooth, glabrous, with dense white setae; central propodeal area rectangular, smooth, shining, with irregular strong rugae; lateral propodeal carinae distinct, broad, blackish, subparallel; lateral propodeal area smooth, glabrous. Hind coxa and femora slightly swollen, without apical lobe; hind tibia with internal carinae. Tarsal claws toothed, with acute basal lobe.
Figure 6a-d. Andricus geniale comb. rev., asexual female (a-c). a) Fore wing; b) propodeum; c) metasoma in lateral view; d) galls, deposited in the AMNH.
Forewing (Fig. 6a) as long as body, hyaline, with very short cilia on margins, veins brown; radial cell opened, 3.1× as long as broad; Rs and R1 not reaching wing margin; areolet indistinct. Rs+M on all length indistinct, invisible.
Metasoma (Fig. 6c) as long as head+mesosoma, slightly longer than high in lateral view; 2nd metasomal tergum extending to 3/4 length of metasoma in dorsal view, with dense patch of white setae anterolaterally; all terga and hypopygium micropunctate posteriorly, prominent part of ventral spine of hypopygium 5.2× as long as broad in ventral view. Body length 2.0-2.5 mm.
Gall (Fig. 6d) unilocular, located on the buds, easily separable, elongated-cylindrical, cup-shaped (sometimes globular), almost or totally closed at the top. External surface silvery to yellow-brown, often with a rough surface; darker when more mature, completely bare, densely scaly or purple. Base of galls enlarged but joined by a small central point to the branch. Internally, the base of the gall is quite solid and woody, containing a centrally located circular larval chamber which, although heavily encrusted, has a distinct cell wall; upper half hollow, cup-shaped, bounded by thin to fairly thick walls occupying more than one-third the diameter of the entire gall; the walls of the upper half of the gall are quite thick and often wrinkled. Diameter up to 8.0 mm and length up to 11.0 mm.
Taxonomic summary
Type material examined. Holotype: female deposited in the AMNH “Durango, 2 N Dgo6500. Gall 11.8.31, female Spr.’32”, “Q. undata Kinsey Coll.” (white labels), “F. geniale HoloParatype” (red label), “AMNH_IZC 00322882” (white label with a QR code). Paratypes: 2 females deposited in the AMNH: “Durango, 2 N Dgo6500. Mex ꚛ, 11.8.31, female Spr.’32”, “Q. undata Kinsey Coll.” (white labels), “F. geniale Paratype” (red label); a female with the same data at HMNH.
Figure 7a-f. Andricus integrum comb. rev., asexual female. a) Head in frontal view; b) head in lateral view; c) head in dorsal view; d) head in posterior view; e) antenna; f) propleuron and first coxae.
Biology. Only the asexual generation is known; adults emerge in spring. Galls on Q. undata Trell. (section Quercus, subsection Leucomexicanae, white oaks) (Kinsey 1937b).
Distribution. Mexico: state of Durango (Kinsey, 1937b).
Diagnosis. Differs from all the Andricus species, except for the species here transferred to Andricus, which have tibial carina and the last femur swollen. It differs from A. lusum comb. rev. by scarcely pubescent body, with mesopleuron glabrous on its entire surface, the internal margin of eyes parallel, the hind femur without distal lobe; differs from A. calvoi sp. nov., A. lusum comb. rev., and A. perfectum comb. rev. by the LOL which is more than 1.2× as long as the diameter of lateral ocellus, the hind coxae and femora are not swollen, and the propodeal carinae subparallel. Differs from A. geniale comb. rev. by dull, rugose-reticulate lower face, with vertical carinae radiating from clypeus; the mesopleuron is completely striated, except for the smooth speculum.
Redescription. Asexual female (Figs. 7a-f, 8a-e, 9a-b). Head, mesosoma, antenna dark brown to black; legs dark brown, except dark brown to black coxae; metasoma chestnut brown.
Head (Fig. 7a-d) trapezoid, broadest part on toruli level, 1.5× as broad as high and slightly narrower than mesosoma in frontal view, with sparse setae, denser on lower face and postgena; 2.2× as broad as long in dorsal view. Gena alutaceous, units of sculpture orientated dorsoventrally, elongated, giving striate aspect in lower part; gena broadened behind eye in frontal view, slightly narrower than cross diameter of eye in lateral view. Malar space with distinct rugae radiating from clypeus and reaching eye, area between rugae matte, alutaceous; eye 1.9× as high as length of malar space. Inner margins of eyes parallel or only slightly converging ventrally. POL 2.0× as long as OOL, OOL 1.5× as long as diameter of lateral ocellus and only slightly longer than LOL. Transfacial distance 1.2× as long as height of eye; toruli located at mid height of eyes, frons shorter than height of lower face, diameter of antennal torulus 2.0× as long as distance between them, distance between torulus and eye 1.5× as long as diameter of torulus; lower face with sparse setae, rugoso-reticulate, rugae radiating from clypeus and reaching toruli, slightly elevated median area sculptured like rest of lower face. Clypeus impressed, flat, rectangular, broader than high, smooth, glabrous; ventrally rounded, not emarginate and without median incision; anterior tentorial pit rounded, distinct, epistomal sulcus distinct, clypeo-pleurostomal line well impressed. Frons uniformly alutaceous, without striae and setae, area between toruli and torulus and eye alutaceous; interocellar area rugose. Vertex rugose, occiput alutaceous, glabrous, with white long setae; postocciput with delicate transverse striae, postgena glabrous, alutaceous-reticulate, around occipital foramen and postgenal bridge smooth, shining; posterior tentorial pit large, elongated, area below impressed; occipital foramen 2.0× as high as height of postgenal bridge; hypostomal carina emarginate, continuing into postgenal sulci, which diverge toward occipital foramen, postgenal bridge anteriorly broader than occipital foramen. Antenna (Fig. 7e) as long as head+mesosoma, with 11 flagellomeres, scape 2.0× as long as pedicel, pedicel subglobose, as long as broad; flagellomeres subsequently broadening until apical end; all flagellomeres with sparse white short setae; F1 slightly longer than F2 and 1.8× as long as pedicel; F2 1.2× as long as F3; F3 slightly longer than F4, F5 = F6 = F7, F8 until F10 equal in length; F11 1.8× as long as F10; placodeal sensilla on F3-F11.
Figure 8a-e. Andricus integrum comb. rev., asexual female. a) Mesosoma in lateral view; b) mesosoma in dorsal view; c) mesoscutellum; d) propodeum; e) fore wing.
Mesosoma (Figs. 7f, 8a-d) longer than high, with few white setae, setae denser along propleuron and on lateral propodeal area. Pronotum smooth, glabrous dorsally, with transverse striae laterally; anterolateral impressed narrow area smooth, shining; propleuron alutaceous, smooth shining, with scattered white short setae. Mesoscutum uniformly alutaceous-reticulate, slightly broader than long (largest width measured across mesoscutum at level of base of tegulae), with white setae, denser along anterior parallel lines. Notaulus deep, distinct, complete; posteriorly converging; in most posterior part distance between notauli shorter than distance between notaulus and side of mesoscutum; anterior parallel line, glabrous, indistinct; parapsidal line impressed, extending well above tegula; median mesoscutal line absent or in a form of a very short, impressed triangle; circumscutellar carina broad, reaching notaulus. Mesoscutellum elongated, longer than broad, trapezoid, with subparallel sides; broadest part in posterior 1/4 of its length; disk of mesoscutellum dull rugose laterally and posteriorly, reticulated in anteromedian part, overhanging metanotum, with sparse setae. Mesoscutellar foveae transverse, with smooth, shining bottom, divided by narrow elevated smooth central area. Mesopleuron shining in between striae going across mesopleuron, anteriorly mesopleuron with narrow foveolate stripe, lower half of anterior margin elevated into a strong carina, followed by an impressed narrow furrow with bottom striated, speculum smooth, glabrous, without transverse longitudinal striae; mesopleural triangle smooth, glabrous, with dense, long white setae; dorsal and lateral axillar areas alutaceous, matte, with sparse white setae; axillula with delicate parallel longitudinal striae; subaxillular bar smooth, glabrous, with parallel sides, posteriorly as high as height of metanotal trough; metapleural sulcus reaching mesopleuron in upper 1/3 of its height, delimiting broad triangular smooth area with dense setae; upper part of sulcus distinct. Metascutellum with longitudinal rugae, 2.0× as high as height of smooth, glabrous ventral impressed area; metanotal trough smooth, glabrous, with dense white setae. Central propodeal area rectangular, smooth, shining, without irregular rugae; lateral propodeal carinae slightly bent outwards (parallel in the holotype), distinct, broad, blackish; lateral propodeal area smooth, glabrous, with long dense white setae. Nucha dull rugose dorsally, with parallel sulci laterally. Hind coxa and femora swollen, femora without apical lobe (Fig. 9a). Tarsal claws toothed, with acute basal lobe.
Figure 9a-c. Andricus integrum comb. rev., asexual female (a-b). a) Hind leg; b) metasoma in lateral view; c) galls, deposited in the AMNH.
Forewing (Fig. 8e) above as long as body, hyaline, with very short cilia on margin, veins brown; radial cell opened, 2.8× as long as broad; Rs and R1 not reaching wing margin; areolet indistinct. Rs+M on all length indistinct, invisible.
Metasoma (Fig. 9b) as long as head+mesosoma, slightly longer than high in lateral view; 2nd metasomal tergum extending to 3/4 length of metasoma in dorsal view, with dense patch of white setae anterolaterally; all terga and hypopygium micropunctured, prominent part of ventral spine of hypopygium 7.2× as long as broad in ventral view. Body length 2.1-2.6 mm (according to Kinsey, 1937b).
Gall (Fig. 9c). Similar to A. geniale but a little smaller: diameter up to 7 mm, length up to 10 mm.
Figure 10a-f. Andricus lusum comb. rev., asexual female. a) Head in frontal view; b) head in dorsal view; c) mesosoma in lateral view; d) mesosoma in dorsal view; e) mesoscutellum; f) propodeum.
Taxonomic summary
Type material examined. Holotype: female deposited in the AMNH “S. Luis Potosí, S.L.P. 15W, 8000, Mex. ꚛ, gall 11.30.31, female 1932”, “Q. potosina Kinsey Coll.” (white labels), “F. integrum HoloParatype” (red label), “AMNH_IZC 00322883” (white label with a QR code). Paratypes: 2 females deposited in the AMNH “S. Luis Potosí, S.L.P. 15W, 8000, Mex. ꚛ, gall 10.30.31, female 1932”, “Q. potosina Kinsey Coll.” (white labels), “F. integrum Paratype” (red label); a female with the same data at HMNH.
Additional material. One female deposited in the AMNH “San Felipe, Gto., 20 SW, 3000’, Mex. ꚛ, 12.7.31, female, spr. 32”, “Q. chihuahuens Kinsey coll.”, “F. integrum Kinsey coll. 37”.
Biology. The asexual generation is only known to induce galls on Q. potosina Trel., Q. chihuahuensis Trel., Q. undata Trel., and Q. rugosa Né (= Q. reticulata Née) (section Quercus, subsection Leucomexicanae, white oaks), according to Kinsey (1937b). Adults probably emerge in spring.
Distribution. México: Guanajuato and San Luis Potosí (Kinsey, 1937b).
Diagnosis. Differs from all the Andricus species, except for the species here transferred to Andricus, which have tibial carina and the last femur swollen. This species belongs to the group of species that have the hind femur with a distal lobe and the LOL shorter than diameter of lateral ocelli, along with A. calvoi sp. nov. and A. perfectum comb. rev.It differs from A. perfectum comb. rev. by a faintly reticulate, shining lower face, carinae radiating from clypeus not extending towards toruli, the pronotum punctured with striae only on lateral margin, and the notaulus incomplete reaching more than 3/4 of length of mesonotum. Differs from A.calvoi sp. nov., by the space between notauli in the posterior margin on mesoscutum, which is subequal to the space between notauli and parapsidal lines, and parapsidal lines parallel or slightly bent outwards.
Redescription. Asexual female (Figs. 10a-f, 11a-b). Head, mesosoma dark brown to black, antenna dark brown; legs chestnut brown, except dark brown to black coxae; metasoma chestnut brown.
Head (Fig. 10a-c) trapezoid, broadest part below the toruli level, 1.5× as broad as high and slightly narrower than mesosoma in frontal view, with sparse setae, denser on lower face and postgena; 2.6× as broad as long in dorsal view. Gena finely reticulate, shining, broadened behind eye in frontal view, nearly as broad as cross diameter of eye in lateral view. Malar space alutaceous with distinct rugae radiating from clypeus and reaching eye; eye 2.1× as high as length of malar space. Inner margins of eyes parallel. POL 2.0× as long as OOL, OOL 1.5× as long as diameter of lateral ocellus and 1.3× as long as LOL, all ocelli ovate, of same size. Transfacial distance slightly longer than height of eye; toruli located at mid height of eyes, frons shorter than height of lower face, diameter of antennal torulus 2.0× as long as distance between them, distance between torulus and eye 1.2× as long as diameter of torulus; lower face with dense setae, shining, faintly reticulate-alutaceous, rugae orientated mainly dorsoventrally and units of impressed areas slightly elongated, smooth; slightly elevated median area sculptured like rest of lower face. Clypeus impressed, flat, rectangular, broader than high, smooth, glabrous, with few long setae along ventral edge; ventrally rounded, not emarginate and without median incision; anterior tentorial pit rounded, distinct, epistomal sulcus distinct, clypeo-pleurostomal line well impressed. Frons uniformly reticulated, without setae, area between toruli and torulus and eye alutaceous; interocellar area rugose. Vertex rugose, occiput alutaceous, glabrous, with white long setae; postocciput and postgena glabrous, alutaceous-reticulate, with concentric lines around occipital foramen and postgenal bridge. Antenna of the type material broken past F4, scape 1.5× as long as pedicel, pedicel 1.2× as long as broad; flagellomeres subsequently broadening until apical end; all flagellomeres with sparse white short setae; F1 slightly longer than F2 and 2.4× as long as pedicel; F2 slightly longer than F3; F3 slightly longer than F4, subsequent flagellomeres are missing.
Mesosoma (Fig. 10c-f) longer than high, with dense white setae, setae denser along propleuron and on lateral propodeal area. Pronotum with delicate parallel striae and impressed setose pits; anterolateral impressed narrow area smooth, shining; propleuron coriaceous, smooth shining in the dorsomedial part, with scattered white short setae. Mesoscutum uniformly alutaceous-reticulate, units transversally oriented on anterior half, posterior half alutaceous-reticulate with impressed setal points; slightly broader than long (largest width measured across mesoscutum at level of base of tegulae), with white setae. Notaulus deep, distinct, incomplete, absent in anterior 1/4-1/5 of mesoscutum length, anterior insertion into parascutal carina visible, posteriorly converging; in most posterior part distance between notauli shorter than distance between notaulus and side of mesoscutum; anterior parallel line distinct, slightly elevated, extending to 1/2 of mesoscutum length; parapsidal line impressed, extending until shortly passed the tegula; median mesoscutal line absent; circumscutellar carina broad, reaching notaulus. Mesoscutellum elongated, longer than broad, trapezoid, broadest part in posterior 1/4 of its length; disk of mesoscutellum uniformly dull rugose, overhanging metanotum, with sparse setae. Mesoscutellar foveae transversally ovate, with smooth, shining bottom, divided by broad elevated rugose central area, half as wide as mesoscutellar fovea. Mesopleuron smooth, shining with delicate striae going across mesopleuron; anteriorly with narrow foveolate stripe, speculum and posterior margin smooth, glabrous, without transverse longitudinal striae; mesopleural triangle coriaceous, glabrous, with dense, long white setae; dorsal and lateral axillar areas alutaceous with faint rugae, dull, with sparse white setae; axillula with delicate parallel longitudinal striae; subaxillular bar smooth, glabrous, triangular, posteriorly as high as height of metanotal trough. Metapleural sulcus reaching mesopleuron in upper 1/3 of its height, delimiting broad triangular smooth area with dense setae; upper part of sulcus distinct. Metascutellum rugose, as high as the smooth, glabrous ventral impressed area; metanotal trough smooth, glabrous, with dense white setae; central propodeal area rectangular, smooth, shining, with irregular strong rugae. Lateral propodeal carinae distinct, broad, slightly bent outwards; central propodeal area smooth with faint rugae; lateral propodeal area punctured-smooth, uniformly pubescent. Nucha dull rugose dorsally, with parallel sulci laterally. Hind legs (Fig. 11b) with coxa broad, femur strongly broadened, with apical lobe; hind tibia with ventral carina reaching almost to the base of the tibia; tarsal claws toothed, with acute basal lobe.
Forewing (Fig. 11a) above as long as body, hyaline, with very short cilia on margins, veins brown; radial cell opened, 3.2× as long as broad; Rs and R1 not reaching wing margin; areolet indistinct. Rs+M on all length indistinct, invisible.
Metasoma (Fig. 11b) as long as head+mesosoma, slightly longer than high in lateral view; 2nd metasomal tergum extending to 3/4 length of metasoma in dorsal view, with dense patch of white setae anterolaterally, with micropunctures; all subsequent terga and hypopygium with dense micropunctures, prominent part of ventral spine broken. Body length 3.0 mm (according to Kinsey, 1937b).
Gall (Fig. 11c). According to Kinsey (1937b): galls are cylindric, with the thin-walled top half of the gall widely open or flaring, making the gall wide open cup-shaped with a thick and solid base, the open cavity almost as wide as the whole gall. The gall silvery to yellowish-brown; young galls quite scurfy, older galls naked. The diameter of the body of the gall up to 15.0 mm, averaging nearer 11.0 mm; the flared top up to 19.0 mm in diameter; length up to 19.0 mm, averaging near 15.0 mm.
Taxonomic summary
Type material examined. Holotype asexual female deposited in the AMNH: “Morelia, 14E; Mich 7000; Mex gall 12.27.31”, “Q. conglomerata, Kinsey Coll.” (white labels), “Femuros lusum HoloParatype” (red label), “AMNH_IZC 00267205” (white label with a QR code). Paratypes: only galls with the same data as the holotype.
Biology. The asexual generation is known for inducing galls on a single species of white oaks: Q. rugosa Née (= conglomerata Trell.; section Quercus, subsection Leucomexicanae, white oaks). The single adult of this species (holotype) probably obtained after gall cut; galls were collected on December 27, 1931 (Kinsey, 1937b).
Diagnosis. Differs from all the Andricus species, except for the species here transferred to Andricus, with tibial carina and the last femur swollen. This species belongs to the group of species that have the hind femur with a distal lobe and the LOL shorter than the diameter of lateral ocellus, A. calvoi sp. nov., and A. lusum comb. rev. Differs from those 2 species by dull rugose-reticulate lower face, with vertical carinae radiating from the clypeus towards the toruli; the pronotum completely striate with parallel curved striae; and the notaulus incomplete reaching slightly more than half-length of mesonotum.
Redescription. Asexual female (Figs. 12a-f, 13a-c, 14a-c). Head, antenna dark brown; mesosoma blackish; legs chestnut brown, except dark brown to black coxae; metasoma chestnut brown.
Head (Figs. 12a-d, 13c) trapezoid, broadest part on the toruli level, 1.4× as broad as high and as broad as mesosoma in frontal view, with sparse setae, denser on postgena; 2.4× as broad as long in dorsal view. Gena alutaceous, units of sculpture orientated dorsoventrally, elongated, giving striate aspect of gena in its lower part; gena slightly broadened behind eye in frontal view, slightly broader than cross diameter of eye in lateral view. Malar space with distinct rugae radiating from clypeus and reaching eye, area between rugae smooth, shining; eye 2.2× as high as length of malar space. Inner margins of eyes parallel. POL 2.1× as long as OOL, OOL 1.7× as long as diameter of lateral ocellus and only slightly longer than LOL, lateral ocelli bigger than median ocellus. Transfacial distance subequal to height of eye; toruli located slightly above height of eyes, frons at least 2.0× shorter than height of lower face, diameter of antennal torulus 2.4× as long as distance between them, distance between torulus and eye 1.4× as long as diameter of torulus; lower face with sparse setae, delicately coriaceous, striae radiating from clypeus extending to 1/3 of lower face height; slightly elevated median area delicately coriaceous, on both sides with delicate striae radiating from clypeus and extending to 1/3 of lower face height. Clypeus convex, rectangular, broader than high, delicately coriaceous; ventrally rounded, not emarginate and without median incision; anterior tentorial pit rounded, distinct, epistomal sulcus distinct, clypeo-pleurostomal line well impressed. Frons dull rugose, without striae and setae, area between toruli and torulus and eye smooth, shining; interocellar area rugose. Vertex rugose, occiput alutaceous, glabrous, with white long setae; postocciput and postgena glabrous, alutaceous-reticulate, around occipital foramen and postgenal bridge smooth, shining; posterior tentorial pit large, elongated, area below impressed; occipital foramen as high as height of postgenal bridge; hypostomal carina emarginate, continuing into postgenal sulci which diverge toward occipital foramen, postgenal bridge anteriorly broader than occipital foramen. Antenna (Fig. 12e) slightly longer than head+mesosoma, with 11 flagellomeres, scape 2.7× as long as pedicel, pedicel subglobose, as long as broad; flagellomeres; flagellomeres from F1 until F7 of same width, with sparse white short setae; F1 = F2 and 2.4× as long as pedicel; F2 1.65× as long as F3; F3 slightly shorter than F4, F5 = F6 = F7, from F8 flagellomeres subsequently broadening until apical end, F8 until F10 equal in length; F11 1.8× as long as F10; placodeal sensilla on F2-F11.
Mesosoma (Figs. 12f, 13a-c, 14c) longer than high, with few white setae, setae denser along propleuron and on lateral propodeal area. Pronotum smooth, glabrous dorsally, laterally delicately uniformly coriaceous, without transverse striae; anterolateral impressed narrow area smooth, shining; propleuron alutaceous, smooth shining, with scattered white short setae. Mesoscutum uniformly alutaceous-reticulate, with distinct piliferous points scattered all over the mesoscutum, slightly broader than long (largest width measured across mesoscutum at level of base of tegulae), with white setae, denser along anterior parallel lines. Notaulus weakly impressed, narrow, incomplete, reaching to 3/4 of mesoscutum length; posteriorly converging; in most posterior part distance between notauli shorter than distance between notaulus and side of mesoscutum; anterior parallel line indistinct; parapsidal line impressed, extending to the level of tegula; median mesoscutal absent; circumscutellar carina broad, reaching notaulus. Mesoscutellum elongated, longer than broad, trapezoid, with subparallel sides; broadest part in posterior 1/4 of its length; disk of mesoscutellum uniformly dull rugose, overhanging metanotum, with sparse setae. Mesoscutellar foveae transverse, with smooth, shining bottom, divided by narrow elevated coriaceous central area. Mesopleuron alutaceous, delicate short transverse striae ventrally only in the anterolateral part, anteriorly mesopleuron with narrow foveolate stripe, speculum smooth, glabrous, without transverse longitudinal striae; mesopleural triangle delicately coriaceous, with dense, long white setae; dorsal and lateral axillar areas delicately coriaceous, matte, with sparse white setae; axillula with delicate parallel longitudinal striae; subaxillular bar smooth, glabrous, triangular, in the highest posterior part as high as height of metanotal trough; metapleural sulcus indistinct, reaching mesopleuron in upper 1/3 of its height, delimiting broad triangular smooth area with dense setae; upper part of sulcus indistinct. Metascutellum with longitudinal rugae, as high as height of smooth, glabrous ventral impressed area; metanotal trough smooth, glabrous, with dense white setae; central propodeal area rectangular, smooth, shining, without irregular rugae; lateral propodeal carinae slightly bent outwards, distinct, broad, blackish; lateral propodeal area smooth, glabrous, with long dense white setae. Nucha dull rugose dorsally, with parallel sulci laterally. Hind femora (Fig. 14b) strongly broadened, hind tibia with ventral carina reaching almost to the base of the tibia. Tarsal claws toothed, with acute basal lobe.
Forewing (Fig. 14a) above as long as body, hyaline, with dense cilia on margins, veins whitish, hardly traceable; radial cell opened, 2.8-3.2× as long as broad; Rs and R1 not reaching wing margin; areolet indistinct and Rs+M, indistinct invisible.
Metasoma (Fig. 14b) as long as head+mesosoma, longer than high in lateral view; 2nd metasomal tergum extending to 3/4 length of metasoma in dorsal view, with numerous white setae anterolaterally, smooth, shining; all subsequent terga and hypopygium with micropunctures, prominent part of ventral spine of hypopygium 4.5× as long as broad in ventral view. Body length 2.4-3.5 mm (according to Kinsey, 1937b).
Gall (Fig. 14d). Similar to A. geniale and A. perfectum, but larger (diameter up to 16 mm, never more than 13 mm in length), nearly globular or slightly elongated or flattened. In section, the upper cavity is exceedingly small occupying the upper half of the gall, never wider than larval chamber (often narrower), almost completely closed by very thick and solid walls, although a central pucker at the apex of the gall still indicates the opening to the cavity; outside of the gall silvery grey to purplish brown, conspicuously covered with a purplish-white bloom.
Taxonomic summary
Type material examined. Holotype: female deposited in the AMNH “Chilpancingo, Gro 6S, 4000’, Mex; gall 1.8.32, 56 females 5.10.32”, “Q. macrophylla Kinsey Coll.” (white labels), “F. perfectum HoloParatype” (red labels), “AMNH_IZC 00322886” (white label with a QR code). Paratypes: 33 females deposited in the AMNH “Chilpancingo, Gro 6S, 4000, Mex; gall 1.8.32, 56 females 5.10.32”, “Q. macrophylla Kinsey Coll.” (white labels), “F. perfectum Paratype” (red label).
Biology. The asexual generation is only known to induce galls on Q. magnoliifolia Née (= Q. macrophylla Née; section Quercus, subsection Leucomexicanae, white oaks). Adults emerge from May to July (Kinsey, 1937b).
Distribution. México: Guerrero (Kinsey, 1937b).
Femuros Kinsey, 1937
Type species: Femuros repandae Kinsey, 1937.
Diagnosis. Only asexual females known. Femuros is characterized as having a lower head smooth or almost smooth, without radiating carina from clypeus or very short, neither malar sulcus, occipital carina visible behind the ocelli, with transscutal articulation, winged forms, hind femur broadened on ventral margin near distal end, and an internal carina on the hind tibia. Some species of Andricus, Amphibolips, and Odontocynips can have broadened hind femur but in these cases the lower face is always sculptured (rugose and/or with radiating carina from clypeus). Very few Cynipini genera with transscutellar articulation lack facial striae and a malar groove: Dros, Cynips, Eumayriella, Heteroecus, and Kokkocynips. Eumayriella, unlike Femuros, is brachypterous, lacks scutellar pits and has a dorso-ventrally flat mesosoma. Heteroecus and Kokkocynips have sculptured face and simple tarsal claws, unlike Femuros; furthermore, the metanotum is sculptured in Kokkocynips (without sculpture in Femuros). Cynips have the head sculptured and, the mesoscutum and mesopleuron smooth or practically smooth (head smooth and sculptured mesoscutum and mesopleuron in Femuros); also, agamic forms of Cynips have a wide forming ventral spine provided with a dense truncated tuft in agamic forms (long spine without the apical tuft in Femuros). Dros has the head in frontal view smooth and mesoscutum also smooth but in Femuros the fronts and mesoscutum are sculptured. Finally, Sphaeroteras and some Neuroterus species have the lower face smooth, as Femuros, but have also malar sulcus (absent in Femuros); besides, in Neuroterus the transscutal articulation is absent (present in Femuros).
Redescription. Asexual female. Head, mesosoma dark brown, chestnut brown to black, rusty brown or yellowish to yellow amber; antenna of the same color or paler than head; metasoma dark brown to reddish brown; mouthparts, legs yellowish-brown, light brown to dark brown, with coxae always darker.
Head alutaceous, with sparse setae, denser on lower face, rounded, trapezoid or transverse, 1.2-1.4× as broad as high and slightly broader than mesosoma in frontal view; 2.0-2.2× as broad as long in dorsal view. Gena alutaceous, either not or broadened behind eye in frontal view, narrower than transverse diameter of eye in lateral view. Malar space alutaceous, with striae radiating from clypeus and reaching eye, malar sulcus absent (Figs. 15a, 16a, 18a, 21a); eye 2.8-4.0× as high as length of malar space. Eyes parallel or slightly converging ventrally. POL 1.8-3.6× as long as OOL, OOL slightly shorter or 1.3-1.6× as long as diameter of lateral ocellus and nearly equal to LOL, all ocelli ovate, of same size (Figs. 16b, 18c, 21c). Transfacial distance slightly shorter or equal to height of eye; toruli located at mid-height or level with the lower half of eye; frons higher than lower face, diameter of antennal torulus 1.3-2.0× as long as distance between them, distance between torulus and eye slightly shorter or 1.2-1.5× as long as diameter of torulus; lower face smooth, glabrous, alutaceous to delicately coriaceous, with white setae, with or without short delicate striae; slightly elevated median area alutaceous to delicately coriaceous, with few setae. Clypeus rounded, quadrangular or rectangular, nearly 2.0× as broad as high, smooth, glabrous, with few setae; ventrally rounded, not emarginate and without median incision; anterior tentorial pit large, rounded, distinct, epistomal sulcus distinct, clypeo-pleurostomal line well impressed. Frons uniformly alutaceous, without striae and setae, interocellar area alutaceous. Vertex, occiput and postocciput alutaceous; postgena smooth or alutaceous, with or without setae; posterior tentorial pit large, elongated, area below impressed; occipital foramen slightly shorter or as high as height of postgenal bridge; hypostomal carina emarginate, continuing into postgenal sulci which strongly diverge toward occipital foramen, postgenal bridge anteriorly slightly broader than occipital foramen. Antenna longer than head+mesosoma, with 11-12 flagellomeres (in some specimens the suture between F12 and F11 hardly visible), pedicel longer than broad; flagellomeres subsequently broadening towards apical end; F1 1.6× as long as pedicel and 1.3× as long as F2; F2 1.1× as long as F3; F3 = F4 = F5, F5 1.1× as long as F6, F6 to F10 nearly equal in length; F11 2.1× as long as F10; placodeal sensilla on F3-F11(F12).
Mesosoma slightly longer than high, with a few white setae, denser along propleuron and laterally. Pronotum smooth, glabrous, with parallel striae and sparse setae laterally; propleuron smooth, glabrous. Mesoscutum uniformly and entirely reticulate, with a few white setae along notauli (Fig. 17a), slightly longer than broad (greatest width measured across mesoscutum level with base of tegulae). Notaulus complete, in some species indistinct in anterior 1/3, impressed in posterior 2/3 of mesoscutum length, notaular furrow alutaceous or smooth; posteriorly strongly converging; anterior parallel line invisible or indistinctly impressed and extending to 1/3 of mesoscutum length; parapsidal line marked with broad impressed area; median mesoscutal line absent or short and impressed only posteriorly; parascutal carina broad, reaching pronotum. Mesoscutellum ovate, slightly longer than broad; disk of mesoscutellum, rugose, reticulated or dull rugose only laterally and posteriorly, overhanging metanotum, glabrous or with sparse long setae; circumscutellar carina complete. Mesoscutellar foveae transverse, about 2.0× as broad as high, with smooth glabrous bottom, divided by narrow rugose elevated central carina. Mesopleuron entirely covered with delicate interrupted parallel striae, without setae or only setose ventrally (Figs. 19a, 22a); mesopleural triangle smooth, glabrous, with a few strong irregular striae and long white setae; dorsal and lateral axillar areas smooth, glabrous, without setae; axillula with delicate parallel longitudinal striae; subaxillular bar smooth, glabrous, triangular, posteriorly as high as height of metanotal trough; metapleural sulcus reaching mesopleuron at mid-height or slightly above, upper part of sulcus also distinct, sulcus separating smooth, glabrous area, with some setae in lower part. Metascutellum smooth, glabrous or coriaceous, as high as height of smooth, glabrous ventral impressed area; metanotal trough smooth, glabrous, without setae; central propodeal area smooth, glabrous, with or without delicate rugae in posterolateral part; several parallel indistinct, interrupted, incomplete lateral propodeal carinae bent outwards in mid-height or posterior 1/3 (Figs. 19c-22c); in some cases lateral carinae absent; lateral propodeal area smooth, with long white setae and piliferous points. Nucha with strong longitudinal sulci dorsally and laterally. Tarsal claws with basal lobe.
Forewing longer than body, hyaline, with distinct dense cilia on margin, veins dark brown, radial cell open, 3.2-4.5× as long as broad; Rs not reaching wing margin, R1 indistinct, less pigmented, not reaching wing margin; areolet small, triangular, closed and distinct. Rs+M inconspicuous, its projection reaching basalis slightly below or in lower half of its height.
Metasoma as long as or longer than head+mesosoma, slightly longer or shorter than high in lateral view; 2nd metasomal tergum extending to half-length of metasoma in dorsal view, with few white setae anterolaterally, without micropunctures; third and fourth terga smooth, glabrous, without micropunctures; subsequent terga without or with rare delicate micropunctures (Figs. 15d, 20b). Hypopygium with or without micropunctures, prominent part of ventral spine of hypopygium 2.3-5.1× as long as broad in ventral view, with a few white setae ventrally. Body length 1.5-2.5 mm.
Femuros bracteatus (Weld, 1944), comb. nov.
Fig. 15a-d
Andricus bracteatus Weld, 1944: 8.
Diagnosis. Femuros bracteatus is most closely related to F. repandae and both differ from F. ruidum and F. ocri in having the POL around 1.5× as long as OOL, OOL 1.5× longer than diameter of lateral ocellus, the height of eye 2.0× longer than malar space, and the transfacial distance 1.3× as long as height of eye. Femuros bracteatus differs from F. repandae by the anterior parallel lines and parapsidal lines of the same color as the rest of the mesoscutum; mesoscutellar foveae are divided by a wide rugose elevated area, while in F. bracteatus the mesoscutum with the anterior parallel lines and parapsidal lines are darkened, chestnut colored; the mesoscutellar foveae are divided by a thin and sharp carina.
Redescription. Asexual female (Figs. 15a-b, 15d). Head, mesosoma, metasoma and legs reddish-brown, without darker areas in anterior parallel lines and parapsidal lines; antenna dark brown, last flagellomere darker; tegula yellowish. Wing veins brown.
Head (Fig. 15a-c) transversally oval, broadest part below toruli, broader than high and narrower than mesosoma in frontal view, with short dense white setae; 1.3× as broad as high in anterior view and head 2.0× as broad as long in dorsal view. Gena alutaceous to smooth, slightly broadened behind eye, as broad as cross diameter of eye, measuring along transfacial line. Malar space weak alutaceous, without striae radiating from clypeus, malar sulcus absent; eye 2.1× as high as length of malar space. Inner margins of eyes parallel. POL 2.6× as long as OOL, OOL as long as diameter of lateral ocellus and as long as LOL, all ocelli rounded, of same size. Transfacial distance 1.1× as long as height of eye; toruli located above mid height of head, frons shorter than height of lower face, diameter of antennal torulus 2.0× as long as distance between them, distance between torulus and eye almost as long as diameter of torulus. The lower face almost smooth, raised central part below the toruli alutaceous, pubescent. Clypeus impressed, coriaceous, rounded ventrally, medially not incised, anterior tentorial pits distinct; epistomal sulcus and clypeo-pleurostomal line distinctly impressed. Frons uniformly coriaceous, without striae, with few setae, piliferous points visible; interocellar area coriaceous with piliferous points; space between lateral ocellus to compound eye almost smooth and shining. Vertex and occiput coriaceous; postocciput and postgena glabrous, alutaceous-reticulate, with concentric lines around occipital foramen and postgenal bridge; posterior tentorial pit large, elongated, area below impressed; occipital foramen as high as height of postgenal bridge; hypostomal carina emarginate, continuing into postgenal sulci which strongly diverge toward occipital foramen, postgenal bridge anteriorly slightly broader than occipital foramen. Antenna (Fig. 15a-c) shorter than length of head + mesosoma, with 11 flagellomeres; pedicel 1.5× as long as broad; flagellomeres not broadening until apical end; F1 1.2× as long as F2 and 3.6× as long as pedicel; subsequent flagellomeres progressively shortened; F3 = F4, F5 = F6, F7 to F10 equal in length F11 longer than F10, sometimes F11 with a very inconspicuous suture and thus antenna with 12 flagellomeres; placodeal sensilla on F5-F11.
Mesosoma (Fig. 15b-c) 1.2× as long as high, concave in lateral view, pubescent. Sides of pronotum alutaceous, with white setae and weak and parallel carinae in upper lateroposterior part, anterolateral rim of pronotum inconspicuous. Mesoscutum 1.2× as broad as long in dorsal view; punctured, without rugae, pubescent, with dense piliferous points. Notaulus complete, deep, straight, converging posteriorly, in most posterior part distance between notauli shorter than distance between notaulus and side of mesoscutum; median mesoscutal line present; parapsidal lines and anterior parallel lines differentiated by alutaceous sculpture. circumscutellar carina absent. Mesoscutellum as long as broad, uniformly rugose; overhanging metanotum, with sparse long setae. Mesoscutellar foveae differentiated, delimited posteriorly by a broad rugose area, triangular, deep, with smooth bottom, separated by a median carina. Mesopleuron completely pubescent, weakly reticulate with delicate carinae and sparse setae anteriorly, speculum smooth and shining; mesopleural triangle alutaceous, with dense white setae, hiding the surface sculpture; dorsal and lateral axillar areas with delicate parallel longitudinal carinae, glabrous; axillula alutaceous, pubescent; subaxillular bar smooth, glabrous, triangular, posteriorly as high slightly shorter than high of metanotal trough; metapleural sulcus reaching mesopleuron in upper 1/2 of its height; upper part of sulcus distinct; lower part of sulcus delimiting big area with dense long white setae. Metascutellum subrectangular, coriaceous with some weak longitudinal carina, curved ventrally; metanotal trough alutaceous, with dense setae; ventral bar of metanotal trough coriaceous dorsally and smooth ventrally; central propodeal area nearly smooth and glabrous; lateral propodeal carinae parallel by converging toward posterior end; lateral parts of propodeum uniformly alutaceous, densely pubescent. Nucha almost smooth and shining dorsally, with parallel sulci laterally. Legs (Fig. 15d) with hind coxa broad, hind femur strongly broadened, with apical lobe; hind tibia with ventral carina on the ventral part extending to half the length of the tibia; base of tarsal claws with strong tooth.
Forewing (Fig. 15b) hyaline, 1.1× as long as body, pubescent, with cilia on margins; radial cell opened, around 2.6× as long as broad; veins light brown; areolet present. Rs+M vein obsolete heading towards the middle of the basal vein.
Metasoma (Fig. 15d) shorter than head+mesosoma, longer than high. 2nd metasomal tergum occupying 3/4 parts on the metasoma, with lateral patch of white setae, without micropunctures or micropunctures obsolete, all subsequent terga uniformly and entirely smooth or with obsolete micropunctures. Prominent part of ventral spine of hypopygium needle-like, around 2.6× as long as broad, with sparse setae laterally, without apical tuft of setae. Body length: 2.9 mm (Weld 1944).
Gall (Fig. 15c). Globular, bud gall up to 8.4 mm in diameter, more or less with short bracts usually on apical half. The internal parenchyma is cavernous with numerous lamellae connecting the outer shell and the larval chamber.
Taxonomic summary
Type material examined. Holotype, asexual female deposited in the USMN with the following labels “Young, Ariz.” (white label), “Type No. 56377, U.S.N.M.” (red label), “Andricus bracteatus 1942 Weld” (white label), “USNMENT 00779931” (white label with a QR code). Holotype examined through the images available at the website of the Entomology Department in the USNM: http://n2t.net/ark:/65665/3e449e73d-2c5a-49ee-8f2b-94f3ac9f237c
Biology. Only the asexual generation is known. The holotype was collected from an unknown Quercus, but the paratypes are reported as inducing galls on Q. oblongifolia Torr. and Q. rugosa (= diversicolor Trel.). According to Weld (1944) similar galls are also reported in Q. arizonica Sarg., and Q. toumeyi Sarg. (section Quercus, subsection Leucomexicanae, white oaks). The galls were collected between December and February, and the adults emerge in late March (Weld, 1944).
Figure 11a-c. Andricus lusum comb. rev., asexual female (a-b). a) Fore wing; b) metasoma in lateral view; c) galls, deposited in the AMNH.
Diagnosis. Differs from F. repandae by the POL 2.0× as long as OOL, OOL similar in length to the diameter of lateral ocellus, height of eye 2.5× as long as malar space, and the transfacial distance subequal to the height of the eye. Differs from F. ruidum by the sparsely pubescent mesopleuron, which is smooth, with scattered piliferous points, the speculum smooth and glabrous at least on half of its length, and the propodeal carinae are parallel.
Figure 12a-f. Andricus perfectum comb. rev., asexual female. a) Head in frontal view; b) head in posterior view; c) head in dorsal view; d) head in lateral view; e) antenna; f) mesosoma in dorsal view.
Redescription. Asexual female (Figs. 16a-e, 17a-c). Head, mesosoma, metasoma and legs reddish-brown (with some darker areas in anterior parallel lines and parapsidal lines); antenna light brown, last flagellomere darker; tegula yellowish. Wing veins brown.
Head (Fig. 16a-c) transversally ovate, broadest part below toruli, broader than high and narrower than mesosoma in frontal view, with short dense white setae; 1.3× as broad as high in anterior view and head 2.0× as broad as long in dorsal view. Gena alutaceous to smooth, slightly broadened behind eye, as broad as cross diameter of eye, measuring along transfacial line. Malar space weak alutaceous, without striae radiating from clypeus, malar sulcus absent; eye 2.1× as high as length of malar space. Inner margins of eyes parallel. POL 2.6× as long as OOL, OOL as long as diameter of lateral ocellus and as long as LOL, all ocelli rounded, of same size. Transfacial distance 1.1× as long as height of eye; toruli located above mid height of head, frons shorter than height of lower face, diameter of antennal torulus 2.0× as long as distance between them, distance between torulus and eye slightly longer than diameter of torulus. Lower face almost smooth raised central part below the toruli alutaceous, pubescent. Clypeus impressed, coriaceous, rounded ventrally, medially not incised, anterior tentorial pits distinct; epistomal sulcus and clypeo-pleurostomal line distinctly impressed. Frons uniformly coriaceous, without striae, with few setae, piliferous points visible; interocellar area coriaceous with piliferous points; space between lateral ocellus to compound eye almost smooth and shining. Vertex and occiput coriaceous. Antenna (Fig. 16d) shorter than length of head + mesosoma, with 11 flagellomeres; pedicel 1.5× longer than broad; flagellomeres not broadening until apical end; F1 1.2× as long as F2 and 3.6× as long as pedicel; subsequent flagellomeres progressively shortened; F3 = F4, F5 = F6, F7 to F10 equal in length F11 longer than F10, sometimes F11 with a very inconspicuous suture and thus antenna with 12 flagellomeres. Placodeal sensilla on F5-F11.
Figure 13a-c. Andricus perfectum comb. rev., asexual female. (a) Mesosoma in dorsal view; b) mesoscutellum; c) mesosoma in lateral view.
Mesosoma (Figs. 16e, 17a-c) 1.2× as long as high, concave in lateral view, pubescent. Sides of pronotum alutaceous, with white setae and weak, parallel carinae in upper lateroposterior part, anterolateral rim of pronotum inconspicuous. Mesoscutum 1.2× as broad as long in dorsal view; weak coriaceous, without rugae, pubescent, with piliferous points more visible in the posterior half between notauli. Notaulus complete, deep, straight, converging posteriorly, in most posterior part distance between notauli shorter than distance between notaulus and side of mesoscutum; median mesoscutal line present; parapsidal lines and anterior parallel lines differentiated by alutaceous sculpture. circumscutellar carina absent. Mesoscutellum as long as broad, uniformly rugose; overhanging metanotum, with sparse long setae. Mesoscutellar foveae differentiated, delimited posteriorly by a weak carinae, triangular, deep, with weak alutaceous to smooth bottom, separated by a median carina. Mesopleuron sculptured, coriaceous to weak reticulate with delicate carinae and sparse setae anteriorly, speculum smooth and shining; mesopleural triangle alutaceous, with dense white setae, hiding the surface sculpture; dorsal and lateral axillar areas with delicate parallel longitudinal carinae, glabrous; axillula alutaceous, pubescent; subaxillular bar smooth, glabrous, triangular, posteriorly as high slightly shorter than high of metanotal trough; metapleural sulcus reaching mesopleuron in upper 1/2 of its height; upper part of sulcus distinct; lower part of sulcus delimiting big area with dense long white setae. Metascutellum subrectangular, coriaceous with some weak longitudinal carina, curved ventrally; metanotal trough alutaceous, with dense setae; ventral bar of metanotal trough coriaceous dorsally and smooth ventrally; central propodeal area nearly smooth and glabrous; lateral propodeal carinae parallel by converging toward posterior end; lateral parts of propodeum uniformly alutaceous, densely pubescent. Nucha almost smooth and shining dorsally, with parallel sulci laterally. Legs (Fig. 16e) with hind coxa broad, hind femur strongly broadened, with apical lobe; hind tibia with ventral carina on the ventral part extending to half the length of the tibia; base of tarsal claws with strong tooth.
Figure 14a-d. Andricus perfectum comb. rev., asexual female (a-c). a) Fore wing; b) metasoma in lateral view; c) propodeum; d) galls, deposited in the AMNH.
Forewing hyaline, 1.1× as long as body, pubescent, with cilia on margins; radial cell opened, around 2.6× as long as broad; veins light brown; areolet present. Rs+M vein obsolete heading towards the middle of the basal vein.
Metasoma (Fig. 16e) shorter than head+mesosoma, longer than high. 2nd metasomal tergum occupying 3/4 of metasoma, with lateral patch of white setae, without or with obsolete micropunctures, all subsequent terga uniformly and entirely smooth or with obsolete micropunctures. Prominent part of ventral spine of hypopygium needle-like, around 3.5-4.0× as long as broad, with sparse setae laterally, without apical tuft of setae. Body length: 3.0-4.5 mm (Kinsey, 1937b).
Gall (Fig. 17d). Similar to F. repandae but smaller, diameter up to 12 mm.
Taxonomic summary
Type material examined. Holotype: female, deposited in the AMNH “Pabellon, 20W, Ags 7000, Mex; gall 11.26.31, female Spr. ‘32”, “Q. sacame Kinsey Coll.” (white labels), “F. ocri HoloParatype” (red label), “AMNH_IZC 00267206” (white label with a QR code). Paratypes (4 females): 3 females with same data as holotype (AMNH); 1 female, “Sayula, 13S W, Jal 7700’, Mex, gall 12.21.31, female 2.10.32”, “Q. rhodophleb Kinsey Coll.”, “F. ocri Kinsey coll 37” (white labels), “F. ocri paratype, in type box” (red label), (JP-V col).
Figure 15a-d. Femuros bracteatus comb. nov., asexual female (a-b, d). a) Head in frontal view; b) mesosoma in dorsal view; d) habitus; pictures extracted from the entomology collection website of the Smithsonian Institution [https://collections.nmnh.si.edu/search/ento/], pictures taken by Matthew Buffington; c) galls extracted from Weld, 1944.
Additional materialexamined. Three females, deposited in the AMNH “Sayula, 13S W, Jal 7700’, Mex. ꚛ, gall 12.21.31, female 2.10.32”, “Q. rhodophleb Kinsey Coll.”, “F. ocri Kinsey coll 37”; 1 female “Guadalajara, Jal., 25W, 6000’, Mex. ꚛ, 12.23.31”, “Q. haematophlebKinsey coll.”, “F. ocri Kinsey coll 37” white labels. New material deposited in the JP-V col. (UB): 11 asexual females: 3 females “Santa Fe, Delegación de Cuajimalpa, Ciudad de México, México, (MEX181), Ex Q. laeta, (28.ii.2014) iii.2014: 3 females, D. Cibrián-Tovar leg.; 3 females “Fracción de Bosques de Santa Fe, Delegación de Cuajimalpa, Ciudad de México, México, (MEX336), Ex Q. laeta, (10.xii.2015) 15-24.ii.2016: 3 females, D. Cibrián-Tovar”; 1 female “Nativitas, Texcoco, Estado de México, (MEX400), Ex Quercus sp., (13.i.2015) 19.i.2015: 1 female, A. Equihua-Martinez & E. Estrada-Venegas leg.”; 1 female “Nativitas, Texcoco, Estado de México, (MEX401), Ex Quercus sp., (13.i.2015) 19.i.2015: 1 female, A. Equihua-Martinez & E. Estrada-Venegas leg.”; 3 females “Peñon Blanco, 22°10’12.6” N, 102°31’14.8” W, San José de Grácia, Aguascalientes, México, (MEX645), Ex Q. grisea, (10.i.2021) 15.ii.21-20.iii.21: 3 females, R. Clark leg.”, “Femuros ocri Kinsey, 1937, JP-V det. 2022”.
Biology. The asexual generation is only known to induce galls on Q. arizonica Sargent (= Q. sacame Trel.), Q. grisea Liebm, Q. laeta Liebm., Q. magnoliifolia Née (= Q. haemathophlebia Trel.), and Q. rugosa Née (= Q. rhodophebia Trel.) (section Quercus, subsection Leucomexicanae, white oaks). The galls were collected between November and January; adults emerge between January and March (Kinsey, 1937b).
Figure 16a-e. Femuros ocri, asexual female. a) Head in frontal view; b) head in dorsal view; c) mesosoma and head in lateral view; d) antenna; e) lateral habitus, with detail of the ventral spine of the hypopygium.
Distribution. México: Aguascalientes and Jalisco (Kinsey, 1937b).
Diagnosis. Femuros repandae is most closely related to F. bracteatus and both differ from F. ruidum and F. ocri by the POL which is around 1.5× as long as OOL, OOL 1.5× as long as diameter of lateral ocellus, the height of eye is 2.0× as long as the malar space, and the transfacial distance 1.3× as long as the height of the eye. Femuros repandae differs from F. bracteatus by the mesoscutum with the anterior parallel lines and parapsidal lines darkened, chestnut colored; mesoscutellar foveae divided by a thin and sharp carina, while in F. bracteatus the anterior parallel lines and parapsidal lines are of the same color as the rest of the mesoscutum; and the mesoscutellar foveae are divided by a wide rugose elevated area.
Redescription. Asexual female (Figs. 18a-f, 19a-d, 20a-b). Head, mesosoma, metasoma and legs reddish-brown (with some darker areas in anterior parallel lines and parapsidal lines); antenna light brown, last flagellomere darker; tegula yellowish. Wing veins brown.
Head (Fig. 18a-d) transversally ovate, broadest part below toruli, broader than high and narrower than mesosoma in frontal view, with short dense white setae; 1.3× as broad as high in anterior view and head 2.0× as broad as long in dorsal view. Gena alutaceous to smooth, slightly broadened behind eye, as broad as cross diameter of eye, measuring along transfacial line. Malar space weak alutaceous, without striae radiating from clypeus, malar sulcus absent; eye 2.1× as high as length of malar space. Inner margins of eyes parallel. POL 2.6× as long as OOL, OOL as long as diameter of lateral ocellus and as long as LOL, all ocelli rounded, of same size. Transfacial distance 1.1× as long as height of eye; toruli located above mid height of head, frons shorter than height of lower face, diameter of antennal torulus 2.0× as long as distance between them, distance between torulus and eye slightly longer than diameter of torulus. Lower face almost smooth raised central part below the toruli alutaceous, pubescent. Clypeus impressed, coriaceous, rounded ventrally, medially not incised, anterior tentorial pits distinct; epistomal sulcus and clypeo-pleurostomal line distinctly impressed. Frons uniformly coriaceous, without striae, with few setae, piliferous points visible; interocellar area coriaceous with piliferous points; space between lateral ocellus to compound eye almost smooth and shining. Vertex and occiput coriaceous; postocciput and postgena glabrous, alutaceous-reticulate, with concentric lines around occipital foramen and postgenal bridge; posterior tentorial pit large, elongated, area below impressed; occipital foramen as high as height of postgenal bridge; hypostomal carina emarginate, continuing into postgenal sulci which strongly diverge toward occipital foramen, postgenal bridge anteriorly slightly broader than occipital foramen. Antenna (Fig. 18e) shorter than length of head + mesosoma, with 11 flagellomeres; pedicel 1.5× longer than broad; flagellomeres not broadening until apical end; F1 1.2× as long as F2 and 3.6× as long as pedicel; subsequent flagellomeres progressively shortened; F3 = F4, F5 = F6, F7 to F10 equal in length F11 longer than F10, sometimes F11 with a very inconspicuous suture and thus antenna with 12 flagellomeres. Placodeal sensilla on F5-F11.
Figure 17a-d. Femuros ocri, sexual female (a-c). a) Mesosoma in dorsal view; b) mesoscutellum; c) propodeum; d) galls, deposited in the AMNH.
Mesosoma (Figs. 18f, 19a-d) 1.2× as long as high, concave in lateral view, pubescent. Sides of pronotum alutaceous, with white setae and weak and parallel carinae in upper lateroposterior part, anterolateral rim of pronotum inconspicuous. Mesoscutum 1.2× as broad as long in dorsal view; weak coriaceous, without rugae, pubescent, with piliferous points more visible in the posterior half between notauli. Notaulus complete, deep, straight, converging posteriorly, in most posterior part distance between notauli shorter than distance between notaulus and side of mesoscutum; median mesoscutal line present; parapsidal lines and anterior parallel lines differentiated by alutaceous sculpture. Circumscutellar carina absent. Mesoscutellum as long as broad, uniformly rugose; overhanging metanotum, with sparse long setae. Mesoscutellar foveae differentiated, delimited posteriorly by a weak carinae, triangular, deep, with weak alutaceous to smooth bottom, separated by a median carina. Mesopleuron completely sculptured, coriaceous to weak reticulate with delicate carinae and sparse setae anteriorly, speculum smooth and shining; mesopleural triangle alutaceous, with dense white setae, hiding the surface sculpture; dorsal and lateral axillar areas with delicate parallel longitudinal carinae, glabrous; axillula alutaceous, pubescent; subaxillular bar smooth, glabrous, triangular, posteriorly as high slightly shorter than high of metanotal trough; metapleural sulcus reaching mesopleuron in upper 1/2 of its height; upper part of sulcus distinct; lower part of sulcus delimiting big area with dense long white setae. Metascutellum subrectangular, coriaceous with some weak longitudinal carina, curved ventrally; metanotal trough alutaceous, with dense setae; ventral bar of metanotal trough coriaceous dorsally and smooth ventrally; central propodeal area nearly smooth and glabrous; lateral propodeal carinae parallel by converging toward posterior end; lateral parts of propodeum uniformly alutaceous, densely pubescent. Nucha almost smooth and shining dorsally, with parallel sulci laterally. Legs with hind coxa broad, hind femur strongly broadened, with apical lobe; hind tibia with ventral carina on the ventral part extending to half the length of the tibia; base of tarsal claws with strong tooth.
Figure 18a-f. Femuros repandae, asexual female. a) Head in frontal view; b) head in posterior view; c) head in dorsal view; d) head in lateral view; e) antenna; f) mesosoma in frontal view.
Forewing (Fig. 20a) hyaline, 1.1× as long as body, pubescent, with cilia on margins; radial cell opened, around 2.6× as long as broad; veins light brown; areolet present. Rs+M vein obsolete heading towards the middle of the basal vein.
Metasoma (Fig. 20b) shorter than head+mesosoma, longer than high. 2nd metasomal tergum occupying 3/4 parts of metasoma length, with lateral patch of white setae, without or with obsolete micropunctures; all subsequent terga uniformly and entirely smooth or with obsolete micropunctures. Prominent part of ventral spine of hypopygium needle-like, around 3.5-4.0× as long as broad, with sparse setae laterally, without apical tuft of setae. Body length: 3.2-4.0 mm (Kinsey, 1937a).
Gall (Fig. 20c). Bud gall, globular to spherical, unilocular, sessile, located on main or side twigs, solitary or occasionally in groups of 2 or 3 galls. It is normally spherical (diameter up to 17 mm), distorted by the bracts, deformed leaves, and petioles, which are fused on the surfaces. Green touched with red when young, silvery and purple-brown when mature (similar to the twig bark). In section, a hard wall is observed that surrounds the gall, a spongy-opened and lax tissue and a large spherical central larval chamber thick and hard walled, up to 7 mm in diameter even in small galls; the spongy tissue usually is darker in mature galls.
Figure 19a-d. Femuros repandae, asexual female. a) Mesosoma in lateral view; b) mesosoma in dorsal view; c) propodeum; d) mesoscutellum.
Taxonomic summary
Type material examined. Holotype asexual female deposited in the AMNH: “Mex. (City), 32E; D.F. 10,600; gall 1.3.32, 13 females, 4.24.32 ”, “Q. repanda, Kinsey Coll.”, red handwriting label “Femuros repandae HoloParatype” “AMNH_IZC 00267207” (white label with a QR code). Paratypes: 15 females with same data as holotype, except for 6 females with different emergence date “4.16.32” (13 females deposited in the AMNH, 2 paratype females deposited I the JP-V col., UB). Type material from F. ruidum belonging to F. repandae. Seven females deposited in the AMNH “Mex. ꚛ, Cuernavaca 8N, Mor. 8700; gall 1.7.32, 1 female, 4.10.32”, “Q. texcocana, Kinsey Coll.”, red handwriting label “Femuros ruidum Paratype”.
Additional material. Material deposited in JP-V col. (UB), 15 asexual females: 1 female “San Juan Coajomulco, 19°45’21.0” N, 99°59’06.4” W, Jocotitlan, Estado de México, México, (MEX254), Ex Q. martinezii, (16.x.2013) 10.vi.2014: 1f, D. García-Martiñón leg.”; 2 females “San Juan Coajomulco, 19°45’21.0” N, 99°59’06.4” W, Jocotitlan, Estado de México, México, (MEX255), Ex Q. rugosa, (22.ix.2013) 30.iii.2014: 1f, D. García-Martiñón leg.”; 4 females “San Juan Coajomulco, 19°45’21.0” N, 99°59’06.4” W, Jocotitlan, Estado de México, México, (MEX256), Ex Q. obtusata,(18.i.2014) 28.i-5.iii.2014: 1f, D. García-Martiñón leg.”; 3 females “La Cumbre, 17°10’01” N, 96°35’58” W, Santa Catarina Ixtepeji, Oaxaca, México, (MEX649), Ex Q. rugosa, (02.ii.2020) 10.vi.2020: 3 females, R. Clark leg.”; 3 females “Santa María Yavesía, 17°16’04.8” N, 96°26’06.5” W, Santa María Yavesía, Oaxaca, México, (MEX650), Ex Q. crassifolia, (20.i.2022) 20.iii-20.iv.2022: 3 females, R. Clark leg”; 2 females “La Congoja, 22°09’34.5” N 102°33’05.2” W, San José de Grácia, Aguascalientes, México, (MEX651), Ex Q. grisea, (12.xii.2021) 15.ii-03.iii.2022: 2 females, R. Clark leg.”.
Figure 20a-c. Femuros repandae, asexual female (a-b). a) Fore wing; b) metasoma in lateral view; c) galls, deposited in the AMNH.
Biology. The asexual generation is only known for inducing galls on Q. deserticola Trel. (= texcocana Trel.), Q. grisea Liebm., Q. martinezii C.H.Muller, Q. obtusata Bonpl., Q. repanda Bonpl., Q. rugosa Née (section Quercus, subsection Leucomexicanae, white oaks), and 1 oak species from section Lobatae, Q. crassifolia Bonpl.. The adult galls were collected between September and February; adults emerge between January and April (Kinsey 1937a).
Diagnosis. Femuros ruidum differs from F. repandae by having the POL 2.0× as long as OOL, the OOL is equal to length of lateral ocellus, the malar space 0.4× as long as height of the eye; the transfacial distance subequal to the height of the eye. Differs from F. ocri by the densely pubescent and distinctly punctured mesopleuron; the speculum pubescent and punctured except for a small smooth central area; propodeal carinae bent outwards.
Redescription. Asexual female (Figs. 21a-f, 22a-d, 23a-b). Head, mesosoma, metasoma and legs reddish-brown (without darker areas); antenna light brown, last flagellomere darker; tegula yellowish. Wing veins brown.
Figure 21a-f. Femuros ruidum, asexual female. a) Head in frontal view; b) head in posterior view; c) head in dorsal view; d) mesosoma in frontal view; e) head in lateral view; f) antenna.
Head (Fig. 21a-e) transversally oval, broadest part below toruli, broader than high and narrower than mesosoma in frontal view, with short dense white setae; 1.3× as broad as high in anterior view and head 2.4× as broad as long in dorsal view. Gena alutaceous, slightly broadened behind eye, as broad as cross diameter of eye, measuring along transfacial line. Malar space weak alutaceous to smooth, without striae radiating from clypeus, malar sulcus absent; eye 2.1× as high as length of malar space. Inner margins of eyes parallel. POL 1.6× as long as OOL, OOL 2.6× as long as diameter of lateral ocellus and longer than LOL, all ocelli rounded, of same size. Transfacial distance 1.2× as long as height of eye; toruli located above mid height of head, frons shorter than height of lower face, diameter of antennal torulus 2.0× as long as distance between them, distance between torulus and eye slightly longer than diameter of torulus. Lower face alutaceous to weak coriaceous, raised central part below the toruli coriaceous, pubescent. Clypeus impressed, coriaceous, rounded ventrally, medially not incised, anterior tentorial pits distinct; epistomal sulcus and clypeo-pleurostomal line distinctly impressed. Frons uniformly coriaceous, without striae, with few setae, piliferous points visible; interocellar area coriaceous with piliferous points; space between lateral ocellus to compound eye almost smooth and shining. Vertex and occiput coriaceous. Antenna (Fig. 21f) shorter than length of head + mesosoma, with 11 flagellomeres; pedicel 1.5× longer than broad; flagellomeres from F5 broadening until apical end; F1 1.4× as long as F2 and 4.1× as long as pedicel; subsequent flagellomeres progressively shortened; F11 longer than F10, sometimes F11 with a very inconspicuous suture and thus antenna with 12 flagellomeres. Placodeal sensilla on F5-F11.
Figure 22a-d. Femuros ruidum, asexual female. a) Mesosoma in lateral view; b) mesosoma in dorsal view; c) propodeum; d) mesoscutellum.
Mesosoma (Figs. 21d, 22a-d) 1.2× as long as high, pubescent, concave in lateral view. Sides of pronotum alutaceous, with white setae and inconspicuous carinae in upper lateroposterior part, anterolateral rim of pronotum inconspicuous. Mesoscutum 1.1× as broad as long in dorsal view; weak coriaceous, without rugae, pubescent, with piliferous points more visible in the posterior half between notauli. Notaulus complete, deep, straight, converging posteriorly, in most posterior part distance between notauli shorter than distance between notaulus and side of mesoscutum; median mesoscutal line absent; parapsidal lines and anterior parallel lines differentiated by alutaceous sculpture, almost smooth. Circumscutellar carina absent. Mesoscutellum slightly longer than broad, uniformly rugose; overhanging metanotum, with sparse long setae. Mesoscutellar foveae differentiated, triangular, relatively deep, not defined posteriorly with alutaceous bottom, separated by a median carina. Mesopleuron alutaceous to smooth, pubescent with piliferous points, speculum smooth and shining; mesopleural triangle alutaceous, with dense white setae, hiding the surface sculpture; dorsal and lateral axillar areas with delicate parallel longitudinal carinae, glabrous; axillula alutaceous, pubescent; subaxillular bar smooth, glabrous, triangular, posteriorly as high slightly shorter than high of metanotal trough; metapleural sulcus reaching mesopleuron in upper 1/2 of its height; upper part of sulcus distinct; lower part of sulcus delimiting big area with dense long white setae. Metascutellum subrectangular, coriaceous with some weak longitudinal carina, curved ventrally; metanotal trough alutaceous, with dense setae; ventral bar of metanotal trough coriaceous; central propodeal area nearly alutaceous with some rugae and glabrous; lateral propodeal carinae parallel by converging toward posterior end; lateral parts of propodeum uniformly alutaceous to smooth, densely pubescent. Nucha almost smooth and shining dorsally, with parallel sulci laterally. Legs (Fig. 23b) with hind coxa broad, hind femur strongly broadened, with apical lobe; hind tibia with ventral carina on the ventral part extending to 4/5 the length of the tibia; base of tarsal claws with strong tooth.
Forewing (Fig. 23a) hyaline, 1.1× as long as body, pubescent, with cilia on margins; radial cell opened, around 2.6× as long as broad; veins light brown; areolet present. Rs+M vein obsolete heading towards the middle of the basal vein.
Metasoma (Fig. 23b) shorter than head+mesosoma, slightly longer than high. Metasomal tergite 2 occupying 2/3 parts of the metasoma, with lateral patch of white setae, without micropunctures or micropunctures obsolete, all subsequent tergites uniformly and entirely smooth or with obsolete micropunctures. Prominent part of ventral spine of hypopygium needle-like, around 5.5× as long as broad, with sparse setae laterally, without apical tuft of setae. Body length: 3.0-4.3 mm (Kinsey, 1937a).
Gall (Fig. 23c). Similar to F. repandae but larger, diameter up to 23 mm.
Figure 23a-c. Femuros ruidum, asexual female (a-b). a) Fore wing; b) metasoma in lateral view; c) galls, deposited in the AMNH.
Taxonomic summary
Type material of F. ruidum. Holotype asexual female: “Mex. ꚛ, Cuernavaca 8N, Mor. 8700; gall 1.7.32, 8 females, 3.5.32”, “Q. texcocana, Kinsey Coll.”, red handwriting label “Femuros ruidum HoloParatype” (deposited in AMNH: AMNH_IZC 00267208). Paratypes: 3 females and 3 galls “Mex. ꚛ, Cuernavaca 8N, Mor. 8700; gall 1.7.32, 1 female, 4.10.32”, “Q. texcocana, Kinsey Coll.”, red handwriting label “Femuros ruidum Paratype” (1 female in AMNH; 1 female in JP-V col; 1 female and galls in HMNH); 3 females “Mex (City) 12W, D.F. 8500’, Mex. ꚛ, gall 1.13.32, 10 females, 4.10.32”, “Q. texcocana, Kinsey Coll.”, “Femuros ruidum Kinsey coll.” (1 female in JP-V col; 2 females in HMNH). Type material of F. repandae belonging to F. ruidum. Paratypes: 1 female “Mex. (City), 32E; D.F. 10600; gall 1.3.32, 9 females, 4.16.32”, “Q. repanda, Kinsey Coll.”, red handwriting label “Femuros repandae Paratype” (deposited in JP-V col).
Figure 24a-e. Lateral habitus of holotypes. a) Andricus calvoi sp. nov.; b) Andricus geniale comb. rev.; c) Andricus integrum comb. rev.; d) Andricus lusum comb. rev.; e) Andricus perfectum comb. rev.
Additional material. Seven asexual females deposited in the JP-V col. (UB) with the label “Universidad de la Sierra Juárez, 17°18’54” N, 96°28’58” W, Ixtlán de Juárez, Oaxaca, México, (MEX646-648), Ex Q. glaucoides, R. Clark leg.” and different collection and emergence dates: 1 female “(10.iii.2018) 27.iv.2018”; 3 females “(08.xii.2020) 10.i- 20.ii.2021”; and 3 females “(10.xii.2018) 10.i.2019”.
Biology. The asexual generation is only known to induce galls on Q. deserticola (= texcocana Trell.) and Q. rugosa Née (= conglomerata Trel. = rhodophlebia Trel.), according to Kinsey (1937a); and Q. glaucoides Mart. & Gal. (section Quercus, subsection Leucomexicanae, white oaks) in this study. The galls were collected between December and March, and the adults emerge between January and April.
Distribution. México: México City, Morelos, and Oaxaca (Kinsey, 1937a).
Figure 25a-d. Lateral habitus of holotypes. a) Femuros bracteatus comb. nov.; b) Femuros ocri; c) Femuros repandae; d) Femuros ruidum.
Discussion
After carefully studying the type materials of the Femuros species described by Kinsey (1937a, b), we have observed distinct morphologies. The species F. repandae, F. ruidum, and F. ocri have a smooth lower face of the head, while the rest of the species (A. geniale, A. integrum, A. lusum, and A. perfectum) have a sculptured lower face with carinae radiating from the clypeus. This latter group of species has been provisionally transferred to the Andricus genus. Andricus is a polyphyletic genus, and although several species have recently been transferred to other genera (such as Striatoandricus, Disholandricus, Druon, Dros, Feron, Protobalandricus, and Trichoteras), there remains a significant number of species groups within Andricus that require further assessment. The morphological characteristics of the species currently included in Andricus display excessive variation, making it difficult to determine reliable diagnostic characters. The species transferred into Andricus in this study exhibit the radiating carinae from the clypeus, which is one of the few characters broadly used to define Andricus.
The Cynipini genera are known for exhibiting a high level of homoplasy (Liljeblad et al., 2008), making it challenging to identify exclusive diagnostic characters for most genera. Recognition of these genera relies on a combination of characters rather than any single defining feature, further complicating the task of generic delimitation. Although, the morphological distinctiveness of Femuros compared to its closest genera is evident (see diagnosis). The etymology of Femuros refers to the broadening of the hind femur on the ventral margin near the distal end, although this feature is not exclusive to Femuros (see diagnosis). Additionally, the presence of an internal carina on the hind tibia, previously considered exclusive to Femuros, loses its exclusivity after transferring some species to the genus Andricus. This character is also found in the unrelated genus Odontocynips. Regardless of its distinctiveness, little is known about the relationships between Femuros and the rest of the Cynipini genera. It is suspected to be closely related to Andricus, probably to the species transferred in this study. If that is the case, the distinctiveness of Femuros should be assessed with the support of molecular data and would also be dependent on the taxonomy of Andricus and how this macro genus is assessed.
The galls of Femuros are now exclusively round bud galls with small bracts partially covering their surface with radiating lamellae connecting the larval chamber and the lignified outer shell. There is a certain degree of variation in terms of the gall size between the species; F. ruidum usually induces the biggest galls (up to 23 mm in diameter), but the size distribution overlaps with the galls of F. repandae and F. ocri. Hence, the galls of Femuros are almost impossible to tell apart without the confirmation of the adult wasp.
The galls of the studied Andricus speciesare mostly barrel-shaped or cup-shaped bud galls, with an apical depression, forming a central cavity that can be widely open to the exterior or almost closed, with thick lignified parenchyma. The apical walls of the outer shell of the gall can be opened forming a distinct cup or cover the apical part of the central cavity. The larval chamber is closer to the base of the gall.
The host plant associated with Femuros and the newly transferred Andricus are mainly oak species from section Quercus, subsection Leucomexicanae, except for a single record of F. repandae galling on Q. crassifolia (section Lobatae). Species galling on 2 different sections are extremely rare and in many cases such records have been corrected. This last record on Q. crassfolia may be attributed to an accidental host swap since F. repandae galls mainly in section Quercus. Further samplings should confirm this record and the occurrence of it if ever repeated.
Acknowledgments
VCP was supported by the University of Barcelona, grant number APIF 2018-2019. We thank all the staff and colleagues of the AMNH during VCP’s visit for their help and support: James Carpenter, Christine Lebeau, Melody Doering, Morgan H Chase, Marcel Hermes, Nayeli Gutiérrez, and Royce Cumming. We are also thankful to Matt Buffington (Smithosnian Institution, USA) and Mar Ferrer-Suay for their pictures of the type materials. This research was funded by “PID2021-128146NB-I00/MCIN/AEI/10.13039/501100011033/” and “FEDER una manera de hacer Europa”.
References
Cuesta-Porta, V., Cooke-McEwen, C., Melika, G., Romero-Rangel, S., Equihua-Martínez, A., Estrada-Venegas, E. G. et al. (2024). Review of the Mexican species of Dishol- caspis Dalla Torre & Kieffer with the description of eleven new species. Zootaxa, 5498, 1–100. https://doi.org/10.11646/zootaxa.5498.1.1
Cuesta-Porta, V., Melika, G., Nicholls, J. A., Stone, G. N., & Pujade-Villar, J. (2022). Re-establishment of the Nearctic oak cynipid gall wasp genus Druon Kinsey, 1937 (Hymenoptera: Cynipidae: Cynipini), with description of 5 new species. Zootaxa, 5132, 1–92. https://doi.org/10.11646/zootaxa.5132.1.1
Cuesta-Porta, V., Melika, G., Nicholls, J. A., Stone, G. N., & Pujade-Villar, J. (2023). Re-establishment of the Nearctic oak cynipid gall wasp genus Feron Kinsey, 1937 (Hymenoptera: Cynipidae: Cynipini), including the description of six new species. Zootaxa, 5366, 1–174. https://doi.org/10.11646/zootaxa.5366.1
Denk, T., Grimm, G. W., Manos, P. S., Deng, M., & Hipp, A. L. (2017). An updated infrageneric classification of the oaks: review of previous taxonomic schemes and synthesis of evolutionary patterns. In E. Gil-Pelegrín, J. Peguero-Pina, & D. Sancho-Knapik (Eds.), Oaks physiological ecology. Exploring the functional diversity of genus Quercus L. (pp. 13–38). Cham Switzerland: Tree Physiology. Springer Nature.
Harris, R. (1979). A glossary of surface sculpturing. Occasional Papers in Entomology, 28, 1–31.
Kinsey, A. C. (1937a). New Mexican gall wasps (Hymenoptera, Cynipidae). Revista de Entomologia, 71, 39–79.
Kinsey, A. C. (1937b). New Mexican gall wasps (Hymenoptera, Cynipidae) II. Revista de Entomologia, 74, 428–471.
Liljeblad, J., Ronquist, F., Nieves-Aldrey, J. L., Fontal-Cazalla, F., Ros-Farre, P., Gaitros, D. et al. (2008). A fully web-illustrated morphological phylogenetic study of relationships among oak gall wasps and their closest relatives (Hymenoptera: Cynipidae). Zootaxa, 1796, 1–73. https://doi.org/10.11646/zootaxa.1796.1.1
Melika, G. (2006). Gall wasps of Ukraine. Vols. 1 & 2. Vestnik Zoologii, 21 (Suppl.), 1–644.
Melika, G., & Abrahamson, W. (2002). Review of the world genera of oak cynipid wasps (Hymenoptera: Cynipidae, Cynipini). In G. Melika, & C. Thuróczy (Eds.), Parasitic wasps: evolution, systematics, biodiversity and biological control (pp. 150–190). Budapest: Agroinform.
Melika, G., Nicholls, J. A., Abrahamson, W. G., Buss, E. A., & Stone, G. N. (2021). New species of Nearctic oak gall wasps (Hymenoptera: Cynipidae, Cynipini). Zootaxa, 5084, 1–131. https://doi.org/10.11646/zootaxa.5084.1.1
Melika, G., Pujade-Villar, J., Abe, Y., Tang, C., Nicholls, J., Wachi, N. et al. (2010). Palaearctic oak gallwasps galling oaks (Quercus) in the section Cerris: re-appraisal of generic limits, with descriptions of new genera and species (Hymenoptera: Cynipidae: Cynipini). Zootaxa, 2470, 1–79. https://doi.org/10.11646/zootaxa.2470.1.1
Menitsky, L. L. (1984). Oaks of Asia. St. Petersburg: Leningosizdat Sciences.
Nixon, K. C. (1993). Infrageneric classification of Quercus (Fagaceae) and typification of sectional names. Annals of Forest Science, 50 (Suppl.), 25s–34s. https://doi.org/10.1051/forest:19930701
Pujade-Villar, J., & Ferrer-Suay, M. (2015). Adjudicació genérica d’espècies mexicanes d’ubicació dubtosa descrites per Kinsey i comentaris sobre la fauna mexicana (Hymenop- tera: Cynipidae: Cynipini). Butlletí de la Institució Catalana d’Història Natural, 79, 7–14.
Pujade-Villar, J., Lobato-Vila, I., & Ferrer-Suay, M. (2017). Restablecimiento del género Dros Kinsey (Hymenoptera: Cynipidae: Cynipini) como género válido para especies americanas. Entomología Mexicana, 4, 752–758.
Pujade-Villar, J., & Melika, G. (2014). Re-establishment of Erythres Kinsey, 1937 as a valid genus of gallwasps from Mexico (Hymenoptera: Cynipidae: Cynipini). Dugesiana, 21, 155–160. https://doi.org/10.32870/dugesiana.v21i2.4155
Ronquist, F., & Nordlander, G. (1989). Skeletal morphology of an archaic cynipoid, Ibalia rufipes (Hymenoptera: Ibaliidae). Entomologica Scandinavica. Supplementum, 33, 1–60.
Weld, L. H. (1952). Cynipoidea (Hym.) 1905-1950 being a Supplement lo the Dalla Torre and Kieffer monograph, the Cynipidae in Das Tierreich, Leifening 24, 1910 and bringing the systematic literature of the world up to date, including keys to families and subfamilies and list of new generic, specific and variety names. Ann. Arbor, Michigan: Privately printed.
José Ángel Zamarripa-Fernández a, b, *, Ismael Hinojosa-Díaz c, Moisés Armando Luis-Martínez d, Ricardo Ayala a
a Universidad Nacional Autónoma de México, Instituto de Biología, Estación de Biología Chamela (Sede Colima), Km 59, Carr. Fed. 200, Melaque – Pto. Vallarta, La Huerta, 48895 Chamela, Jalisco, Mexico
b Universidad Nacional Autónoma de México, Posgrado en Ciencias Biológicas, Edificio D, 1°Piso, Circuito de Posgrados, Ciudad Universitaria, Coyoacán, 04510 Ciudad de México, Mexico
c Universidad Nacional Autónoma de México, Instituto de Biología, Departamento de Zoología, 3er. Circuito Exterior s/n, Ciudad Universitaria, Coyoacán, 04510 Ciudad de México, Mexico
d Universidad Nacional Autónoma de México, Facultad de Ciencias, Departamento de Biología Evolutiva, Museo de Zoología “Alonso L. Herrera”, Circuito Exterior s/n, Ciudad Universitaria, Coyoacán, 04510 Ciudad de México, Mexico
A taxonomic revision of the cleptoparasitic bee genus Mesoplia Lepeletier, 1841 from Mexico and Central America is presented. We recognize 4 new species, resulting in a total of 10 species for the study area: Mesoplia (Mesoplia) insignis (Smith, 1879), M. (M.) sapphirina Melo & Rocha-Filho, 2011, M. (M.) regalis (Smith, 1854), M. (M.) dugesi (Cockerell, 1917), M. (M.) rufipes (Perty, 1933), M. (M.) veracruzana sp. nov., M. (M.) oaxacana sp. nov., M. (M.) tica sp. nov., M.(Eumelissa) ornata (Spinola, 1841)and M.(E.) carmelitae sp. nov. We propose the following synonymies: M. imperatrix (Friese, 1913) = M. (M.) insignis, and M. guatemalensis (Cockerell, 1912) = M. (M.) rufipes. We describe the previously unknown female of M. (M.) dugesi and provide diagnoses for both sexes based on the holotype. An identification key for the species, illustrations, distributional records (available as supplementary material), and lists of hosts and floral associations are provided.
Revisión taxonómica y distribución de las abejas cleptoparásitas del género Mesoplia (Apidae: Ericrocidini) de México y Centroamérica
Resumen
Se presenta una revisión taxonómica del género de abejas cleptoparásitas Mesoplia Lepeletier de México y Centroamérica. Se reconocen 4 especies nuevas, dando un total de 10 especies para el área en estudio: Mesoplia (Mesoplia) insignis (Smith, 1879), M. (M.) sapphirina Melo & Rocha-Filho, 2011, M. (M.) regalis (Smith, 1854), M. (M.) dugesi (Cockerell, 1917), M. (M.) rufipes (Perty, 1933), M. (M.) veracruzana sp. nov., M. (M.) oaxacana sp. nov., M. (M.) tica sp. nov., M. (Eumelissa) ornata (Spinola, 1841) y M. (E.) carmelitae sp. nov. Se encontraron las siguientes sinonimias: M. imperatrix (Friese, 1913) = M. (M.) insignis y M. guatemalensis (Cockerell, 1912) = M. (M.) rufipes. Se describe la hembra de M. (M.) dugesi, previamente desconocida, y se proporcionan las diagnosis para ambos sexos basados en el tipo. Se aportan una clave de identificación de las especies, ilustraciones, registros de distribución (disponible como material complementario), una lista de huéspedes y asociaciones florales.
The tribe Ericrocidini is composed mainly of cleptoparasitic bees that have Neotropical affinity, with the exception of the genus Ericrocis Cresson, 1887, which is Nearctic (Martins et al., 2018). The greatest diversity occurs in the Amazon region (Silveira et al., 2002; Snelling & Brooks, 1985). Their known hosts are species of the tribe Centridini (Rocha-Filho et al., 2009). The most easily recognizable morphological character of the tribe is the large, bifurcate or multidentate apex of the middle tibial spur (Michener, 2007).
The genus Mesoplia Lepeletier, 1841 is the richest in the tribe with 19 described species (Table 1), although it is estimated that it could include more species (Rozen et al., 2011). It is distributed from northern Mexico (Sinaloa and Tamaulipas) to Argentina (Snelling & Brooks, 1985). Mesoplia is recognized by the following characters: internal orbits more or less parallel; presence of 2 tubercles on the scutellum of variable development; meso and metabasitarsus without lateral patches of short, flattened setae; tiny metallic scales blue or green, mainly in the dorsal area of the metasoma, frequently also with patches of yellowish or whitish pubescence; S5 of male evidently emarginated and hidden under S4 (Genaro & Breto, 2022; Michener, 2007; Snelling & Brooks, 1985; Vivallo, 2010).
The subgeneric classification was proposed by Snelling and Brooks (1985). They proposed 2 subgenera based on morphological characters, Mesoplia and Eumelissa. Males of the former have posterior tibial spurs that do not extend beyond the basal third of the basitarsus, the posterior tibia has an internal distal patch of setae and S5 evidently emarginate and hidden under S4. Females of the same subgenus have a broad pygidial plate, which occupies the exposed dorsal surface of T6, covered with setae or scales and dorsal surface of posterior coxa angulate or carinate at the junction with the lateral surfaces. In contrast, males of the subgenus Eumelissa have long posterior tibial spurs reaching to or beyond middle of basitarsus. Females of the same subgenus have narrow pygidial plate, does not completely occupy the exposed dorsal surface of T6, without scales or setae and dorsal surface of posterior coxa abruptly rounded at the junction with lateral surfaces (Michener, 2007). Furthermore, Moure (1960a, b) recognizes 2 groups: bifrons and azurea, both of which are part of the subgenus Mesoplia s. str.Males of the bifrons grouphave conspicuous hind tibia setal brush, 2 spurs on the posterior tibia, ventral basal surface of posterior femur without a robust posterior projection. Females have pronotum without a carina extending laterally from the pronotal collar to the pronotal lobe.On the other hand, males of the azurea grouphave inconspicuous hind tibia setal brush, 1 spur on the posterior tibia and ventral basal surface of posterior femur with a robust posterior projection. Females of this group have pronotum with a carina extending laterally from the pronotal collar to the pronotal lobe.
The known hosts include several species of Centridini (Rocha-Filho et al., 2009). For Mesoplia, as in the rest of the tribe, the biology of most species is practically unknown and their geographical distribution uncertain, since some of the information available in the literature is based on mistaken identifications (Vivallo, 2014).
In this work we update the knowledge of the species of Mesoplia forMexico and Central America, providing diagnoses, descriptions, distributional data, identification keys, and a summary of floral and host records. We describe 4 new species and establish 2 new synonyms.
Materials and methods
We reviewed 363 specimens from the following collections where studied specimens are deposited (names of curators and/or collection managers are in parentheses): EBCh, Estación de Biología Chamela, IBUNAM, Jalisco, Mexico (R. Ayala Barajas); CNIN, Colección Nacional de Insectos, Instituto de Biología, UNAM, Mexico City (I.A. Hinojosa Díaz); MZFC, Museo de Zoología “Alfonso L. Herrera”, Facultad de Ciencias, UNAM, Mexico City (M.A. Luis Martínez); CZUG, Centro de Estudios en Zoología, CUCBA, Universidad de Guadalajara, UDG, Jalisco, Mexico (José Luis Navarrete, Hugo Fierros); HFL, Colección Particular de Hugo Eduardo Fierros López, Jalisco, Mexico (Hugo Fierros); IEXA, Colección Entomológica del Instituto de Ecología, A.C., INECOL, Veracruz, Mexico (Jorge E. Valenzuela, Viridiana Vega); ECOAB, Colección de Abejas de El Colegio de la Frontera Sur, Chiapas, Mexico (Rémy Vandame, Jorge A. Mérida Rivas, Philippe Sagot); CER-UADY, Colección Regional Entomológica de la Universidad Autónoma de Yucatán, UADY, Yucatán, Mexico, (Virginia Meléndez Ramírez, María José López Gómez); SEMC, Snow Entomological Collection, Division of Entomology, University of Kansas Natural History Museum, KU, Lawrence, Kansas, USA (Zachary Falin, Michael Engel, Rachel Osborn); MNCR, Museo Nacional de Costa Rica, Heredia, Costa Rica (Maricelle Méndez, Marcela Sánchez); MZUCR, Museo de Zoología, Universidad de Costa Rica, San José, Costa Rica (Mauricio Fernández, Paul Hanson); CINAT, Centro de Investigaciones Apícolas Tropicales, Universidad Nacional de Costa Rica, UNA, Heredia, Costa Rica (Mario Gallardo, Eduardo Herrera).
Table 1
Recognized species of Mesoplia Lepeletier, 1841. * New synonyms.
Dominica, Guadeloupe, Martinique and Saint Vincent
Mesoplia chalybaea (Friese, 1912)
Both
Brazil
Mesoplia dugesi (Cockerell, 1917)
Both
Mexico
Mesoplia guatemalensis (Cockerell, 1912)*
–
–
Mesoplia oaxacana sp. nov.
Female
Mexico
Mesoplia rufipes (Perty, 1833)
Both
Mexico to South America
Eumelissa
Mesoplia alboguttata (Ducke, 1905)
Both
Bolivia and Brazil
Mesoplia carmelitae sp. nov.
Both
México and Costa Rica
Mesoplia decorata (Smith, 1854)
Both
Brazil, Ecuador, Guatemala, Panama and Venezuela
Mesoplia friesei (Ducke, 1902)
Both
Brazil, Colombia and Paraguay
Mesoplia guedesii (Ducke, 1902)
Female
Brazil
Mesoplia ornata (Spinola, 1841)
Both
Mexico to French Guiana
Type specimens of M. sapphirina were studied. For the rest of the species high-resolution images of holotypes were available, which allowed verification of the species that were delimited and that had been previously described: for M. insignis (both sexes)and M. regalis on the website of the Natural History Museum (London, England); the holotype of M. dugesi on the website of the National Museum of Natural History, Smithsonian Institution (Washington D.C., USA); for M. imperatrix images of holotype from the Museum für Naturkunde (Berlin, Germany) were provided by Stefanie Krause; and the holotype images of M. guatemalensis from the American Museum of Natural History (New York, USA) were provided by Corey Smith. Delimitation of other species followed original descriptions and specimens previously identified by taxonomists who worked with the genus and compared their specimens with types deposited in the mentioned collections. Due to the morphological characteristics of the species of this genus, it is possible to be certain of their identification.
Morphological terminology follows Michener (2007); for integument sculpture we follow Harris (1979). Metasomal terga and sterna are designated as T and S respectively, numbered from anterior to posterior. We used F for antennal flagellum, with F1 following the pedicel. Male genitalia were dissected along with S7 and S8. The subgeneric classification follows Snelling and Brooks (1985) and the classification of groups follows Moure (1960a). All measurements are given in millimeters (mm). Images for most of the structures and habitus were taken with a Leica MC 170 HD camera adapted to a Leica M205C stereoscopic microscope except some of the habitus photographs were taken with a Cannon EOS 70D DSLR camera and a Canon EF-S 60 mm macro lens. For Mesoplia tica sp. nov., images were taken using an Olympus DP74 camera attached to an Olympus SZX16 stereoscopic microscope. Images were processed with Adobe Photoshop CS5®, Photopea.com, HeliconSoft and Leica Application Suite. The scale bar indicates 0.5 mm in the genitalia images. Distribution maps were produced from specimen locality data (available as supplementary material) using QGis software and the base map of Esri Physical and were prepared by the first author. Geospatial coordinates are presented in DMS. Plant associations were based on the information present in the specimen label. For the cleptoparasite-host associations we reviewed and compiled the published information categorized following Rocha-Filho et al. (2009).
Description
We recognize 10 species of Mesoplia for Mesoamerica; 4 are new to science herein described and illustrated. In addition, 2 synonyms are recognized, Mesoplia imperatrix (Friese, 1913) = M. insignis (Smith, 1854) and M. guatemalensis (Cockerell, 1912) = M. rufipes (Perty, 1833).
Genus Mesoplia Lepeletier, 1841
Mesoplia Lepeletier, 1841: 457. Type species: Mesocheira azurea Lepeletier & Serville, 1825: Museo Regionale di Scienze Naturale, Torino, Italy (♀♂), monobasic.
Melissa Smith, 1854: 279. Type species: Mesocheira azurea Lepeletier & Serville, 1825, designated by Sandhouse, 1943: 570.
Diagnosis. Maxillary palps elongated, with 3 or 4 segments; internal orbits more or less parallel; scutellum bituberculate (in some species not very evident); medial basitarsus with a flattened distal process on the posterior margin, more evident in females (Figs. 1, 2); dorsal region of the metasoma covered with tiny scales that give it a metallic blue or green color, regularly with small patches of yellow or white pubescence; S5 of the male evidently emarginate and hidden under S4; body length from 10 to 25 mm.
Subgenus Mesoplia Lepeletier, 1841
Diagnosis. Male: distal inner surface of the posterior tibia with a setal brush, not very evident in some species (Fig. 3A-E); hind tibial spurs not reaching beyond basal third of basitarsus, some species with only 1 spur present. Female: pygidial plate broad, occupying the exposed dorsal surface of T6; pygidial plate covered with scales or setae (Fig. 4A-G); dorsal surface of posterior coxa angulate or carinate at the junction with the lateral surfaces.
M. bifrons group(sensu Moure, 1960a, b)
Diagnosis. Male: hind tibia with setal brush conspicuous (Fig. 3A-C) and 2 spurs; posterior femur with ventral basal margin without a robust posterior projection; posterior basitarsus with inner surface without a longitudinal carina. Female: without a carina between pronotal collar and the pronotal lobe (Fig. 5A).
Mesoplia (Mesoplia) insignis (Smith, 1879)
(Figs. 3A, 4A, 5A, 6, 7A, 8-10, 35)
Melissa insignis Smith, 1879: 108. Syntypes: British Museum Natural History, London, England (♀♂). Type locality: Mexico, Veracruz, Orizaba.
Melissa imperialis Friese, 1912: 205. Holotype: Museum für Naturkunde, Berlin, Germany (♀). Type locality: Mexico, Morelos. New junior synonym.
Melissa imperatrix Friese, 1913: 89. nom. nov. for Melissa imperialis Friese, 1912. New junior synonym.
Melissa imperatrix Friese, 1921: 266. nom. nov. for Melissa imperialis Friese, 1912. New junior synonym.
Diagnosis. Male: metallic greenish body, with pubescence on head and mesosoma mostly bright yellow; integument of antenna, pronotal lobe, tegula and legs black; scutellar tubercles conical, inconspicuous due to dense pubescence (Fig. 6D), with perceptible cleft between them; robust forked medial tibial spur, with dark integument, wide anterior projection and with between 2 and 4 internal teeth; pubescence of the terga mainly whitish with a spot of bright yellow pubescence on both lateral margins of T1, at least also present in T2 (Fig. 6A); surface of T7 without scales but with black pubescence; apex of T7 slightly forked, both apices truncated and bare at tip (Fig. 7A); S4 shallowly emarginate, with several rows of compound pubescence on the apical margin, dark in color in the center and becoming light at the laterally; digitiform lobe of the gonostylus triangular and broad, projecting upwards (Fig. 8C, D).
Figure 1. Middle leg basitarsus, male: A, Mesoplia (M.) sapphirina. B, Mesoplia (M.) dugesi. C, Mesoplia (M.) rufipes. D, Mesoplia (E.) carmelitae sp. nov. E, Mesoplia (E.) ornata.
Female: body dark metallic blue and black pubescence, but with some small patches of whitish pubescence behind the antennal area, preoccipital area, lateral margins of the scutum to the level of tegula, and lateral margins of S2-S4 (Fig. 9A-C); black integument on antenna pronotal lobe, tegula and legs; scape with dark metallic blue; integument of scutum and tegula with scales that give a dark metallic blue appearance; scutellar tubercles mamilliform; tergal pubescence mainly dark; ventral surface of mesosoma and metasoma with metallic blue scales; middle tibial spur robust with black integument, forked, anterior projection with 1 to 4 internal teeth; pygidial plate with a broad and quadrangular apex, without scales on the surface, with blackish pubescence that does not reach the apex, black integument (Fig. 4A).
Variation. Some females from Morelos with white setae on lateral edges of the labrum and posterolateral edges of the propodeum. Pubescence and the presence of metallic scales in some body areas of males seem to be relatively variable, labral setae can be yellow, whitish or dark; the clypeus may have yellow setae or metallic blue scales, as well as the dorsal surface of the scutellar tubercles.
Material examined. Mexico: Jalisco: 22.5 km al NE de Magdalena, 20°58’46.17” N, 104°6’52.33” W, 1,066.8 m, 19-VII-1953, Univ. of Kans. Mex. Exped., 1♂ (SEMC 1254912); Tala, Bosque Escuela, 20°35’44.9988” N, 103°38’15” W, 1,499 m, 7-IX-2012, H. E. Fierros-López, 1♀ (CZUG); ANP Bosque la Primavera, S. Nopales, 20°36’3.4” N, 103°38’20.4” W, 1,500 m, 26-IX-2013, O. Serrano-Pineda, 1♀ (CZUG); Tequila, Volcán de Tequila, 20°51’52” N, 103°50’36” W, 1,300 m, 29-VII-1995, H. E. Fierros-López, 1♀ (CZUG 580); 20°49’36” N, 103°50’45” W, 1,300 m, 29-VIII-1995, H. E. Fierros-López, 1♀ 1♂ (HFL), 20°51’36” N, 103°51’0” W, 1,370 m, 12-VI-2022, K. Sanchez, 1♂ (ECOAB 87968); Tlajomulco de Zúñiga, Fraccionamiento Nueva Galicia coto Valencia, 20°34’39” N, 103°26’40” W, 1,618 m, 24-IX-2022, J. A. Zamarripa-Fernández, C. Sánchez-Bastidas e I. I. Alfaro-Ríos, 5♀ (CZUG); Zapopan, Barranca la Experiencia, 20°57’42.804” N, 103°24’5.292” W, 1,300 m, 14-IX-1996, G. Mercado, 1♀ (CZUG 1112), 1♂ (CZUG 1113), 22-VIII-2009, G. Mercado, 1♀ (CZUG EXP0440), 1♂ (CZUG EXP0446), 5-IX-2009, G. Mercado, 1♂ (CZUG EXP0445), 1,350 m, 29-VII-2009, G. Mercado, 1♂ (HFL), 29-VII-2009, G. Mercado, 1♂ (CZUG); Parque ecológico Huilotán, 20°57’42.804” N, 103°24’5.292” W, 1,121 m, 7-IX-2023, J. A. Zamarripa-Fernández, C. Morales & J. M. Sandoval, 3♀ 4♂ (CZUG). Morelos: Jojutla de Juárez, Cerro del Higuerón, 18°34’0.3876” N, 99°9’55.2816” W, 1,060 m, 26-VII-1981, C. Deloya, 1♀ (MZFC 28612); Yautepec de Zaragoza, 18°50’55.6116” N, 99°4’42.0888” W, 1,249 m, 15-XI-1980, J. M. Labougle, 4♀ (CNIN 3042-3045) 2♂ (CNIN 3046; 3047). Oaxaca: Santo Domingo Tehuantepec, 17 km W of Tehuantepec, 16°21’59.328” N, 95°22’59.088” W, 8-IX-1965, D. Janzen, 2♂ (SEMC 1254910; 1254911).
Distribution. This species is endemic to Mexico and distributed from the center of country to the north of the Isthmus of Tehuantepec (Fig. 10) between 1,060-1,616 m of altitude, a distribution that corresponds to the Trans-Mexican Volcanic Belt and Sierra Madre del Sur.
Figure 3. Hind leg, male: A, Mesoplia (M.) insignis. B, Mesoplia (M.) tica sp. nov. C, Mesoplia (M.) sapphirina. D, Mesoplia (M.) dugesi. E, Mesoplia (M.) rufipes. F, Mesoplia (E.) carmelitae sp. nov. G. Mesoplia (E.) ornata.
Taxonomic comments. This species is morphologically similar to Mesoplia tica sp. nov. Males differ in the apex of T7 slightly forked with both apices truncated and bare at tip (Fig. 7A), and the pubescence of the mesosoma almost entirely bright yellow (Fig. 6). The female pygidial plate has a broadly quadrangular apex, with blackish pubescence on the surface (Fig. 4A), and the scutellar tubercles are less projected upward than in Mesoplia tica sp. nov.
Diagnosis. Male: metallic greenish body, with bright yellow pubescence on the clypeus, anterior surface of the mesepisternum, pronotal lobe, anterior region of the scutellar disc, posterior region of the scutellum, scutellum and lateral areas of the propodeum (Fig. 11); tegula with black setae on inner anterior and posterior edge; scutellar tubercles conical and strongly projecting upwards, with a perceptible cleft between them; robust forked medial tibial spur, with blackish integument, wide anterior projection and with between 3 and 4 internal teeth; tergal pubescence mainly whitish, with a spot of bright yellowpubescence on both lateral margins of T1 (Fig. 11B); tergal scales metallic greenish-copper; apex of T7 noticeably forked, both apices rounded (Fig. 7B); dorsal lobe of gonostyle triangular and broad projected upwards (Fig. 12C, D).
Female: body dark metallic and blue pubescence, with scales blue-greenish on head and mesosoma, and metallic blue to the metasoma; with patches of whitish pubescence on labrum, anterior lateral edges of the clypeus, behind the antennal insertion, preoccipital region, upper region of the gena, lateral surface of the mesepisternum, lateral margins of the scutum at the level of the tegula, posterior region of the scutellum, lateral apex of T5 and lateral apices of S2-S4 (Fig. 13); black integument on antenna, pronotal lobe, tegula and legs; scape with blue-green scales; tegula with metallic blue scales; scutellar tubercles subconical, strongly projecting upwards (Figs. 13A, D, 35C); middle tibial spur robust with black integument, forked, anterior projection with 2 to 3 internal teeth; pygidial plate with apex more or less rounded, with scales on the surface that do not reach the apex, and black integument (Fig. 4B).
Figure 6. Mesoplia (M.) insignis, male. A, Lateral habitus; B, dorsal habitus; C, frontal habitus; D, posterior view of the scutellar tubercles.
Description. Holotype: male. Body length 17.5 mm, forewing length 13.4 mm, head length 4.2 mm, intertegular distance 4.3 mm, T2 length 2.5 mm. Head: mandible with an internal tooth. Labrum subrectangular, concave surface, with a very evident preapical margin. Ocelli aligned to the upper margin of the eyes, protruding above the head in lateral view. Mesosoma: convex scutum in lateral view. Scutellar tubercles conical, strongly projecting upwards, cleft between them evident. Vertical metanotum and propodeum. Middle tibial spine rounded and short. Medial tibial spur robust forked, anteriorly projecting with 3 to 4 internal teeth. Middle basitarsus with posterior margin smooth and with short and straight flattened distal process. Hind tibia with 2 short spurs at the inner apex. Metasoma: T7 with a flattened surface, noticeably forked apex, with a moderately deep central cleft, medium distance between the apices, both ends rounded. Color: in general, with black integument. Head: labrum, rostrum, scape, pedicel and f1 black, remainder of flagellum greyish. Mandible with apical third yellowish brown, the rest black. Mesosoma: pronotal lobe, tegula, wing veins, legs, middle tibial spur, black. With smoked wings. Forewings without dark spots evident. Metasoma: with black sternum. Surface sculpture: head, labrum with most of surface rugose, by basal edge polished. Mesosoma: tegula with stippling. The propodeum strigulate. Pubescence: black and bright yellow. Head: labrum central surface with white plumose setae and scattered simple black setae, lower edge with a pair of long black tufts, lateral edges with simple black setae, upper edge bare. Clypeus densely covered with bright yellow plumose setae. Supraclypeal area, forehead close to the lower edge of the ocelli and vertex with metallic bluish-green scales. Supraclypeal area with black setae. With a spot of bright yellow setae in the upper part of the paraocular area. Preoccipital region and upper gena region with bright yellow setae. Lower region of the gena with black setae. Mesosoma: anterior surface of the mesepisternum, pronotal lobe, region anterior to the central disc of the scutum, posterior region of the scutellum, metascutum and lateral areas of the propodeum covered almost exclusively by bright yellow setae. The rest covered by black setae. Central disc of the scutum and most of the surface of the tegula with metallic green scales. Both the anterior and posterior inner edges of the tegula with black setae. Naked propodeal triangle. Internal apex of posterior tibia with very evident short blackish setal brush (Fig. 3B). Metasoma: terga covered with metallic greenish-copper scales. Anterior edge of T1 with scattered simple black and white setae, with a spot of yellow pubescence on both lateral margins. Surfaces of T3 to T6 with several series of rows of simple black setae. S2 to S4 with a short white patch of pubescence on the lateral edges. Scattered black sternum setae. S4 with long, branched black setae near the posterior edge and with several rows of simple black setae on the surface. S2 to S4 with a more or less triangular white spot on the lateral margins; dorsal lobe of gonostyle triangular and broad projected upwards.
Allotype: female. Body length 16.8 mm, forewing length 12.6 mm, head length 4 mm, intertegular distance 4.5 mm, T2 length 2.3 mm. Head: mandible with an internal tooth; labrum subrectangular with flat surface, and with a very evident preapical margin; ocelli aligned to the upper margin of the eyes, protruding above the head in lateral view. Mesosoma: convex scutum in lateral view. Scutellar tubercles with the conical shape strongly projecting upwards, an evident cleft between them. Vertical metanotum and propodeum. Middle tibial spine pointed and short. Medial tibial spur robust forked, anteriorly projecting with 2 to 3 internal teeth. Medium basitarsus with slightly wavy posterior margin and a flattened curved distal process. Metasoma: pygidial plate with apex more or less rounded. Color: integument black. Head: labrum, rostrum, scape, pedicel and F1 black, remainder of flagellum greyish. Apical third of mandible dark reddish brown with nearby yellowish brown spot, basal half black. Mesosoma: pronotal lobe, tegula, wing veins, legs, middle tibial spur, black. Apex of distal process of middle basitarsus dark reddish brown. Evenly smoked wings. Forewings without obvious dark spots. Metasoma: black sternum. Surface sculpture: head. Rugulous labrum. Mesosoma: finely punctuate tegula. Dotted propodeum. Metasoma: dotted pigidial plate. Pubescence: mainly black, but head covered mainly with white setae. Head: labrum surface with white setae branched and few scattered simple black setae, with a pair of tufts of black setae on the anterior margin and with setae on the lateral edges. Scape almost entire surface of anterior area with metallic blue-green scales. Mesosoma: covered mainly with black setae, except for patches of white setae on the collar of the pronotum, lateral region of the mesepisternum, lateral edges of the scutum, near the tegula, posterior region of the scutellum. Scales of the central disc of the scutum and the pronotal lobe metallic blue-green, of the same tone as those of the face. Scales of the tegula, mesepisternum and scutellum metallic blue. Metasoma: virtually the entire surface covered with metallic blue scales and the setae present are almost exclusively black, except for a spot of branched white setae on the lateral edges of T1, several rows of simple white pubescence on the surface of T4 and T5, a triangular spot of short branched white pubescence on the lateral ends of S3 to S5 and another small spot on the lateral edge of T5. Sterna also with metallic blue scales. Pygidial plate with metallic scales on the surface.
Variation. Some males have bright yellow setae on the external surface of anterior tibia and little pale-yellow pubescence on the lateral edge of S4.
Figure 8. Mesoplia (M.) insignis, male: A, S7. B, S8. C and D, genital capsule, dorsal and lateral view, respectively.
Taxonomic summary
Type material. Holotype: ♂ MNCR INB0004333459, CR. CART (Costa Rica, Cartago), Ochomongo, San Nicolás, Finca Kirqua, 9°54’41.29” N, 83°56’1.81” W, 14-II-2010/1-III-2010, W. Porras (MNCR). Allotype: ♀ MNCR INB0004333299, CR. HER [Costa Rica, Heredia], Sarapiquí, La Isla, 10°24’50.79” N, 84°7’42.24” W, 100-200 m, 22-II-2017/17-IV-2017, I. A. Chacón (MNCR). Paratypes: same data as the holotype ♀ MNCR INB0004333460 (MNCR), ♀ MNCR A5002767; CR. ALAJ [Costa Rica, Alajuela], Virgen del Socorro, 10°17’0.20” N, 84°10’38.22” W, 750 m, 15-IX-1982, I. A. Chacón (MNCR); ♂ MNCR A5057872 CR. HER [Costa Rica, Heredia], Sarapiquí, Puerto Viejo, Estación Biológica La Selva, 10°25’50.61” N, 84°10’38.21” W, 61 m, 24-VI-1988, I. A. Chacón (MNCR), ♀ SEMC 1254906, 10°25’35.81” N, 84°1’1.16” W, 80 m, 19-V-1993, J. Ashe & A. Ashe (SEMC); ♀ MZUCR HY6823 CR. HER [Costa Rica, Heredia], Sarapiquí, Puerto Viejo, La Isla, 10°14’7.70” N, 83°54’43.45” W, 221 m, VI-2011/VII-2011, I. A. Chacón (MZUCR); ♀ CINAT JZ344 CR. HER [Costa Rica, Heredia], Sarapiquí, Puerto Viejo, La Tirimbina, 10°23’52.20” N, 84°8’9.16” W, 186 m, 1997, Sergio (CINAT), ♀ MNCR JZ357, same location as the previous one, 25-VI-1997, Posada (MNCR); ♀ MZUCR HY6827 CR. PUNT [Costa Rica, Puntarenas], Reserva Forestal Golfo Dulce, 24 km W. Piedras Blancas, 8°45’17.43” N, 83°29’5.51” W, 200 m, IV-1992/V-1992, P. Hanson (CINAT).
Etymology. The specific epithet tica refers to the demonym with which the inhabitants of Costa Rica recognize themselves.
Distribution. Registered only for Costa Rica and it is possible that this species be endemic to this country (Fig. 10), present between 61 to 750 m altitude.
Taxonomic comments. This species is morphologically like M. insignis, the main differences are that the female has the scutellar tubercles strongly projecting upwards (Fig. 6A), and the pygidial plate covered by metallic scales and its apex is rounded (Fig. 4B); and the male has the apex of T7 noticeably forked, both apices rounded (Fig. 7B).
Figure 9. Mesoplia (M.) insignis, female: A, lateral habitus; B, dorsal habitus; C, frontal habitus; D, posterior view of the scutellar tubercles.
Mesoplia (Mesoplia) regalis (Smith, 1854)
Melissa regalis Smith, 1854: 280. Syntypes: British Museum Natural History, London, England (♀♂). Type locality: Brazil, Pará, Santarém.
Diagnosis. Male: body metallic green and pubescence white and brown; reddish brown on antennal integument, pronotal lobe, tegula and legs; scutum and tegula with metallic green scales; scutellar tubercles with a flattened surface, median slit between them; bifurcated middle tibial spur, with integument brown; anterior projection with 2 to 4 internal teeth; anterior edge of T1 with scattered white setae, lateral edges with a brown and white spot; T7 with the flat tips, with setae below it that are noticeable in dorsal view.
Figure 10. Map with the known distribution of Mesoplia (Eumelissa) carmelitae sp. nov., M. (E.) ornata, M. (Mesoplia) dugesi, M. (M.) insignis, M. (M.) oaxacana sp. nov., M. (M.) regalis, M. (M.) tica nov. sp., and M. (M.) veracruzana sp. nov.
Female: body metallic green, with white pubescence; antennal integument, pronotal lobe, tegula and legs reddish brown; scutum and tegulas with scales metallic green; scutellar tubercles more developed than in M. sapphirina with a deep depression between them and tubercles conspicuously pointed the delimiting carina is more developed only along the tubercles gradually fading to the sides; bifurcated middle tibia spur, integument brown; anterior projection with 2 to 4 internal teeth; pygidial plate with rounded apex and metallic scales that do not reach the apex (Melo & Rocha-Filho, 2011).
Taxonomic summary
Material examined. 1♂: Panama: Islas de las Perlas, Isla del Rey, 8°23’34.70” N, 78°54’24.11” W, 139 m, 13-IV-1981, R. W. Brooks, 1♂ (SEMC 1254921).
Distribution. Mainly South American, with the northern limit in Panama (Moure & Melo, 2023).
Taxonomic comments. According with Melo and Rocha-Filho (2011), this is a species similar morphologically to M. sapphirina, the main difference is that in this species the tubercles of the scutellum have the distal edge projecting upwards, more evident in females; the dorsal surface of the T7 in males bulging, with flat apices and with setae inserted underneath, distinguishable even in dorsal view. Specimens from Brazil deposited in SEMC were analyzed, whose distribution data were not included because they are from a distribution area not included in this study.
Mesoplia sapphirina Melo & Rocha-Filho, 2011: 30. Holotype: Department of Zoology, Universidade Federal do Pará, Curitiba, Brazil (♀). Type locality: Panamá, ‘Old Panama’.
Figure 11. Mesoplia (M.) tica sp. nov. Holotype, male: A, lateral habitus; B, dorsal habitus; C, frontal habitus; D, posterior view of the scutellar tubercles.
Diagnosis. Male: body metallic blue, with whitish setae (Fig. 14); F1 light reddish brown; remainder of flagellum, pronotal lobe, tegula, most of legs and sterna dark reddish brown; scutum and tegula with metallic blue scales; scutellar tubercles poorly developed, posterior carina conspicuous; middle tibial spur forked, both apical branches with robust teeth, outer branch with 2 small internal teeth (Fig. 16A); dorsal surface of T7 bulging, its projected ventral portion conspicuously excavated; with a pair of apical projections of T7 with rounded apices, emargination between them relatively deep (Fig. 7C); dorsal and digitiform lobes of the gonostylus well developed (Fig. 15C, D).
Female: body metallic blue, with whitish setae (Fig. 17); F1 light reddish brown; remainder of flagellum, pronotal lobe, tegula, most of legs and sterna dark reddish brown; scutellar tubercles weakly developed, its surface only slightly convex and its tubercles low and broadly rounded; the carina that delimits the tubercles posteriorly well developed and runs continuously from one side of the scutellum to the other; middle tibial spur forked, both apical branches with robust teeth, outer branch with 2 small internal teeth (Fig. 18A); pygidial plate with oval apex and covered with decumbent bluish metallic scaly hairs, except for the apex which is naked (Fig. 4C).
Figure 12. Mesoplia (M.) tica sp. nov. Holotype male: A, S7. B, S8. C and D, genital capsule, dorsal and lateral view, respectively.
Variation. Some males have yellow setae on the posterior surface of the scutellar tubercles.
Taxonomic summary
Material examined. Costa Rica: Cartago: Cachí, 9°49’52.06” N, 83°48’18.12” W, 1,016 m, 28-V-1974, G. Rivera, 1♀ (MZUCR HY6608). Guanacaste: Bagaces: Barrio el Brasil, 10°32’57.36” N, 85°15’54.11” W, 114 m, 5-V-2022, K. Borbón, 1♀ (CINAT JZ340), 3♂ (CINAT JZ341 – CINAT JZ343). 10°32’58.60” N, 85°15’52.42” W, 110 m, 8-IV-2023, K. Borbón, 1♀ (MZUCR HY6131), 1♂ (MZUCR HY6131). Filadelfia, 10°26’51.27” N, 85°32’59.86” W, 22 m, 28-IX-1959, M. Leiva, 1♂ (MZUCR HY6816); La Cruz: Cuajiniquil, Bahía Tomás, Salinitas, in mangrove, 10°55’15.60” N, 85°42’57.96” W, 0 m, 28-I-2022, M. F. Otárola & J. Lobo, 1♀ (MZUCR HY2249), 7-II-2022/7-III-2022, M. M. Chavarría & P. Hanson, 2♀ (MZUCR HY5067), (MZUCR HY5068), 25-III-2021, M. F. Otárola & J. Lobo, 1♀ (MZUCR HY2345), V-2022, M. M. Chavarría & P. Hanson, 1♀ (MZUCR HY6838); Nicoya: Sámara, 9°52’51.60” N, 85°31’36.30” W, 17-I-2009, C. Reichie, 1♀ (MZUCR HY5051). San José: San Pedro de Montes de Oca, 9°56’11.41” N, 84°2’58.50” W, 1,201 m, 20-VI-1959, Y. Gómez, 1♀ (MZUCR HY5061). Mexico: Chiapas: La Concordia, 16°7’12.00” N, 92°39’0.00” W, 616 m, 1-IV-2016, P. Sagot, 1♀ (ECOAB 58710), 16°3’36.00” N, 92°33’36.00” W, 550 m, 5-III-2020, P. Sagot, 1♂ (ECOAB 134687); Mazatan, 14°55’12.00” N, 92°37’48.00” W, 6 m, 2-II-2019, P. Sagot, 1♂ (ECOAB 130647), 14°55’48.00” N, 92°37’12.00” W, 8 m, 2-II-2019, I. Pérez, 1♂ (ECOAB 130665); Tonalá, 15°30’0.00” N, 92°24’0.00” W, 3 m, 21-IV-2011, 1♀ (ECOAB 56616). Jalisco: La Huerta: Chamela, 19°29’54.77” N, 105°2’41.22” W, 10-IX-1981, S. Bullock, 1♀ (EBCH SB736), 19-X-1985, S. Bullock, 1♀ (SEMC 1451101), 27-IX-1985, R. Ayala, 1♀ (SEMC 1451080); Estación Biológica Chamela, 19°29’54.77” N, 105°2’41.22” W, 25-IX- 1985, C. D. Michener, 1♀ (EBCH JZ65); La Manzanilla, 19°17’0.03” N, 104°47’13.06” W, 1 m, 16-XI-1994, A. Moreno, 1♀ (HFL 302), 1♀ (CZUG 302), 16-XI-1994, H. E. Fierros-López, 1♀ (HFL JZ7), 1♂ (HFL JZ8), 1♀ (CZUG 309); Playa Careyitos, 19°29’36.18” N, 105°1’29.56” W, 27-X-1985, R. Ayala, 1♀ (EBCH RA219), 27-IX-1985, R. Ayala, 1♀ (EBCH RA218), 30-IX-1985, C. D. Michener, 1♀ (SEMC 1451078); Playa Careyitos 6 Km. South of Chamela, 19°29’36.18” N, 105°1’29.56” W, 27-IX-1985, A. Rodríguez P., 1♀ (EBCH JZ63), R. B. Roberts, 1♀ (EBCH JZ64); Playa Teopa, 19°23’48.69” N, 105°1’9.27” W, 4-X-1985, J. G. Rozen 1♀ (EBCH JZ62), R. Ayala, 1♀ (EBCH JZ69). Oaxaca: San Pedro Huamelula, 15°55’48.00” N, 95°46’48.00” W, 22 m, 21-XII-2019, P. Sagot, 1♂ (ECOAB 133378). Sinaloa: San Ignacio, Autopista 4 Río-Piaxtla, 23°55’59.28” N, 104°25’59.88” W, 1,184 m, 18-III-1990, W. Bell, D. Conlon & R. L. Mickley, 1♀ (SEMC 1451099). Tabasco: Tenosique, 17°18’0.00” N, 91°10’12.00” W, 126 m, 23-V-2018, A. Tapia, 1♀ (ECOAB 120153). Tamaulipas: Altamira, Playa Altamira, 22°29’59.53” N, 97°51’41.04” W, 3-VI-1985, M. S. Wasbauer & J. E. Slansky, 1♀ (SEMC 1442315); Llera de Canales, 23°19’24.79” N, 99°1’19.66” W, 267 m, 19-VII-1954, Univ. Of Kans. Mex. Exped., 1♂ (SEMC 1451076); Soto la Marina, La Pesca, 23°46’31.53” N, 97°44’21.63” W, 4 m, 1-VII-1981, B. Miller, B. Porter & L. Stage, 6♀ (SEMC 1451070 – SEMC1451075); Tampico, 22°13’57.47” N, 97°53’30.53” W, 2 m, 10-VI-1951, H.E. Evans, 6♀ (SEMC 1451089 – SEMC 1451094), 1♂ (SEMC 1451088). Veracruz: without coordinates, 25-VII- 1995, 1♀ (CERUADY 239ver). 25-VII-1995, 1♂ (CERUADY 230ver); Actopan: Cofre de Perote, 19°35’45.96” N, 96°22’47.28” W, 10 m, VI-2019, P. Luna & W. Dáttilo, 1♀ (IEXA JZ38); La Mancha, 19°21’12.60” N, 96°13’27.48” W, 3 m, VI-2022, B. Ratoni & W. Dáttilo, 1♂ (EBCH 622 1), 19°21’16.92” N, 96°13’29.64” W, 15 m, VI-2022, B. Ratoni & W. Dáttilo, 1♀ (EBCH 623 7), 1♂ (EBCH 623 6), V-2023, C. Pinilla, 2♂ (EBCH JZ355, EBCH JZ356). Boca del Río: 8 km SE of Boca del Río, 19°3’13.58” N, 96°2’42.53” W, 9 m, 22-VII-1990, W. Bell, D. Conlon & R. L. Mickley, 1♂ (SEMC 1451100); San Andrés Tuxtla: Estación biológica Los Tuxtlas, 18°31’0.00” N, 95°7’59.59” W, 136 m, 16-IX-2018, I. Huerta, 1♀ (CZUG JZ 13); Tecolutla: 20°28’47.00” N, 97°0’36.00” W, H. E. Evans, 1♀ (SEMC 1451095), 2.41402 km N of Tecolutla, 20°29’33.25” N, 97°1’34.21” W, 4.572 m, 12-VI-1985, Univ. of Kans. Mex. Exped., 1♂ (SEMC 1451077). Yucatán: Tizimín: El Cuyo, 21°31’5.99” N, 87°40’59.00” W, 25-VII-1995, H. Moo, 2♀ (CERUADY 009406(02450)), (009411(02477)), 1♂ (009414(02451)), R. Tut, 7♀ (CERUADY 009574(02453), (009546(02454)), (009543(02455)), (009539(02456)), (009541(02474)), (009545(02475)), (009536(02476)), 1♂ (009544(02461)), 14-VI-1995, R. Tut, 8♀ (CERUADY 007998(02452)), (007987(02462)), (007992(02457)), (007986(02465)), (007980(02466)), (007982(02467)), (008004(02469)), (008000(02473)), 5♂ (007996(02458)), (007979(02460)), (007994(02463)), (007983(02472)), (008006(02479)), 24-V-1995, R. Tut, 1♀ (006649(02468)), 1♂ (006651(02478)), H. Moo, 1♂ (006844(02464)), 4-IV-1995, R. Tut, 1♀ (005166(02470)), 1♂ (005175(02459)). Nicaragua: León: Campus Agropecuário UNAN-León, 12°25’22.14” N, 86°57’8.68” W, 16-V-2022, R. Varela, 1♀ (LEECAV JZ292). Panama: Chimán: Brujas: Punta Bruja, Zona del Canal, 8°35’6.51” N, 78°31’56.69” W, 4 m, 25-I-1929, C. H. Curran, 1♂ (SEMC 1451102). Panamá: Panamá Viejo, 9°0’22.09” N, 79°29’6.29” W, 5 m, 16-IV-1945, C. D. Michener, 1♂ (SEMC 1451079). Panamá Oeste: Fort Kobbe, 8°55’0.30” N, 79°34’59.59” W, 8 m, 11-I-1960, W. J. Hanson, 2♀ (SEMC 14510972), (SEMC 1451098), 2♂ (SEMC 1451096), (SEMC 1427034).
Figure 13. Mesoplia (M.) tica sp. nov. Allotype, female: A, lateral habitus; B, dorsal habitus; C, frontal habitus; D, posterior view of the scutellar tubercles.
Distribution. The northernmost distribution has been recorded in Sonora, along the Pacific Ocean slope and in Tamaulipas on the Gulf of Mexico slope, to the south the limit of its distribution it is in the center of Panama (Fig. 19).
Taxonomic comments. It is a species morphologically similar to M. regalis, the main difference is that the apices of the scutellar tubercles are rather flattened (Fig. 16A, D), not projected upwards (this character can be confused if the scales in this area of the body have been lost), while males do not present setae that protrude in dorsal view below T7 and the apices of this are rounded (Fig. 7C).
Diagnosis. Female: body metallic blue, with pubescence mostly blackish, but bright yellow setae on head and mesosoma, especially on the pronotum, mesepisternum, posterior region of the scutellum, metanotum and lateral areas of the propodeum (Fig. 20); integument black in antenna, pronotal lobe, tegula and legs; posterior apex of scutellar tubercles projecting upwards (Fig. 20C); middle tibial spur forked, with black integument, the anterior projection with 3 inner teeth; tergal pubescence mainly dark with a bright yellow spot on both lateral margins of T1 and T2 (Fig. 20A); pygidial plate with rounded apex, but with a notch in the medial part of the apex, with scales that does not reach the apex, and with black integument (Fig. 4D).
Figure 14. Mesoplia (M.) sapphirina, male: A, lateral habitus; B, dorsal habitus; C, frontal habitus; D, posterior view of the scutellar tubercles.
Description. Holotype: female. Body length 17.9 mm, forewing length 12.6 mm, head length 5 mm, intertegular distance 4.2 mm, T2 length 2.5 mm. Head: mandible with an internal tooth. Labrum subtriangular, surface slightly concave, with a raised preapical margin. Ocelli aligned to the upper margin of the eyes, protruding above the head in lateral view. Mesosoma: scutum convex in lateral view. Scutellar tubercles not very evident due to the large amount of pubescence, a noticeable cleft between them. Metanotum and propodeum vertical. Spine of the middle tibia long pointed. Medial tibial spur robust and forked, anterior projection with 3 internal teeth. Medial basitarsus with smooth posterior margin and a flattened distal process that is slightly curved externally. Metasoma: broad pygidial plate at the base, apex subtruncate with a slight central notch. Color: integument blackish. Head: black on face, labrum and antenna; the flagellum with integument opaque. Apical third of mandible yellowish brown, except for black teeth. Mesosoma: almost all black. Apex of distal process of middle basitarsus reddish brown. Wings overall evenly smoked (Fig. 20A, B); forewings with the anterior edge of the marginal cell darker. Veins dark. Metasoma: between the terga and sterna reddish brown. Surface sculpture: head. Labrum with most surface rugose, basal edge polished. Mesosoma: punctured tegula. Reticulated propodeum. Metasoma: dotted pigidial plate. Pubescence: mostly bright yellow and black. Head: labrum discal area with white plumose setae and scattered simple black setae, lower edge with a pair of long dark tufts, lateral edges with simple black setae, upper edge bare. Clypeus with lower margin with white plumose setae, sides with pale yellow plumose setae, central surface with light metallic blue scales. Suplaclypeal area with few long and scattered black simple setae and with scales equal to those of the clypeus. Frons with black setae and light metallic green scales near the lower edge of the ocelli. Paraocular area with pale yellow plumose setae. Vertex and preoccipital region with bright yellowcompound setae. Gena with setae bright yellow, except for the lower region that has black. Mesosoma: pronotal lobe with the anterior and external lateral margin with bright yellow setae, posterior margin with interspersed white and black setae, inner margin with mainly black setae, surface with dark metallic blue scales (Fig. 20). Mesepisternum upper region with bright yellow setae, lower region black. Scutum covered mainly by black setae, except for the lateral edges near the posterior two-thirds of the tegula that have interspersed bright yellow setae, central disc with light metallic green scales. Tegula black on the anterior and inner edge and with dark metallic blue scales on the surface. Upper of scutellum with few black setae and light metallic blue scales and bright yellow on posterior region, that projects a little between the tubercles. On the metanotum bright yellow. Propodeum upper region naked, posterolateral region bright yellow. Legs are mainly dark and with dark metallic blue scales on the external surfaces, with a tuft of white setae on the posterior margin of the femurs of the forelegs and on the external apices of the middle femurs. Metasoma: terga covered with metallic bluish-green scales. Anterior edge of T1 with scattered white setae, lateral edges with a bright yellow spot; T2 with a smaller pale-yellow spot in the lateral marginal area. T4 and T5 with few white simple setae in lateral view. T6 with thick black setae on the sides of the pygidial plate. Pygidial plate with light metallic green scales that do not reach the apex. Sterna with scattered black setae. S2 to S4 with a sub triangular white spot on the lateral margins.
Figure 15. Mesoplia (M.) sapphirina, male: A, S7. B, S8. C and D, genital capsule, dorsal and lateral view, respectively.
Male: unknown.
Taxonomic summary
Type material. Holotype: ♀ IEXA JZ39 MEX. VER [Mexico, Veracruz], Coatepec, 19°26’42.36” N, 96°57’52.13” W, 1,200 m, 6-VI-2020, G. Quintos-Andrade (IEXA). Paratypes: 3♀: UNAM-LT JZ352 MEX. VER [Mexico, Veracruz], San Andrés Tuxtla, Estación Biológica Los Tuxtlas, 18°35’5.50” N, 95°4’26.58” W, 160 m, 1985-VII-6, A. Ibarra (UNAM-LT). Same location as the previous one, 2♀ UNAM-LT JZ353, 1985-VI-2, P. Sinica. UNAM-LT JZ354, 1986-VII-20, P. Sinica.
Etymology. The name veracruzana refers to the known distribution of this species, the state of Veracruz, Mexico.
Distribution. Only known for the localities of Coatepec and San Andrés Tuxtla (Fig. 10), although there are photographic records in iNaturalist near Xalapa and Orizaba, localities with cloud forest and tropical forest.
Taxonomic comments. The female of this species has a pubescent color similar to that in the male of M. insignis, so they could be confused. In this species, the bright yellow pubescence on the metasoma is only located in the pronotum, mesepisternum, posterior region of the scutellum, metanotum and lateral areas of the propodeum (Fig. 20), unlike M. insignis whose metasoma is almost completely covered by yellow setae (Fig. 6).
M. azurea group(sensu Moure, 1960a, 1960b)
Diagnosis. Male: hind tibia with an inconspicuous setal brush and with 1 spur; ventral basal surface of posterior femur with a robust posterior projection (Fig. 3D, E); inner surface of basitarsus with a longitudinal carina. Female: with carina extending laterally from the pronotal collar, to the pronotal lobe (Fig. 5B).
Mesoplia (Mesoplia) dugesi (Cockerell, 1917)
(Figs. 1B, 3D, 4E, 5B, 7D, 10, 16B, 21-23, 35E)
Mesonychium dugesi Cockerell, 1917: 477. Holotype: National Museum of Natural History, Smithsonian Institution, Washington DC, United States of America (♂). Type locality: Mexico, Guanajuato.
Diagnosis. Male: body dark metallic blue, pubescence mainly black (Fig. 21), except for some white spots on the central surface of the labrum, anterior edge of the superior gena and clypeus; integument blackish on antenna, pronotal lobe, tegula and legs, except for the F1 which is usually dark reddish brown; tegula with metallic blue scales; wing with black veins; scutellar tubercles practically flattened and without a cleft between them; middle tibial spur forked with dark reddish-brown integument, anterior projection with 1 to 3 internal teeth (Fig. 16B); femur posterior with a robust posterior projection on the ventral basal surface (Fig. 3D); apex of T7 bifurcated, both with an acute angle and close to each other (Fig. 7D); dorsal lobe of gonostylus reduced (Fig. 22C, D).
Female: body dark metallic blue, with dark pubescence at first glance (Fig. 23), in a deeper examination some areas with whitish pubescence can be seen on labrum, superior area of the gena, internal margin of the pronotal lobe and a small spot on the posterior surface of the scutellum and between the tubercles; integument of antenna, pronotal lobe, tegula and legs blackish (dark reddish); labrum, vertex, preoccipital area and tegula with metallic blue scales; with a carina extending laterally from the pronotal collar to the pronotal lobe (Fig. 5B); wings with black veins (Fig. 23A, B); scutellar tubercles conical, slightly projecting with a shallow cleft between them (Fig. 23D); middle tibial spur forked with dark reddish-brown integument, anterior projection with 3 internal teeth; T1 with black setae; terga with metallic blue scales; pygidial plate with a narrow apex and completely covered by metallic bluish-green scales (Fig. 4E).
Description. Female: body length, 16.4 mm, forewing length 12.7 mm, head length 4.1 mm, intertegular distance 3.9 mm, T2 length 1.7 mm. Head: mandible with an internal tooth. Labrum subrectangular, surface slightly concave, with a raised preapical margin. Ocelli aligned with the upper margin of the eyes, protruding slightly above the head in lateral view. Mesosoma: with carina that runs laterally from the collar of the pronotum to the pronotal lobe. Convex scutum in lateral view. Scutellar tubercles rounded, without posterior carina, with a median slit between them. Metanotum and propodeum vertical. Medial tibial spine short rounded. Medial tibial spur bifurcated, anterior projection with 3 internal teeth. Medial basitarsus with pentadentate external margin and with a flattened distal process that is slightly curved externally. Metasoma: broad pygidial plate at the base, narrow rounded apex. Color: integument blackish to dark reddish brown. Head: labrum with reddish brown lateral and anterior edges, blackish surface. Apical region of mandible blackish (yellowish brown) reddish brown in basal region. Scape and pedicel blackish to reddish brown. F1 reddish brown, remainder of flagellum brown. Mesosoma: pronotal lobe and tegula dark reddish brown. Almost transparent wings. Forewings with the anterior edge and the distal apex of the marginal cell darker, also presenting a darker spot that goes from the external edge of the 2r-m to the wing apex (Fig. 23B). Dark veins. Inner surfaces of legs dark reddish brown, outer surfaces blackish. Apex of the distal process of the medial basitarsus ferruginous and medial tibial spur reddish brown. Metasoma: blackish sterna, except for S6 which is reddish brown. Surface sculpture: head. Labrum with most surface rugose, basal edge polished. Mesosoma: punctured tegula. Strigulate propodeum. Metasoma: dotted pigidial plate. Pubescence: mostly blackish. Head: labrum central surface with white feathery setae and scattered simple black setae, lower edge with a pair of long dark tufts, lateral edges with simple black setae, upper edge bare. Clypeus and supraclypeal area with metallic blue scales and long black simple setae. Scape with short black setae. Frons with black setae and metallic blue scales on the lower edge of the ocelli. Paraocular area mainly with simple black setae, with a tuft of setae near the antennal alveolus. Vertex and preoccipital region with simple black setae and metallic blue scales. Gena with black setae, except for the middle region near the eyes which has white setae. Mesosoma: with black setae except for the inner margin of the pronotal lobe and a small spot on the posterior surface of the scutellum and between the tubercles. Pronotal lobe with metallic blue scales. Anterior region of the scutum with dense setae coverage. Central disc with scattered setae and light metallic blue scales. Tegula with black setae on the anterior edge and metallic blue scales on the inner edge. Scutellum upper region with few black setae and metallic blue scales, posterior region also with metallic blue scales. Naked propodeal triangle. Legs are mainly black, with only a patch of white setae on the external apex of the anterior tibia and on the external apex of the middle femur. External surface of the tibiae of all legs with metallic blue scales and on the posterior basitarsus. Metasoma: with black setae except for the lateral margins of S2 to S4 which have a triangular spot of short white setae. Sterna with scattered black setae.
Variation. Some males have a greater proportion of white setae in some body regions, on all margins of the pronotal lobe, in the anterior region of the scutum, anterior and posterior apex of the tegula, between the tubercles and in the posterior region of the scutellum, metanotum and on the supralateral margins of the propodeum.
Taxonomic summary
Material exanimated. Mexico: Jalisco: Mazamitla, Puerta del Zapatero, 19°50’29.00” N, 103°5’52.00” W, 1,615 m, 27-VIII-2005, H. E. Fierros-López, 1♂ (HFL); Teocuitatlán: Laguna de Sayula, 19°56’55.00” N, 103°27’56.00” W, 1,350 m, 28-VIII-2011, A. Aguilar, 1♂ (HFL 1111); Zapopan: Barranca la Experiencia, 20°44’6.13” N, 103°19’38.38” W, 1,200 m, 23-VIII-1997, G. Mercado, 1♀ (HFL 1107), 23-VIII-1996, G. Mercado, 1♂ (HFL), 14-IX-1996, G. Mercado, 1♂ (CZUG 1108), 1,350 m, 27-IX-2009, G. Mercado, 1♀ (CZUG). Michoacán: Nahuatzen: Zacapu, 19°45’22.46” N, 101°46’52.61” W, 2,152 m, 10-IX-2014, G. Mérida, 1♂ (ECOAB 25661).
Distribution. Only known from Jalisco, Guanajuato and Michoacán in México, although there is at least one record in iNaturalist for Querétaro (Fig. 35E). Its distribution seems to be restricted to the center of the country (Fig. 10).
Taxonomic comments. Is the darkest species distributed in the region, both the general pubescence of the body and the integument of the legs are mainly blackish.
Mesoplia guatemalensis Cockerell, 1912: 567. Holotype: National Museum of Natural History, Smithsonian Institution, Washington D.C., United States of America (♀). Type locality: Guatemala, Gualan. New junior synonym.
Diagnosis. Male: body metallic blue-greenish coloration and with whitish pubescence (Fig. 24); integument of the scape, pedicel and f1 ferruginous (in some specimens inner margin of the scape darker); integument ferruginous on apical flagellomere in posterior view, pronotal lobe and tegula; integument of legs dark brown, on external surface and ferruginous on internal; tegula without scales (Fig. 24B); wing veins ferruginous; with rounded scutellar tubercles, with posterior carina and no cleft between them; femur posterior with a robust posterior projection on the ventral basal surface (Fig. 3E, 35F); terga with blue-green scales; apex of T7 bifurcated, both with an acute angle and close to each other (Fig. 7E); dorsal lobe of gonostylus reduced (Fig. 25C, D).
Female: body metallic blue-greenish coloration and with whitish pubescence (Fig. 26); integument ferruginous on scape, pedicel and f1, pronotal lobe, tegula and legs (some populations with dark brown integument); with a carina extending laterally from the pronotal collar to the pronotal lobe; tegula without metallic scales (Fig. 26B); wing veins ferruginous; conical tubercles slightly projected with a shallow cleft between them; terga with dorsal pubescence whitish; middle tibial spur bifurcated with ferruginous integument, anterior projection with 2 or 3 internal teeth (Fig. 18B); pubescence of the anterior edge of T1 whitish; terga with green scales; pygidial plate with a narrow apex and covered by metallic bluish-green scales (Fig. 4F).
Notes made by Moure (1960a) from the holotype: “The pubescence of the clypeus and paraocular area, especially in the upper part, tends to very pale yellow. With few dark hairs in the supraclipeal area, next to the ocelli and on the frons. The pubescence of the thorax is pale on the pronotum, with dark setae on the lobes. Dark setae in the anterior third of the mesoscutum, but divided in the middle by a line of white setae and bordered posteriorly by white setae. Mesoscutum disc with fine bronze-green scales and few setae; The punctuation is very evident there in two sizes, the small denser dots and the thick ones very dispersed. On the mesepisternum there is white pubescence above and below an irregular disc area of dark setae and ventrally the setae are also dark. The terga are covered with bronze-green scales and in certain light give the impression of being dark at the base of each tergum, each side of the terga with a small longitudinal line of white setae on the border with the ventral surface which is covered with setae quite short white ones. The long setae of T1 toT5 are white, in the last two black. The integument of mandibles, labrum and legs is rusty; the tegulae and pronotal lobes of a lighter rust color.
Figure 20. Mesoplia (M.) veracruzana sp. nov. Holotype, female: A, lateral habitus; B, dorsal habitus; C, frontal habitus; D, posterior view of the scutellar tubercles.
The spur of the middle tibia widened towards the apex and bifurcated, with the inner ramus having a single tooth and the outer ramus having a toothed inner edge. The middle basitarsus with the posterior angle between the external and internal surfaces only edged, not laminated. Hind femurs thickened near base projecting backwards at a large finger-like angle. The tibia moderately thickened at the apex, internally more or less flattened, distally on the internal surface a short imperfect tuft and with a relatively short spur. The posterior basitarsus with the inner side flattened and smooth, largely glabrous and separated from the posterior surface by a thin carina. T7 with the apex narrowly emarginated in a paraboloid shape, the tips relatively close together and strongly rounded. The S4 widely emarginated, procurved, with a wide short band ending at the level of the edge. S5 with deeper emargination, very pubescent, hairs curved towards the center. Approximate length 13.2 mm, forewings including tegula 13 mm; head width 4.28 mm, abdomen 5.45 mm.”
Variation.The shape of the S8 seems to be higly variable; and the shape of the basal projection of the posterior femur on males, in some individuals it is wider, while in others it is narrower.
Material examined. Costa Rica: no location data, 1♂ (MZUCR HY6836). Guanacaste: Bagaces, 8 km al NE de Bagaces, Pan Am Hwy, 10°32’17.67” N, 85°19’53.58” W, 116 m, 23-II-2000, P. Ronchi & G. W. Frankie, 1♂ (MZUCR HY5770), 24-II-2000, P. Ronchi & G. W. Frankie, 2♂ (MZUCR HY3446), (MZUCR HY3448), 12-II-2000, P. Ronchi & G. W. Frankie, 2♂ (MZUCR HY3450), (MZUCR HY3447), 9-III-2000, P. Ronchi & G. W. Frankie, 1♂ (MZUCR HY6835); Urban Bagaces, 10°31’39.84” N, 85°15’25.26” W, 83 m, 12-III-2004, L. Sandoval & G. W. Frankie, 2♂ (MZUCR HY6825), (MZUCR HY6824); Hacienda Monteverde 9 km NW Bagaces, 10°33’17.91” N, 85°16’12.50” W, 91 m, 24-II-1996, G. W. Frankie, 1♀ (MZUCR HY5697), 18-III- 2022, J. Lobo, 1♀ (MZUCR HY6828); Carrillo: Filadelfia, 11.2654 SW of Filadelfia, 10°22’21.18” N, 85°37’29.14” W, 85 m, 3-III-1954, A. Wille & H. Daly, 1♀ (SEMC 1451159); Hojancha: Lajas, 9°59’34.55” N, 85°27’5.06” W, 200 m, 18-V-2014, S. Galbraith, 2♀ (INB0004444317 – INB0004444319); La Cruz, Cuajiniquil, Bahía Tomás, Salinitas, in mangrove, 10°55’17.40” N, 85°42’57.96” W, 0 m, 25-III-2021, M. F. Otárola & J. Lobo, 1♀ (MZUCR HY2792), 7-II-2022/7-III-2022, M. F. Otárola & J. Lobo, 1♀ (MZUCR HY5064), 25-III-2021, M. F. Otárola & J. Lobo, 2♀ (MZUCR HY2348), (MZUCR HY2349), 18-III-2022/-IV-2022, M. M. Chavarría & P. Hanson, 1♀ (MZUCR HY5065), 9-IV-2022/7-V-2022, M. M. Chavarría & P. Hanson, 3♀ (MZUCR HY5063), (MZUCR HY5066), (MZUCR HY5066); Liberia, 10°38’55.46” N, 85°26’39.36” W, 149 m, 21-II-2013, 1♀ (MZUCR HY3449); Barrio La Arena, 10°36’21.96” N, 85°25’30.23” W, 142 m, 15-V-1980, E. Ponce, 1♂ (MZUCR HY6817); Pan Am Hwy, 10°38’32.38” N, 85°27’13.36” W, 132 m, 22-II-2004, G. W. Frankie & S. B. Vinson, 1♂ (MZUCR HY5696); Santa Cruz, Playa Junquillal, 10°10’7.04” N, 85°48’47.87” W, 3 m, 3-III-1976, R. M. Bohart, 1♀ (SEMC 1442317). Heredia: CINAT Lagunilla, 9°58’23.58” N, 84°7’45.55” W, 1,038 m, 30-VII-1997, A. Ortiz, 1♂ (CINAT JZ337), 27-III-2017, R. Díaz, 1♀ (CINAT JZ339); Sarapiquí: Puerto Viejo, Estación Biológica La Selva (OET), 10°25’49.70” N, 84°0’24.96” W, 50 m, 17-VII-1995, P. Hanson, 1♀ (MZUCR HY6826), 2-IV-1993, P. Hanson & C. Godoy, 1♀ (MZUCR HY6818). Puntarenas: Golfo Dulce, 8°42’13.42” N, 83°29’8.86” W, 10 m, XII-1989/III-1990, P. Hanson, 1♀ (MZUCR HY6821); Gromaco, 34 km S of Potrero Grande en río, 8°50’49.49” N, 83°2’41.43” W, 836 m, 21-VII-1963, C. D. Michener & W. Kerfoot, 1♀ (SEMC 1451161); Rincon, 5 km S of Rincon, 8°40’57.72” N, 83°28’24.94” W, 21 m, 15-III-1973, E. Borrows, 1♂ (SEMC 1451162). San José, 9°40’0.01” N, 84°0’0.00” W, C. D. Michener, 1♀ (SEMC 1451160); Pérez Zeledón, Esperanza, 9°16’30.64” N, 83°42’9.86” W, 807 m, II-1997, N. Siles, 1♂ (CINAT JZ336), 13-IX-1999, A. Ortiz, 1♂ (CINAT JZ338); San Antonio de Escazú, 9°53’23.88” N, 84°8’17.66” W, 1,454 m, W. Edward, 1♂ (MZUCR HY6834). Guatemala: without locality, 28-III-1923, 1♀ (SEMC 1451087). Huehuetenango: La Libertad, 15°34’12.00” N, 91°51’0.00” W, 915 m, 27-IV-2010, M. Hurtado, 1♂ (ECOAB 25637), 28-IV-2010, C. Balboa, 2♂ (ECOAB 25639), (ECOAB 38876), L. Aguilar, 1♂ (ECOAB 25642), 26-II-2010, C. Balboa 2♂ (ECOAB 25643), (ECOAB 25646); San Antonio Huista, 15°36’36.00” N, 91°44’24.00” W, 1,192 m, 23-II-2010, D. Sánchez, 1♂ (ECOAB 25645). Honduras: Ocotepeque: Lucerna, Autopista 4, 9 km N of Lucerna, 14°37’36.00” N, 89°3’42.00” W, 792.48 m, 26-V-2003, D. Brzoska, 1♀ (SMO 418386). Mexico: No location data, J. Mérida, 1♀ (ECOAB 25656). Campeche: Champotón, 18°33’0.00” N, 89°56’24.00” W, 155 m, 8-VI-2018, J. Mérida, 3♀ (ECOAB 121736 – ECOAB 121738), 18°27’0.00” N, 89°53’24.00” W, 168 m, 6-VI-2018, 7♀ (ECOAB 121803 – ECOAB 121806), (ECOAB 121813 – ECOAB 121816). Chiapas: Acacoyagua, 15°24’0.00” N, 92°39’0.00” W, 862 m, 15-V-2007, R. Ayala, 1♂ (ECOAB 56633); Arriaga: 16°19’12.00” N, 93°58’48.00” W, 367.5 m, 10-III-2009, M. Guzmán, 1♂ (ECOAB 25641), 19-V-2009, C. Balboa, 1♀ (ECOAB 25657); Ej. López Mateos, 16°20’46.60” N, 93°58’26.80” W, 255 m, 13-III-2009, C. Balboa, M. Guzmán y M. Cigarroa, 2♂ (EBCH ECO-TAB57347), (EBCH ECO-TAB57276); Cacahoatán, 5 km. sur de Cacahoatán, 14°57’0.00” N, 92°9’0.00” W, 340 m, 18-IV-1993, A. Rodríguez P., 2♀ (EBCH JZ70), (SMO 317151), 2♂ (EBCH JZ77), (SMO 317154); La Concordia, 15°45’0.00” N, 92°58’12.00” W, 921 m, 23-IV-2021, P. Sagot, 1♂ (ECOAB 125000), J. Mérida, 2♂ (ECOAB 125229), (ECOAB 125230), 5-III-2020, P. Sagot, 2♂ (ECOAB 134690), (ECOAB 134691), E. Gómez, 2♂ (ECOAB 134756), (ECOAB 134757), 16°2’24.00” N, 92°33’36.00” W, 580 m, 5-III-2020, P. Sagot, 1♂ (ECOAB 134785); Mapastepec, 15°31’12.00” N, 92°48’0.00” W, 316 m, 22-II-2006, J. Esponda, 1♂ (ECOAB 25644), 1-IV-2005, M. Rincón, 1♀ (ECOAB 25660); Motozintla de Mendoza, 15°22’48.00” N, 92°19’12.00” W, 1,230 m, 7-II-2011, P. Sagot, 1♂ (ECOAB 25638), 15°19’12.00” N, 92°20’24.00” W, 1,000 m, 3-II-2019, P. Sagot, 1♂ (ECOAB 131078); Ocosingo, 16°54’36.00” N, 93°40’48.00” W, 950 m, 15-IV-2010, J. Mérida, 1♂ (ECOAB 56637); San Juan Cancuc, 16°54’0.00” N, 92°21’36.00” W, 1,170 m, 6-IV-2010, J. Mérida, 1♂ (ECOAB 25654); Siltepec, 15°34’48.00” N, 92°39’0.00” W, 1,709 m, 9-III-2022, L. Arroyo, 1♀ (ECOAB 71706), 1♂ (ECOAB 71705); Tapachula, 14°53’24.00” N, 92°17’24.00” W, 127 m, 9-VI-1989, A. Aquino, 1♂ (ECOAB 25648), 14°54’0.00” N, 92°18’36.00” W, 102 m, 14-XII-1988, A. Aquino, 2♂ (ECOAB 25649), (ECOAB 25651), 18-I-1989, A. Aquino, 1♂ (ECOAB 25650), 1♀ (ECOAB 25658), M. Cigarroa, 2♂ (ECOAB 25652), (ECOAB 25653), 1♀ (ECOAB 25659); Tonalá, 16°8’24.00” N, 93°40’48.00” W, 407.5 m, 21-V-2009, C. Balboa, 1♂ (ECOAB 56635), 12-VII-2009, C. Balboa, 1♀ (ECOAB 56636), 9-III-2009, M. Guzmán, 1♀ (ECOAB 25655), 16°30’0.00” N, 93°40’48.00” W, 407.5 m, 12-II-2009, C. Balboa, 1♀ (ECOAB 61187), 15°56’24.00” N, 93°49’12.00” W, 6 m, 31-I-2019, I. Pérez, 1♂ (ECOAB 130806), 25-I-1989, M. Cigarroa, 1♂ (ECOAB:66072); Tuxtla Chico, 14°58’12.00” N, 92°10’48.00” W, 395 m, 18-II-1992, M. Medina, 1♀ (ECOAB 56638), 1♂ (ECOAB:25647); Venustiano Carranza, 16°18’60.00” N, 92°33’59.76” W, 570 m, 21-IV-1993, J. L. Neff, 1♀ (EBCH JZ71). Guerrero: Iguala, 18°20’37.00” N, 99°32’21.01” W, 731.52 m, 4-II-1954, R. R. Dreisbach, 1♂ (SEMC 1451084); Tlapa de Comonfort, 17°33’0.00” N, 98°34’48.00” W, 1,063 m, 17-IV-1989, A. Aquino, 1♂ (ECOAB 56634). Jalisco: Cabo Corrientes, 19°39’0.00” N, 105°10’48.00” W, 49 m, 8-IX-2018, J. Mérida 1♀ (ECOAB 121569); El Tuito, 20°21’20.50” N, 105°18’59.96” W, 18-VI-1989, A. Borquez, 1♂ (EBCH JZ79); Jardín Botánico, 20°27’57.64” N, 105°17’30.89” W, 360 m, 26-VII-2014, C. E. Alatorre-Bracamontes y M. Vásquez-Bolaños, 1♂ (CZUG JZ12); La Huerta: Chamela, 19°29’54.77” N, 105°2’41.22” W, 20-VII-1985, R. Ayala, 2♂ (EBCH RA178bis JZ73), 1♂ (EBCH RA178bis JZ76), 19-XI-1989, G. Rodríguez, 2♂ (EBCH JZ74), (EBCH JZ75); Tequila: Volcán de Tequila, 20°51’50.99” N, 103°50’35.00” W, 1,300 m, 15-III-1996, H. E. Fierros-López, 1♂ (HFL JZ11), 15-III-1995, H. E. Fierros-López, 1♂ (CZUG 344); Zapopan: Barranca la Experiencia, 20°44’6.13” N, 103°19’38.38” W, 30-I-1997, G. Mercado, 1♂ (CZUG 1110), 31-VII-1996, G. Mercado, 1♂ (CZUG 1109). Morelos: Temixo: Cuentepec, 18°51’38.16” N, 99°19’30.72” W, 1,485 m, 31-X-2019, D. A. Hernández-Márquez, 1♀ (MZFC 33199), 18°51’27.72” N, 99°19’40.80” W, 1,455 m, 22-XII-2018, D. A. Hernández-Márquez, 1♀ (MZFC 32554). Querétaro: Jalpan de Serra, 21°13’0.01” N, 99°28’21.00” W, 770 m, 24-V-1989, D. Yanega, 2♀ (SEMC 1451144), (SEMC 1451145). Nayarit: San Blas, 20 km al sur de San Blas, 21°23’25.00” N, 105°6’14.00” W, 10 m, 7-IV-1994, F. Noguera, 1♂ (SMO 328474). Oaxaca: San Pedro Totolapa, 8.04672 km al noroeste de San Pedro Totolapa, 16°43’23.12” N, 96°19’14.27” W, 1,158.24 m, 6-VII-1953, Univ. of Kans. Mex. Exped., 1♂ (SEMC 1451086); Putla Villa de Guerrero, 17°0’36.00” N, 97°57’0.00” W, 849 m, 24-V-2020, Wilebaldo, V., 1♀ (ECOAB 58886). Puebla: Cuetzalan del Progreso, 20°3’36.00” N, 97°28’12.00” W, 413 m, 26-III-2020, L. Arroyo, 1♂ (ECOAB 137985). Sonora: Álamos, La Aduana, 27°2’27.16” N, 109°0’57.91” W, 567 m, 15-III-1962, L. A. Stange, 1♀ (SEMC 1442316). Tabasco: Huimanguillo, 17°49’48.00” N, 93°55’12.00” W, 21 m, 3-VI-2015, P. Sagot, 1♂ (ECOAB 77134). Veracruz: without locality, 1♀ (CERUADY 037ver); Acayucan, 48.2803 km al sur de Acayucan, 17°38’6.41” N, 94°54’14.40” W, 56 m, 21-IV-1962, L. A. Stage, 1♀ (SEMC 1442318); Coatepec, 19°26’42.36” N, 96°57’52.13” W, 1,200 m, 1-VI- 2020, G. Quintos-Andrade, 3♀ (IEXA JZ40 – IEXA JZ42), 3-VI- 2020, G. Quintos-Andrade, 1♀ (IEXA JZ43). 4-VI- 2020, G. Quintos-Andrade, 1♀ (IEXA JZ44), 7-VI-2020, G. Quintos-Andrade, 1♀ (IEXA JZ45), 6-VI- 2020, G. Quintos-Andrade, 3♀ (IEXA JZ46 – IEXA JZ48); Medellín: Paso del Toro, 4.82803 km SW of Paso del Toro, 19°0’46.43” N, 96°8’39.30” W, 15.24 m, 23-VI-1961, Univ. of Kans. Mex. Exped., 1♂ (SEMC 1451081); Teocelo, Llano Gande, 19°22’13.01” N, 96°52’50.99” W, 833 m, 17-VI-1990, G. Rodríguez, 1♀ (SEMC1451143); Xalapa, 35.4056 km SW of Xalapa, 19°24’20.92” N, 96°38’46.46” W, 335.28 m, 29-VI-1953, Univ. of Kans. Mex. Exped., 1♂ (SEMC 1451176); Veracruz, 18°54’29.30” N, 96°8’16.01” W, 27-III-1951, W. P. Stephen, 1♂ (SEMC 1451083). Yucatán: Izamal, Plaza Izamal, 20°56’1.00” N, 89°1’5.00” W, 15 m, 24-V-1995, W. May, 1♀ (CERUADY 22841(02486)), 1♂ CERUADY 22838(02482), A. Canto, 2♂ (CERUADY 22488(02482)), (CERUADY:22481(02484)); Kinchil, Parque Central Kinchil, 20°55’1.23” N, 89°56’50.18” W, 8 m, 24-V-1995, F. León, 1♂ (CERUADY 019671(02480)), 8-V-1995, R. Rodríguez, 1♂ (CERUADY 021772(02481)); Xmatkuil, CCBA, 20°52’2.86” N, 89°37’28.10” W, 11 m, 18-V-2022, A. Sansores, 1♂ (CERUADY JZ206), 16-V-2022, 1♀ (CERUADY JZ211), 1♂ (CERUADY JZ207). Nicaragua: Rivas: Cárdenas, 11°14’24.00” N, 85°42’36.00” W, 90 m, 26-V-2015, E. Dorgay, 1♀ (ECOAB 66669); San Juan del Sur, 11°6’36.00” N, 85°45’36.00” W, 1 m, 6-IV-2017, M. Calero, 1♀ (ECOAB 80382), 0 m, 6-IV-2017, M. Calero, 1♂ (ECOAB 80393). Panama: Colón, 3.21869 km NW of Gamboa, 9°7’42.46” N, 79°42’55.28” W, 65 m, 21-I-1958, W. J. Hanson, 1♀ (SEMC 1451152); 8 km NW of Gamboa, pipeline road, 9°8’38.63” N, 79°43’38.22” W, 61 m, 12-I-1981, C. D. Michener, 1♀ (SEMC 1451153). Panamá: Zona del Canal, Juan Mina, 9°13’39.67” N, 79°57’2.59” W, 106 m, 22-VI-1945, C. D. Michener, 1♂ (SEMC 1451082); Curundú, 8°59’26.73” N, 79°32’27.29” W, 34 m, 31-III-1981, R. W. Brooks, 1♂ (SMO 725157), 19-V-1981, R. W. Brooks, 4♂ (SMO 725158), (SEMC 1254922 – SEMC1254924). Panamá Oeste: Laguna, Chame, 8°39’53.99” N, 80°6’10.90” W, 792.48 m, 29-IV-1945, C. D. Michener, 1♂ (SEMC1451085); Zona del Canal, Río Corona, 8°28’55.22” N, 80°1’42.15” W, 609.6 m, 3-V-1952, C. W. Rettenmeyer, 1♀ (SEMC 1451146); Isla Barro Colorado, 9°11’0.00” N, 79°51’0.00” W, 21-II-1956, C. W. Rettenmeyer, 1♀ (SEMC 1451147), 16-IV-1956, C. W. Rettenmeyer, 1♀ (SEMC 1451148), 15-II-1956, C. W. Rettenmeyer, 1♀ (SEMC 1254915), 19-II-1956, C. W. Rettenmeyer, 1♀ (SEMC 1254916), 7-III-1967, M. Naumann, 1♀ (SEMC 1451149); Fort Kobbe, 8°55’0.30” N, 79°34’59.59” W, 8 m, 11-I-1960, W. J. Hanson, 1♀ (SEMC 1451150), 1♂ (SEMC 1451151).
Figure 22. Mesoplia (M.) dugesi, male: A, S7. B, S8. C and D, genital capsule, dorsal and lateral view, respectively.
Distribution. Registered from south Sonora in northern Mexico, to Brazil, according to opinion of Melo and Genaro (Genaro & Franz, 2008), its distribution is restricted to continental America, so its presence on the islands of the continent would be ruled out (Fig. 27).
Taxonomic comments. Within the genus, it is the species with the widest distribution (Fig. 27), largest number of registered hosts (Table 2). This is possibly a species complex; we did not find morphological characters that allow us to delimit it in a group of species.
Diagnosis. Female: body metallic blue but black in face and mesosoma and metasoma (Fig. 28); scape with dark integument on the base and reddish brown on apex; pedicel with dark integument; integument of f1 ferruginous, remainder of flagellum dark brown; labrum, without metallic blue scales on vertex, occiput and tegula (or not very evident on tegula (Fig. 28B)); tegula integument dark brown; legs with integument on outer surface of blackish and inner surface dark reddish brown; with a carina extending laterally from the pronotal collar to the pronotal lobe; conical scutellar tubercles moderately projected, with a median cleft between them (Fig. 28D); tergal pubescence blackish; middle tibial spur forked with dark reddish-brown integument, anterior projection with 4 internal teeth; pygidial plate with a broad apex and almost completely covered by metallic bluish-green scales (Fig. 4G).
Figure 23. Mesoplia (M.) dugesi, female: A, lateral habitus; B, dorsal habitus; C, frontal habitus; D, posterior view of the scutellar tubercles.
Description. Holotype: female. Body length 13.5 mm, forewing length 12.5 mm, head length 3.5 mm, intertegular distance 4.4 mm, T2 length 2.8 mm. Head: mandible with an internal tooth. Labrum subrectangular, surface slightly concave, with a raised preapical margin. Ocelli aligned to the upper margin of the eyes, protruding above the head in lateral view. Mesosoma: with a carina extending laterally from the pronotal collar to the pronotal lobe. Scutum convex in lateral view. Scutellar tubercles conical, without posterior carina, with an evident cleft between them. Vertical metanotum and propodeum. Short pointed middle tibial spine. Medial tibial spur bifurcated, anterior projection with 4 internal teeth. Medium basitarsus with tridentate external margin and with a thin flattened distal process slightly curved externally. Metasoma: broad pygidial plate at the base, and with a broad rounded apex (Fig. 4G). Color: integument blackish to dark reddish brown. Head: scape mostly blackish, with dark reddish brown upper outer edge. Pedicel also bicolor. F1 ferruginous, remainder of flagellum brown. Basal and apical region of the mandible dark, with a yellowish brown area in the base of the teeth and reddish brown near the base. Mesosoma: pronotal lobe and tegula blackish. Wings almost transparent. Forewings with the anterior edge and the distal apex of the marginal cell darker, also presenting a darker spot that goes from the external edge of the 2r-m to the wing apex (Fig. 28B). Very dark veins. Inner surfaces of legs dark reddish brown, outer surfaces blackish. Apex of distal process of middle basitarsus blackish. Middle tibial spur reddish-brown. Metasoma: sterna blackish, except for S6 which is reddish brown. Surface sculpture: head. Labrum with most surface rugose, basal edge polished. Mesosoma: punctured tegula. Dotted propodeum. Metasoma: dotted pigidial plate. Pubescence: approximately the same proportion of blackish and whitish. Head: labrum discal area with white plumose setae and scattered simple black setae; lower edge with a pair of long dark tufts; lateral edges with simple black setae and upper edge bare. Clypeus and supraclypeal area, with lateral with white plumose setae, discal surface with little pubescence, some elongated black simple setae evident in lateral view. Frons with brown setae. Paraocular area with white plumose setae. Vertex and preoccipital region with white setae. Gena with white setae, except for the darks on lower area. Mesosoma: pronotal lobe, with the inner and posterior margins with white setae, rest with blackish setae, with light metallic green scales, only slightly evident in frontal view. Mesepisternum with blackish setae, with a thick longitudinal white line. Scutum covered mainly by black setae, except for the lateral edges near the posterior two-thirds of the tegula that have white setae, a central disc with light metallic green scales. Tegula with black setae on the anterior margin and white on the posterior, and with few light metallic green scales on the inner margin, only slightly evident in the opposite lateral view. Scutellum, upper area with few black setae and light metallic blue scales, posterior part with white setae project a little between the tubercles, also with light metallic blue scales in posterior view. Metanotum blackish. Propodeum upper region naked, posterolateral region blackish. Mainly black legs. Outer surface of anterior tibia with a few light metallic green scales, some white plumose setae and simple blackish elongated setae and also present on the basitarsus. With light metallic blue scales evident on the outer surface of the tibia and basitarsus of the middle and hind legs. Metasoma: terga covered with metallic blue-green scales and setae almost black and simple, except on the side of T5, S2 to S4. T6, with thick black setae on the sides; pygidial plate with light metallic green scales that do not reach the apex (Fig. 4G); sterna with scattered black setae.
Figure 24. Mesoplia (M.) rufipes, male: A, lateral habitus; B, dorsal habitus; C, frontal habitus; D, posterior view of the scutellar tubercles.
Male: unknown.
Taxonomic summary
Type material. Holotype: ♀ ECOAB 74052 MEX. OAX [Mexico, Oaxaca], Santiago Nacaltepec, 17°28’12.00” N, 96°49’12.00” W, 1,377 m, 4-XII-2014, L. M. Reyes (ECOAB).
Etymology. The name oaxacana makes reference to the known distribution of this species, the state of Oaxaca.
Distribution. It is only known from the type locality (Fig. 10).
Taxonomic comments. This species is similar to M. dugesi since the majority of the pubescence is dark. But this species has few metallic scales on the face (Fig. 28C) and tegula (Fig. 28B), and the apex of the pygidial plate is broad (Fig. 4G).
Subgenus Eumelissa Snelling & Brooks, 1985
Eumelissa Snelling & Brooks, 1985: 21. Type species: Melissa decorata Smith, 1854: British Museum Natural History, London, England (♀), by original designation.
Diagnosis. Male: posterior tibia, distal inner surface without a conspicuous setal brush (Fig. 3F, G); hind tibial spurs reaching to or beyond middle of basitarsus, both present. Female: pygidial plate narrow, does not completely occupy the exposed dorsal surface of T6; pygidial plate glabrous (Figs. 4H, 23D); dorsal surface of posterior coxa abruptly rounded at the junction with lateral surfaces.
Diagnosis. Male: body metallic blue, with mostly whitish pubescence; whitish-yellowish pubescence on the face, except for the frons, which has brown pubescence; scape and pedicel with integument dark; basal and apical flagellomere, pronotal lobe, tegula and legs with integument ferruginous; anterior region of the scutellar disc pubescence with a color pattern that goes from blackish in the anterior region, brownish-yellowish to whitish (Fig. 29B); scutellar tubercles flattened; forked spur of middle tibia ferruginous, becoming dark at apex, both branches short, external apex with 3 or 4 internal teeth (Fig. 16D). Terga pubescence whitish, with a pair of white spots with short pubescence in the marginal area of T2 to T6 (Fig. 29D); forked apex of T7, both tips truncated and bare, median cleft shallow (Fig. 7F); S4 bilobed, with a band of very short, dark hairs on the distal margin; dorsal lobe of the gonostylus elongated and projected towards the penis valvae (Fig. 30C, D).
Figure 25. Mesoplia (M.) rufipes, male: A, S7. B, S8. C and D, genital capsule, dorsal and lateral view, respectively.
Female: body metallic blue, with mostly whitish pubescence; F1 shorter than F2; scape and pedicel integument reddish brown; F1, pronotal lobe, tegula and legs integument ferruginous; pubescence of the anterior region of the scutum short and branched, with a characteristic pattern that transversely intersperses spots of whitish and blackish setae (Fig 20B); scutellar tubercles flattened with a superficial cleft between them and with short, bushy black pubescence on the apical edge; terga pubescence whitish; with a pair of white spots with short pubescence in the marginal area of T2 to T4 (Fig. 31A); mesosoma and metasoma, ventral surface with metallic blue scales; middle tibial spur forked with ferruginous integument, becoming dark at apex, both branches short, external apex with a series of 3 or 4 short internal teeth (Fig. 18D); pygidial plate narrow at the base, does not cover the entire posterior margin of T5, glabrous, without scales or hairs (Fig. 4H).
Description. Holotype: male. Body length, 11.3 mm (10.8-11.9; n = 4), forewing length 9.4 mm (9.1-10; n = 4), head length 3.4 mm (3.4-3.5; n = 4), intertegular distance 3.3 mm (2.8-3.5; n = 4), T2 length 1.729 mm (1.6-1.8; n = 4). Head: mandible with an internal tooth. Labrum subrectangular, flat surface, with a slightly elevated preapical margin. Ocelli aligned to the upper margin of the eyes, protruding only a little above the head in lateral view. Mesosoma: convex scutum in lateral view. Scutellar tubercles with a flattened surface, a superficial cleft between them. Vertical metanotum and propodeum. Medial tibial sine short pointed (Fig. 1D). Medial tibial spur bifurcated near the apex, noticeably elongated, internal tip with a single thin elongated tooth, external tip with a series of 3 or 4 internal teeth (Fig. 16D). Medial basitarsus with posterior margin smooth and with short and straight flattened distal process (Fig. 1D). Posterior femur thin. Posterior tibia with 2 spurs at the apex, the inner one longer than the outer one (Fig. 3F). Metasoma: T7 with a flattened surface, bifurcated, with a shallow central cleft, short distance between the apices, both ends truncated (Fig. 7F). Color: blackish to ferruginous integument. Head: ferruginous labrum. Blackish face. Ferruginous scape (some specimens with a reddish spot at the apex). Dark brown pedicel. Ferruginous F1 and F11, remainder of flagellum brown. Apical third of the mandible with apical third blackish (some specimens with yellowish-brown tints), rest dark reddish brown. Mesosoma: ferruginous pronotal lobe and tegula. Blackish mesepisternum. Apex of distal process of middle basitarsus reddish brown. Spur of the middle tibia mainly ferruginous, with blackish apices. Wings almost transparent. Forewings with the anterior edge of the marginal cell darker, also presenting a subtly darkened spot that goes from the outer apex of the marginal cell to the wing apex. Brown veins. Ferruginous legs. Blackish propodeum. Metasoma: ferruginous sterna. Surface sculpture: head. Labrum with most of the surface rugose, the basal edge polished. Mesosoma: punctured tegula. Dotted propodeum. Metasoma: polished T7 apical surface. Pubescence: mainly whitish. Head: labrum discal area with pale yellowish plumose setae; lower edge with a pair of long brown tufts; lateral edges with simple brown setae and upper edge bare. Clypeus and suplaclypeal area, with pale yellowish plumose setae. Frons with brown setae. Paraocular area with pale yellowish plumose and simple setae, some specimens with bright yellow setae in the upper region. Vertex and preoccipital region with white compound setae. Gena with white compound setae, except for the brown on lower area. Mesosoma: pronotal lobe, with yellowish anterior margins, white lateral and posterior margins, practically naked posterior surface. Mesepisternum anterior margin with bright yellow and brown setae, some specimens with the lower portion with a black spot, rest of the surface white except for a spot of black setae below the tegula. Scutum anterior area with a characteristic pattern that goes from blackish, passing through yellowish-brown, until reaching whitish in the region of the discal surface, the latter with metallic blue scales and scattered setae (Fig. 29B). Axila lateral edges with black setae. Tegula with white setae on the inner anterior edge and at the posterior apex, and black on the inner and outer anterior edge, rest of the surface bare. Scutellum upper region with few scattered short black setae and metallic blue scales, scutellar tubercles posterior apices with long black setae and with a line of short, branched white setae between them, posterior area with long white, branched setae (Fig. 29B). Metanotum with white setae. Propodeum upper region naked, posterolateral region whitish-light brown. Legs mainly dark. Anterior tibia outer surface scaleless, with a tuft of short plumose white setae on the outer basal surface, with long simple dark setae running from the outer apex of the tibia and extending along the basitarsus. External surface of middle and posterior tibia and basitarsus with metallic blue scales evident on the external surface. Coxa and trochanter with simple long white setae scattered. Metasoma: terga and sterna with metallic blue scales. Sternum disc with scattered long thin white setae. Anterior edge of T1 with thin white moderately bushy setae, lateral edges with a white patch of short plumose setae. Marginal zone of T2 to T4 with a pair of white spots with short pubescence, from T4 onwards they tend to merge with a lateral spot (Fig. 29D). T7 with simple black setae on the sides. T1 to T6 with a lateral stripe of short, branched setae. Sterna setae scattered black. S4 with short, branched brown setae near the apex and with several rows of simple black setae. S2 to S4 with a more or less triangular white spot on the lateral margins.
Figure 26. Mesoplia (M.) rufipes, female: A, lateral habitus; B, dorsal habitus; C, frontal habitus; D, posterior view of the scutellar tubercles.
Allotype: female. Body length 12.3 mm (11-14.3; n = 3), forewing length 12.3 mm (9.3-17.5; n = 3), head length 3.5 mm (n = 3), intertegular distance 3.5 mm (3.4-3.6; n = 3), T2 length 1.8 mm (1.6-1.9; n=3). Head: mandible with an internal tooth. Labrum subrectangular, surface flattened, with a subtly raised preapical margin. Ocelli aligned to the upper margin of the eyes, protruding only a little above the head in lateral view. Mesosoma: convex scutum in lateral view. Scutellar tubercles flattened, with a superficial cleft between them (Fig. 31A, D). Vertical metanotum and propodeum. Medial tibial spine short pointed. Medial tibial spur notably elongated bifurcated near apex, inner tip with a single slender tooth elongated and curved posteriorly, outer apex has a series of 3 or 4 short inner teeth curved anteriorly (Fig. 18D). Basitarsus medium with smooth posterior margin and with flattened distal process slightly curved externally (Fig. 2D). Metasoma: narrow pygidial plate at the base, forming an angle of approximately 30°, apex rounded (Fig. 4H). Color: blackish to ferruginous integument. Head: scape with dark brown inner edge, rest ferruginous. Pedicel also bicolor, dark brown and ferruginous. Flagellum goes from ferrugous in the basal region to dark brown in the distal region. Apical third of mandible blackish, base dark reddish brown, with a yellowish-brown region at base of teeth extending approximately to end of first third. Mesosoma: pronotal lobe, tegula, upper region of the mesepisternum ferruginous. Wings almost transparents; forewings with the anterior edge of the marginal cell darker, also presenting a subtly darkened spot that goes from the outer apex of the marginal cell to the wing apex. Brown veins. Ferruginous legs. Blackish propodeum. Metasoma: dark pygidial plate. Ferruginous sterna. Surface sculpture: head. Labrum with most of the surface rugose, basal edge polished. Mesosoma: punctured tegula. Dotted propodeum. Metasoma: polished pygidial plate. Pubescence: mostly whitish with some blackish areas. Head: labrum with a thick transverse central band of branched white setae and with few scattered brown simple setae; lower edge with a pair of long brown tufts and some short simple brown setae; lateral edges with simple short brown setae and upper edge bare. Clypeus and supraclypeal area with short white plumose setae, discal area with little pubescence, some simple elongated white setae evident in lateral view. Scape with a tuft of short white plumose setae at the outer edge. Frons with brown setae. Paraocular area with short white plumose setae and some long simple. Vertex and preoccipital region with white compound setae. Gena with white compound setae, except for the lower region that has brown. Mesosoma: pronotal lobe with lateral and posterior margins with short white compound setae, with scattered simple blackish setae (Fig. 31C); anterior surface with metallic blue scales, evident in frontal view; discal surface practically naked. Surface surrounding the pronotal lobe with a thick strip of light brown branched short pubescence. Mesepisternum upper surface mainly with white branched short setae, lower surface with metallic blue scales. Scutum anterior area with short and branched setae, with a characteristic pattern, central area with a thin whitish stripe, followed on both sides by a more or less rectangular blackish spot, these followed by a more or less rectangular whitish spot, after them, a quadrangular blackish spot bordered by whitish setae (the whitish areas have interspersed dark setae); discal area with scattered short simple white setae and metallic blue scales, lateral edges with branched short white setae. Tegula with white setae on the inner anterior edge and at the posterior apex, and black on the inner and outer anterior edge, rest of the surface bare. Scutellum upper region with few scattered short black setae and metallic blue scales; bushy black setae at the posterior apices of the tubercles and with a line of short, branched white setae between them, posterior region with long white, branched setae (Fig. 31B, D). Metanotum with white setae. Propodeum upper region naked, posterolateral region whitish-light brown. Legs mainly dark. Anterior tibia outer surface scaleless, with a tuft of short plumose white setae on the outer basal surface, with long simple dark setae running from the outer apex of the tibia and extending along the basitarsus. External surface of middle and posterior tibia and basitarsus with metallic blue scales evident on the external surface. Coxa and trochanter with simple long white setae scattered. Metasoma: terga and sterna with metallic blue scales. Anterior edge of T1 with white simple long setae, lateral apices with a whitish light brown spot. Marginal zone of T2 to T4 with a pair of white spots with short pubescence, in T4 they tend to merge with a lateral spot. Lateral margins of T2 toT5 and S2 to S4with a strip of short white setae (Fig. 31A). T6 with thick black setae on the sides of the naked pygidial plate. Sterna with scattered black setae.
Variation. Some males from Costa Rica also present yellow setae on the white spots of T4 to T6, the white pubescence spots appear from T1 and they all tend to be fused together.
Figure 27. Map with the known distribution of Mesoplia (M.) rufipes.
Taxonomic summary
Type material. Holotype: ♂ ECOAB 566228, MEX. CHIS [Mexico, Chiapas], Arriaga, 16°13’48.00” N, 93°58’48.00” W, 367.5 m, 10-III-2009, R. Vargas (ECOAB). Allotype: ♀ ECOAB 134689, MEX. CHIS [Mexico, Chiapas] La Concordia, 16°3’36.00” N, 92°34’48.00” W, 550 m, 5-III-2020 P. Sagot (ECOAB). Paratypes: ♀ MZUCR HY6837, CR. GUA [Costa Rica, Guanacaste], La Cruz, Cuajiniquil Bahía Tomás, Salinitas, in mangrove, 10°55’17.40” N, 85°42’57.96” W, 7-III-2022/18-III-2022, M. M. Chavarría & P. Hanson (MZUCR); ♂ MZUCR HY10213, CR. GUA [Costa Rica, Guanacaste], La Cruz, Cuajiniquil, Parque Nacional Santa Rosa, 10°54’19.51” N, 85°46’11.78” W, 80 m, 20-II-2024, M. F. Otárola, M. Solano & M. M. Chavarría (MZUCR), ♂ MZUCR HY10221, 10°54’49.68” N, 85°48’15.41” W, 33 m, 21-II-2024, M. F. Otárola, M. Solano & M. M. Chavarría (MZUCR), ♂ MZUCR HY10257, 10°50’20.40” N, 85°37’4.80” W, 295 m, 7-II-2019, J. Lobo (MZUCR), same data as the previous one, ♀ MZUCR HY10257; ♂ ECOAB 566230, GU. HUE [Guatemala, Huehuetenango], San Antonio Huista, 15°40’12.00” N, 91°57’36.00” W, 1,007 m, 20-II-2010, J. Mérida (ECOAB). Same locality as the holotype, 2♀ ECOAB 566231, 566232, 13-III-2009, C. Balboa (ECOAB); same data as the allotype, ♀ ECOAB 134688 (ECOAB); ♂ ECOAB 566229, MEX. CHIS [Mexico, Chiapas], Tonalá, 16°8’24.00” N, 93°40’48.00” W, 407.5 m, 19-I-2009, C. Balboa (ECOAB); ♂ ECOAB 67237, MEX. CHIS [Mexico, Chiapas], Chiapilla, 16°33’0.00” N, 92°0’0.00” W, 561 m, 1-I-2017, P. Sagot; ♂ ECOAB 67320, MEX. CHIS [Mexico, Chiapas], Venustiano Carranza, 16°21’0.00” N, 92°37’12.00” W, 597 m, 1-II-2017, P. Sagot (ECOAB); ♂ ECOAB 67390 MEX. CHIS [Mexico, Chiapas], Solcotenango, 16°9’0.00” N, 92°22’48.00” W, 723 m, 14-I-2017, P. Sagot. (ECOAB); ♂ ECOAB 125155, MEX. CHIS [Mexico, Chiapas], Nicolás Ruiz, 16°28’12.00” N, 92°36’0.00” W, 890 m, 8-III-2020, P. Sagot (ECOAB); ♀ ECO-TAE57096, MEX. CHIS [Mexico, Chiapas], Arriaga, ej. López Mateos, 16°20’46.60” N, 93°58’26.80” W, 255 m, 10-III-2009, C. Balboa, M. Guzmán & M. Cigarroa (EBCH). Same data as the previous one, 2♀ ECO-TAE57326, ECO-TAE57327, 3♂ ECO-TAE67405, ECO-TAE57406, ECO-TAE57407. ♀ HFL JZ5, MEX. JAL [Mexico, Jalisco], La Huerta, Chamela, Estación biológica, vereda Chachalaca, 19°29’37.20” N, 105°2’44.94” W, 300 m, 9-IV-2014/11-IV-2014, E. Ramírez & A. Estrada (CZUG); ♀ CNIN-AP 009852, MEX, OAX [Mexico, Oaxaca], Santa Maria Huatulco, Parque Nacional Huatulco, 15°45’59.40” N, 96°12’11.00” W, 14-IV-2022, A. Saldivar & P. Benítez (CNIN).
Other material examined. ♂ MZUCR HY5700, no collection data (MZUCR).
Etymology. This species is dedicated to Luz del Carmen Fernández Rodríguez, mother of the first author. The noun is feminine and declined in the genitive case.
Distribution. It is only known from Jalisco, Oaxaca and Chiapas in Mexico, Huehuetenango in Guatemala and Guanacaste in Costa Rica, it is highly probable that it is also found in Belize, El Salvador, Honduras and Nicaragua (Fig. 10).
Taxonomic comments. This species is easily recognizable by the middle tibial spur with 2 short arms in respect to the rest of the spur (Figs. 29D, 33D) and with spots of whitish setae on the sublateral area of T2 to T6 in males (Fig. 29D) and T2 to T4 in females (Fig. 31A).
Table 2
Known host associations for species of Mesoplia Lepeletier, 1841.
Cleptoparasite
Hosts
Relationship record
Type of evidence
Reference
Mesoplia (M.) bifrons (Fabricius, 1804)
Centris (Centris) caxiensis Ducke, 1907
Brazil
Confirmed
Rocha-Filho et al. (2009)
Mesoplia (M.) cubensis Genaro & Breto, 2022
Centris (Centris) poecila Lepeletier, 1841
Cuba
Probable
Genaro and Breto (2022)
Mesoplia (E.) decorata (Smith, 1854)
C. (Centris) flavofasciata Friese, 1900
Costa Rica, Guanacaste
Presumed
Vinson et al. (1987)
Mesoplia (M.) dugesi (Cockerell, 1917)
C. (Exallocentris) aterrima Smith, 1854
Mexico
Suspected
Snelling (1984)
Mesoplia (M.) insignis (Smith, 1879)
C. (Acritocentris) agilis Smith, 1874
Mexico, Jalisco
Probable
This work
Mesoplia (M.) regalis (Smith, 1854)
C. (Centris) flavofasciata Friese, 1900
Costa Rica, Guanacaste
Confirmed
Vinson et al. (1987)
C. (Centris) flavifrons (Fabricius 1775)
Brazil, Paraiba
Confirmed
Martins et al.(2014)
Mesoplia (M.) rufipes (Perty, 1833)
C. (Centris) aenea Lepeletier, 1841
Brazil, Cerrado
Probable
Aguiar and Gaglianone (2003); Rocha-Filho et al. (2009)
Mesocheira ornata Spinola, 1841: 145. Holotype: Museo Regionale di Scienze Naturale, Torino, Italy (♀). Type locality: French Guiana, Cayenne.
Diagnosis. Male: body metallic green, bright yellow and black pubescence (Fig. 32); integument of the antenna, pronotal lobe, tegula and legs black, except for some internal regions of the hind leg which are dark reddish; pubescence of the head and mesosoma mostly bright yellow; conical scutellar tubercles, with a noticeable cleft between them; short and wide forked medial tibial spur, with dark reddish integument that becomes blackish at the apex, wide anterior projection, with 2 to 3 internal teeth (Fig. 3G); pubescence of the terga mainly whitish with a bright yellow maculation on both lateral margins of T1 and T2 (Fig. 32A, B); apex of T7 forked, both pointed and bare at tip, median cleft shallow but fairly wide, separating apices considerably (Fig. 7G); S4 bilobed, with several rows of compound pubescence on the apical margin, dark in color in the center and becomes light in the middle of the apices and continues that color towards the lateral edges of the lobes; digitiform and dorsal lobe of the gonostylus of similar size (Fig. 33C, D).
Female: body metallic blue, black and pale yellow pubescence (Fig. 34); integument of antenna, pronotal lobe, tegula and legs black; F1 a little longer than F2; yellowish pubescence in preoccipital region, gena, collar of the pronotum, a broad band in the center of the mesepisternum, the posterior region of the scutellum and metascutum; conical scutellar tubercles, projecting upwards with an evident cleft between them; robust medial tibial spur, bifurcated practically in half, internal tip curved posteriorly, has an internal tooth that in some cases is located on the bifurcation, external apex wider, has 2 internal teeth; pygidial plate, narrow at the base, rounded apex, forming an angle of approximately 35°, glabrous, without scales or hairs (Fig. 34D).
Figure 29. Mesoplia (E.) carmelitae sp. nov. Holotype, male: A, lateral habitus; B, dorsal habitus; C, frontal habitus; D, detail of the metasoma.
Taxonomic summary
Material examined. Costa Rica: Guanacaste: Estación Biológica Maritza, 10°57’25.06” N, 85°29’42.01” W, 573 m, 1988/1999, 1♀ (MZUCR HY6820), 1990, 1♀ (MZUCR HY6822). Mexico: Chiapas: La Concordia, 15°58’48.00” N, 92°48’36.00” W, 581 m, 2-III-2016, P. Sagot, 1♂ (ECOAB 76697).
Distribution. Previously it had only been recorded in South America. If the identity of this species is confirmed, its distribution would expand to southern Mexico in Chiapas (Fig. 10).
Taxonomic comments. The male is similar to M. insignis due to the yellow coloration of the mesosoma. It is differentiated among other characters by the lack of pubescence brush on the inner margin of the posterior tibia (Fig. 3G) and by the shape of the T7 whose internal notch resembles a semicircle (Fig. 7G).
Key for species of Mesoplia Lepeletier, 1841 of Mexico and Central America.
Figure 30. Mesoplia (E.) carmelitae sp. nov. Holotype, male: A, S7. B, S8.C and D, genital capsule, dorsal and lateral view, respectively.
Males
1. Distal inner surface of the posterior tibia, with a setal brush (Fig. 3A-E); hind tibial spurs not reaching beyond basal third of basitarsus, some species with only 1 spur present [M. (Mesoplia)] ………………………………………………………………… 2
– Distal inner surface of the posterior tibia, without a setal brush (Fig. 3F, G); hind tibial spurs reaching to or beyond middle of basitarsus (Fig. 3F), both present M. (Eumelissa) …………………………………………………………………7
2(1). Inconspicuous hind tibia setal brush (Fig. 3D, E); 1 spur on the posterior tibia; ventral basal surface of posterior femur with a robust posterior projection; inner surface of posterior basitarsus with a longitudinal carina (Group azurea) ………………………………………………………………… 3
– Conspicuous hind tibia setal brush (Fig. 3 A-C); 2 spurs on the posterior tibia; ventral basal surface of posterior femur without a robust posterior projection; inner surface of posterior basitarsus without a longitudinal carina (Group bifrons) ………………………………………………………………… 4
3(2). Setae of most of the body mainly dark; metallic scales on the tegula present (Fig. 21B); integument of legs blackish (Mexico) Mesoplia dugesi (Cockerell, 1917)
– Setae of most of the body mainly whitish; metallic scales on the tegula ausent (Fig. 24B); integument of legs redish brown (Mexico to South America) Mesoplia rufipes (Perty, 1833)
– Pubescence of the mesosoma mainly blackish and whitish, if it presents yellowish setae they are restricted to the posterior region of the scutellum ………………………………………………………………… 6
Figure 31. Mesoplia (E.) carmelitae sp. nov. Allotype, female: A, lateral habitus; B, frontal habitus; C, dorsal habitus; D, posterior view of the scutellar tubercles.
5(4). Pubescence of the mesosoma almost exclusively bright yellow; central disc of scutum and dorsal surface of scutellar tubercles with yellow setae; metasoma with a spot of bright yellow pubescence on lateral margins of T1 and T2 (repeated in some specimens until T4) (Fig. 6A); T7 concavity shallow; T7 apices broadly rounded (Fig. 7A) (México) ………………………………………………………………… Mesoplia insignis (Smith, 1879)
– Pubescence of the mesosoma bright yellow interrupted by a broad transverse band in the anterior region; central disc of scutum and dorsal surface of scutellar tubercles with scattered black setae; metasoma with a bright yellow pubescent spot on both lateral margins of T1 (some specimens also with a very small spot on T2) (Fig. 11A); T7 concavity deep; T7 apices narrowly rounded (Fig. 7B) (Costa Rica) ………………………………………………………………… Mesoplia tica sp. nov.
6(4). T7 with apices rounded and setae on ventral side come out a little in dorsal view (Fig. 7C) (Mexico and Central America) ………………………………………………………………… Mesoplia sapphirina Melo & Rocha-Filho, 2011
– T7 with apices flat and with ventral setae below conspicuous in dorsal view (Panama and South America) ………………………………………………………………… Mesoplia regalis (Smith, 1854)
7(1). Pubescence of the head and mesosoma mainly bright yellow; metasoma with spots of pubescence bright yellowon lateral margins of T1 and T2 (Fig. 32A, B); without spots of short white pubescence on the marginal areas of T3 to T6; middle tibial spur with long branches (Fig. 16E) (South of Mexico, Chiapas, to South America) ………………………………………………………………… Mesopliaornata (Spinola, 1841)
Pubescence of the head and mesosoma mainly whitish; without yellow pubescence on the metasoma; with 2 spots of short white pubescence in the marginal zone of T2 to T6 (Fig. 29D); branches of the middle tibial spur short (Fig. 16D) (Mexico, Guatemala and Costa Rica) ………………………………………………………………… Mesoplia carmelitae sp. nov.
Figure 32. Mesoplia (E.) ornata, male: A, lateral habitus; B, dorsal habitus; C, frontal habitus; D, scutellar tubercles posterior view (photos A, B by Jorge Mérida).
Females
1. Pygidial plate broad, occupying the exposed dorsal surface of T6 and covered with scales or setae (Fig. 4A-G); dorsal surface of posterior coxa angulate or carinate at the junction with the lateral surfaces [M. (Mesoplia)] ………………………………………………………………… 2
– Pygidial plate narrow, does not completely occupy the exposed dorsal surface of T6 and without scales or setae (Figs. 4H, 23D); dorsal surface of posterior coxa abruptly rounded at the junction with lateral surfaces [M. (Eumelissa)] …………………………………………………………………9
2(1). Pronotum with a carina extending laterally from the pronotal collar to the pronotal lobe (Fig. 5B) (Group azurea) ………………………………………………………………… 3
– Pronotum without a carina extending laterally from the pronotal collar to the pronotal lobe (Fig. 5A) ………………………………………………………………… 5 Group bifrons (sensu Moure, 1960a, b)
3(2). With metallic scales evident on head and tegula (Mexico) (Fig. 23B) ………………………………………………………………… Mesoplia dugesi (Cockerell, 1917)
– Without metallic scales or inconspicuous on head and tegula ………………………………………………………………… 4
4(3). Setae on most of the body mainly dark; pygidial plate with broad apex (Fig. 4G) (Mexico, Oaxaca) ………………………………………………………………… Mesopliaoaxacana sp. nov.
– Setae of most of the body mainly whitish; pygidial plate with narrow apex (Fig. 4F) (Mexico to South America) ………………………………………………………………… Mesoplia rufipes (Perty, 1833)
5(2). With bright yellowpubescence on head, mesosoma and metasoma (Fig. 20) (Mexico, Veracruz) ………………………………………………………………… Mesoplia veracruzana sp. nov.
– Without bright yellow pubescence on head, mesosoma and metasoma ………………………………………………………………… 6
6(5). With metallic scales very evident on the scape and tegula; forewings evenly smoked ………………………………………………………………… 7
– Without metallic scales on the scape and tegula or not very evident; forewings with a darker spot at the apex ………………………………………………………………… 8
7(6). Head pubescence mainly black (Fig. 9C); scutellar tubercles moderately projecting upwards (Fig. 9D); truncated pygidial plate with dark setae on the surface (Fig. 4A) (Mexico) ………………………………………………………………… Mesoplia insignis (Smith, 1879)
– Head pubescence mainly whitish (Fig. 13C); scutellar tubercles strongly projecting upwards (Fig. 13A); rounded pygidial plate with scales on the surface, in some specimens they do not reach the apex due to the abrasion of these (Fig. 4B) (Costa Rica)………………………………………………………………… Mesoplia tica sp. nov.
Figure 33. Mesoplia (E.) ornata, male: A, S7. B, S8. C and D, genital capsule, dorsal and lateral view, respectively.
8(6). Poorly developed scutellum protuberances with a shallow depression between them and low tubercles (Fig. 16A, D); the carina of the scutellum runs continuously from one side to the other (Mexico and Central America) ………………………………………………………………… Mesoplia sapphirina Melo & Rocha-Filho, 2011
– Scutellum protuberances developed with a deep depression between them and conspicuously pointed tubercles; the carina of scutellum most developed along tubercles, gradually fading to sides (Panamá and South America) ………………………………………………………………… Mesoplia regalis (Smith, 1854)
9(1). With pale yellow pubescence on the mesosoma (Fig. 34A-C); T2 to T5 without white pubescent spots; long middle tibial spur branches (South of Mexico, Chiapas, to South America) ………………………………………………………………… Mesoplia ornata (Spinola, 1841)
– Without pale yellow pubescence on the mesosoma; T2 to T5 with a couple of spots of appressed white pubescence in the marginal zone (Fig. 31A); short middle tibial spur branches (Fig. 18D) (Mexico, Guatemala and Costa Rica) ………………………………………………………………… Mesoplia carmelitae sp. nov.
Hosts. Like the rest of the members of the Ericrocidini tribe, species of the genus Mesoplia are cleptoparasites of several species of the Centridini tribe (Table 2). It should be noted that M. rufipes is the only species of the tribe that has been recorded cleptoparasitizing species of Epicharis. The cleptoparasitism relationship between M. insignis and Centris agilis was recorded for the first time in Jalisco, Mexico. The first author of this work had the opportunity to collect some specimens of this species in an aggregation of C. agilis nests in a suburban site.
Floral asossitations. The floral records reported in this section are based on information extracted directly from the collection tags of the specimens reviewed in this study (Table 3).
Figure 35. Species of Mesoplia in nature. A-B, Mesoplia (M.) insignis on Ramirezella sp. in Jalisco, México. A, male; B, female (photos by the first author). C, Mesoplia (M.) tica sp. nov. female on Stachytarpheta sp. in Alajuela, Costa Rica (photo by Daniel Garrigues). D, Mesoplia (M.) veracruzana sp. nov. female on Ipomoea sp. in Veracruz, Mexico (photo by Gerardo Quintos-Andrade). E, Mesoplia (M.) dugesi male on Tecoma stans in Querétaro, Mexico (photo by Belem Hernández). F, Mesoplia (M.) rufipes male on Duranta sp. in San José, Costa Rica (photo by “Homúnculo Daimon”).
Discussion
The complexity of the genus Mesoplia has previously been recognized for regions like the Caribbean. There is inaccurate information on its distribution due to taxonomic problems, which has caused erroneous identifications (Genaro & Breto, 2022; Genaro & Franz, 2008). For Mexico, difficulty in accessing the primary types deposited in institutions outside the country complicates the taxonomic understanding of the group. However, there are quality images available that have allowed this review, obtaining a reliable list and synonymizing the names that were required v. gr. M. insignis (Smith, 1879) and M. imperatrix (Friese, 1912), a species easily recognizable in the end.
Most of the of the species in this study present morphological characters that make them easily differentiated. However, 2 pairs of species, M. regalis and M. sapphirina; as well as M. dugesi and M. oaxacana, are quite similar to each other, particularly the females, which complicates their differentiation. Here we provide characters that allow the unequivocal identification of the mentioned species, such as scutellar tubercles and pygidial plate. Additionally, variation in characters of the male of M. rufipes, including shape of S8 and shape of the basal projection of the posterior femur, hint to the possibility that M. rufipes is a species complex, but more evidence is needed including molecular studies.
Table 3
Floral records of the species of Mesoplia Lepeletier, 1841.
Species
Plant
Family
Mesoplia (M.) dugesi (Cockerell, 1917)
Tecoma stans
Bignoniaceae
Canavalia villosa
Fabaceae
Crotalaria sp.
Libidibia sclerocarpa
Macroptilium atropurpureum
Mesoplia (M.) insignis (Smith, 1879)
Eryngium sp.
Apiaceae
Macroptilium atropurpureum
Fabaceae
Ramirezella sp.
Vitex pyramidata
Lamiaceae
Cuphea lanceolata
Lythraceae
Hibiscus tiliaceus
Malvaceae
Mesoplia (M.) regalis (Smith, 1854)
Antigonon leptopus
Polygonaceae
Mesoplia (M.) rufipes (Perty, 1833)
Ipomoea violacea
Convolvulaceae
Tabebuia rosea
Bignoniaceae
Tecoma stans
Caesalpinia sp.
Fabaceae
Haematoxylon brasiletto
Hyptis albida
Lamiaceae
Cuphea sp.
Lythraceae
Genipa americana
Rubiaceae
The association of cleptoparasitism between M. insignis and Centris agilis supports the observations of Lim et al. (2022), they observed a considerable increase in the body size of Ericocidini that could be influenced by a change of host; and supports Harrison’s rule, since both species are of similar sizes (Harrison, 1915). Therefore, in some cases where the host is unknown, it could at least be inferred. For example, M. carmelitae sp. nov. is a relatively small bee within the genus, so it is expected that its host will be a bee from the Centridini tribe of similar size (approx. 11.395 mm) and distributed in the same geographical area. There is an opportunity to study cleptoparasite-host relationships between bees of the tribe Centridini and Ericrocidini, in sites where it is known that nest aggregations periodically occur, in addition to increasing information about the immature stages of both groups.
With this research, the region studied reaches South America with 10 species of Mesoplia, despite this it is expected that there are still several species to be described for that region since Ericrocidini is richer in that region (Snelling & Brooks, 1985). Furthermore, the distribution of some of the species recognized in this work could be broader, since there is a significant information gap across some Central American countries. The area included in this study has little diversity of species of the subgenus Eumelissa, with only 2 of the 10 known species. Furthermore, the data obtained extends the distribution of Eumelissa at least to Central Mexico on the Pacific Slope (particularly in Jalisco), far north of the previous northern limit in Costa Rica (Snelling & Brooks, 1985).
Acknowledgements
This article serves as fulfillment of the first author for obtaining the degree of M.Sc. degree with emphasis on Systematics of the Posgrado en Ciencias Biológicas at the UNAM. This study was financially supported by the student grants: Beca Nacional para Estudios de Posgrado 2022 – 1 Conahcyt No. 814906 and Programa de Apoyo a los Estudios de Posgrado (PAEP) 2023. We want to thank José Luis Navarrete(CZUG), Hugo Fierros (CZUG and HFL), Jorge E. Valenzuela, Viridiana Vega, Gerardo Quintos-Andrade (IEXA), Rémy Vandame, Jorge A. Mérida Rivas, Philippe Sagot (ECOAB), Virginia Meléndez Ramírez, María José López Gómez (CER-UADY), Zachary Falin, Michael Engel, Rachel Osborn (SEMC), Maricelle Méndez, Marcela Sánchez (MNCR), Mauricio Fernández, Paul Hanson (MZUCR), Mario Gallardo, Eduardo Herrera (CINAT) for the loan of specimens and/or for the information provided about the specimens of Mesoplia deposited in their collections. We thank Stefanie Krause (ZMB) and Corey Smith (AMNH), who sent us photographs of some type specimens. We thank again Jorge Mérida (ECOAB), Marcela Sánchez (MNCR), José Luis Navarrete (CZUG), Adam Karremans (Director of Jardín Botánico Lankaster, UCR) and Nicolás Rengifo Alfonso (MZUCR) for letting and helping us to use the imaging system to take the photographs. We want to thank Daniel Garrigues, Gerardo Quintos-Andrade, Belem Hernández and “Homúnculo Daimon” for the photographs of Mesoplia in nature. Finally, we thank the reviewers that helped to improve this article.
References
Aguiar, A. M. L., & Ganglianone, M. C. (2003). Nesting biology of Centris (Centris) aenea Lepeletier (Hymenoptera, Apidae, Centridini. Revista Brasileira de Zoologia, 20, 601–606. https://doi.org/10.1590/S0101-81752003000400006
Coville, R. E., Frenkie, G. W., & Vinson, S. B. (1983). Nests of Centris segregata (Hymenoptera: Anthophoridae) with a Review of the Nesting Habits of the Genus. Journal of the Kansas Entomological Society, 56, 109–122.
Gaglianone, M. C. (2005). Nesting biology, seasonality, and flower hosts of Epicharis nigrita (Friese, 1900) (Hymenoptera: Apidae: Centridini), with a comparative analysis for the genus. Studies on Neotropical Fauna and Environment, 40, 191–200. https://doi.org/10.1080/01650520500250145
Genaro, J. A., & Franz, N. M. (2008). The bees of Greater Puerto Rico (Hymenoptera: Apidae: Anthophila). Insecta Mundi, 40, 1–24.
Genaro, J. A., & Breto, D. (2022). Descripción de dos especies nuevas de Mesoplia Lepeletier (Hymenoptera: Apoidea: Apidae) para Cuba y Las Bahamas, con notas sobre taxonomía y distribución del género en las Antillas. Insecta Mundi, 929, 1–17.
Harris, R. A. (1979). A glossary of surface sculpturing. Occasional Papers in Entomology, 28, 1–32.
Harrison, L. (1915). Mallophaga from Apteryx, and their signifcance; with a note on the genus Rallicola. Parasitology, 8, 88–100.
Hiller, B., & Wittmann, D. (1994). Seasonality, nesting biology and mating behavior of the oil-collecting bee Epicharis dejeanii (Anthophoridae, Centridini). Biociências, 2, 107–124.
Lim, K., Lee, S., Orr, M., & Lee, S. (2022). Harrison´s rule corroborated for the body size of cleptoparasitic cuckoo bees (Hymenoptera: Apidae: Nomadinae) and their hosts. Scientific Reports, 12, 10984. https://doi.org/10.1038/s41598-022-14938-9
Lobo, J. A., Fernández-Otárola, M., Chavarría, M. M., & Agraz-Hernández, C. M. (2023). Nesting biology of Centris aethyctera (Centridini, Apidae) in an estuarine environment. Apidologie, 54, 58. https://doi.org/10.1007/s13592-023-01044-6
Martins, A. C., Luz, D. R., & Melo, G. A. R. (2018). Palaeocene origin of the Neotropical lineage of cleptoparasitic bees Ericrocidini-Rhathymini (Hymenoptera, Apidae). Systematic Entomology, 43, 510–521. https://doi.org/10.1111/syen.12286
Martins, C. F., Neto V. I. S., & Cruz, R. D. M. (2019). Nesting biology and mating behavior of the solitary bee Epicharis nigrita (Apoidea: Centridini). Journal of Apicultural Research, 58, 1–11. https://doi.org/10.1080/00218839.2019.1584963
Martins, C. F., Peixoto, M. P., & Aguiar, C. M. L. (2014). Plastic nesting behavior of Centris (Centris) flavifrons (Hymenoptera: Apidae: Centridini) in an urban area. Apidologie, 45, 156–171. https://doi.org/10.1007/s13592-013-0235-4
Michener, C. D. (2007). The bees of the World(2nd Edition). Baltimore, Maryland: The Johns Hopkins University Press.
Moure, J. S. (1960a). Notas sobre os tipos de abelhas do Brasil descritas por Perty em 1833 (Hymenoptera – Apoidea). Boletim da Universidade do Paraná, Zoologia, 1, 1–23.
Moure, J. S. (1960b). Notes on the types of the Neotropical bees described by Fabricius (Hymenoptera: Apoidea). Studia Entomologica, 3, 97–160.
Moure, J. S., & Melo, G. A. R. (2023). Mesoplia Lepeletier, 1841. In J. S. Moure, D. Urban, & G. A. R. Melo (Orgs.), Catalogue of bees (Hymenoptera, Apoidea) in the Neotropical Region. Retrieved on 30 May 2024 from: http://moure.cria.org.br/catalogue?id=113174
QGIS.org (2022). QGIS Geographic Information System. QGIS Association. http://www.qgis.org
Rocha-Filho, L. C., Morato, É. F., & Melo, G. A. R. (2009). New host records of Aglaomelissa duckei and a compilation of host associations of ericrocidini bees (hymenoptera: Apidae). Zoologia, 26, 299–304. http://dx.doi.org/10.1590/S198446702009000200012
Rocha-Filho, L. C., Silva, C. I., Gaglianone, M. C., & Augusto, S. C. (2008). Nesting behavior and natural enemies of Epicharis (Epicharis) bicolor Smith (Hymenoptera: Apidae). Tropical Zoology, 21, 227–242.
Rozen, J. G. (1969). The larvae of the Anthophoridae (Hymenoptera, Apoidea). Part 3. The Melectini, Ericrocidini, and Rhathymini. American Museum Novitates, 2382, 1–24.
Rozen, J. G. (2016). Nesting biology of the solitary bee Epicharis albofasciata (Apoidea: Apidae: Centridini). American Museum Novitates, 3869, 1–8. https://doi.org/10.1206/3869.1
Rozen, J. G., Vinson, S. B., Coville, R. E., & Frankie, G. W. (2011). Biology of the cleptoparasitic bee Mesoplia sapphirina (Ericrocidini) and its host Centris flavofasciata (Centridini) (Apidae: Apinae). American Museum Novitates, 3723, 1–36. https://doi.org/10.1206/3723.2
Silveira, F. A., Melo, G. A. R., & Almeida, E. A. B. (2002). Abelhas brasileiras: sistemática e identificação. Belo Horizonte, Minas Gerais: Ministério do Meio Ambiente & Fundação Araucária.
Snelling, R. R. (1984). Studies on the taxonomy and distribution of American Centridine bees (Hymenoptera: Anthophoridae). Contributions in Science, Natural History Museum of Los Angeles County, 347, 1–69.
Snelling, R. R., & Brooks, R. W. (1985). A review of the genera of cleptoparasitic bees of the Tribe Ericrocidini (Hymenoptera: Anthophoridae). Contributions in Science, Natural, History Museum of Los Angeles County, 369, 1–34.
Vinson, S. B., Frankie, G. W., & Coville, R. E. (1987). Nesting habits of Centris flavofasciata Friese (Hymenoptera: Apoidea: Anthophoridae) in Costa Rica. Journal of the Kansas Entomological Society, 60, 249–263.
Vivallo, F. (2010). Sistemática e filogenia da tribo de abelhas Centridini e suas relações filogenéticas com as tribos cleptoparasitas Ericrocidini e Rhathymini (Hymenoptera: Apidae)(Ph.D. Thesis). Universidade Federal do Paraná. Curitiba, Brazil.
Vivallo, F. (2014). Taxonomic revision of the cleptoparasitic bee genus Epiclopus Spinola, 1851 (Hymenoptera: Apidae: Ericrocidini). Zootaxa, 3857, 41–70. https://doi.org/10.11646/zootaxa.3857.1.2
Vivallo, F. (2021). Nesting behavior of the oil-collecting bee Epicharis (Triepicharis) analis Lepeletier (Hymenoptera: Apidae) in an urban area of Rio de Janeiro, RJ, Brazil. Journal of Apicultural Research, 60, 135–142. https://doi.org/10.1080/00218839.2020.1820150
Werneck, H. A., & Campos, L. A. O. (2020). A study of the biology of Epicharis (Epicharoides) picta using emergence-traps. Journal of Hymenoptera Research, 80, 147–167. https://doi.org/10.3897/jhr.80.56898
Daniel López-Sandoval a, b, *, Griselda Montiel-Parra a, Tila M. Pérez a
a Universidad Nacional Autónoma de México, Instituto de Biología, Departamento de Zoología, Colección Nacional de Ácaros, Tercer Circuito Exterior s/n, Ciudad Universitaria, Coyoacán, 04510 Ciudad de México, Mexico
b Universidad Nacional Autónoma de México, Posgrado en Ciencias Biológicas, Instituto de Biología, Departamento de Zoología, Colección Nacional de Ácaros, Tercer Circuito Exterior s/n, Ciudad Universitaria, Coyoacán, 04510 Ciudad de México, Mexico
*Corresponding author: danielbiologia@comunidad.unam.mx (D. López-Sandoval)
Received: 19 April 2024; accepted: 30 October 2024
Five samples of mosses and 2 samples of lichens were collected within the Cantera Oriente, in southern Mexico City. In total, 110 tardigrades and 27 eggs, belonging to 2 orders (Apochela and Parachela), 4 families (Milnesiidae, Hypsibiidae, Macrobiotidae, and Ramazzottiidae), 6 genera (Milnesium, Hypsibius, Notahypsibius, Minibiotus, Paramacrobiotus, and Ramazzottius) and 9 species were recorded. Milnesium longiungue Tumanov, 2006, Notahypsibius pallidoides Pilato, Kiosya, Lisi, Inshina and Biserov, 2011 and Paramacrobiotus gadabouti Kayastha, Stec, Mioduchowska and Kaczmarek, 2023, represent new records for Mexico. The species Paramacrobiotuspuma sp. nov. is new to science and its description is provided and supported by phase contrast light microscopy (PCM), scanning electron microscopy (SEM) and analysis of nucleotide sequences of 3 nuclear and 1 mitochondrial markers. The new records increase the diversity of the phylum to 87 species in the country.
Keywords: Tardigrada; Diversity; REPSA; Mexico City
Nuevos registros de tardígrados de México con la descripción de Paramacrobiotus puma sp. nov. (Eutardigrada: Macrobiotidae)
Resumen
Se recolectaron 5 muestras de musgo y 2 muestras de líquenes dentro de la Cantera Oriente en el sur de la Ciudad de México. En total, se registraron 110 tardígrados y 27 huevos pertenecientes a 2 órdenes (Apochela y Parachela), 4 familias (Milnesiidae, Hypsibiidae, Macrobiotidae y Ramazzottiidae), 6 géneros (Milnesium, Hypsibius, Notahypsibius, Minibiotus, Paramacrobiotus y Ramazzottius) y 9 especies. Milnesiumlongiungue Tumanov, 2006, Notahypsibiuspallidoides Pilato, Kiosya, Lisi, Inshina y Biserov, 2011 y Paramacrobiotusgadabouti Kayastha, Stec, Mioduchowska y Kaczmarek, 2023, representan nuevos registros para México. La especie Paramacrobiotuspuma sp. nov. es nueva para la ciencia y se proporciona su descripción, respaldada por microscopía óptica de contraste de fases (MCF), microscopía electrónica de barrido (MEB) y análisis de secuencias de nucleótidos de 3 marcadores nucleares y 1 mitocondrial. Estos nuevos registros incrementan la diversidad del grupo a 87 especies en el país.
Palabras clave: Tardigrada; Diversidad; REPSA; Ciudad de México
Introduction
Tardigrades (tardus = slow, gradus = step or “slow-stepper”) have commonly been called “water bears” due to their bear-like appearance, legs with claws, and slow lumbering gait (Nelson et al., 2015, 2018). These micrometazoans are found in a wide variety of marine, freshwater and terrestrial habitats, such as tropical forests and polar and arid deserts, from mountains to the depths of the oceans, and inhabit mainly mosses and lichens (Nelson & Marley, 2000; Nelson et al., 2015; Ramazzotti & Maucci, 1983). Being hydrophilic organisms, they need an aqueous medium to move and carry out their life cycle. Particularly terrestrial tardigrades depend on water films that adhere to the substrates where they live (Glime, 2017; Nelson et al., 2015).
To date, more than 1,400 species of tardigrades have been described in 3 classes (Eutardigrada, Heterotardigrada, and Mesotardigrada) (Bertolani et al., 2014; Degma & Guidetti, 2024; Guidetti & Bertolani, 2005). As for Mexico, 83 species have been recorded in 16 of the 32 states: Baja California, Chiapas, Chihuahua, Coahuila, Mexico City, Michoacán, Morelos, Nuevo León, Oaxaca, Quintana Roo, San Luis Potosí, Sinaloa, Sonora, Estado de México, Tamaulipas and Yucatán (Anguas-Escalante et al., 2020; Beasley, 1972; Beasley et al., 2008; Dueñas-Cedillo et al., 2020, 2024; García-Román et al., 2022; Heinis, 1911; Kaczmarek et al., 2011; León-Espinosa et al., 2017, 2019; Moreno-Talamantes & León-Espinosa, 2019; Moreno-Talamantes et al., 2015, 2019, 2020; May, 1948; Núñez et al., 2021; Pérez-Pech et al., 2017, 2018, 2020; Pilato, 2006; Pilato & Lisi, 2006; Ramazzotti & Maucci, 1983; Schuster, 1971). The presence of tardigrades in the rest of the Mexican territory is unknown. In this article, we present new records of tardigrades found in samples of mosses and lichens collected in the Cantera Oriente, buffer zone that belongs to the Pedregal de San Angel Ecological Reserve (REPSA), southern Mexico City. We describe a new species, Paramacrobiotus puma sp. nov., by using an integrative approach, including morphological analysis with phase-contrast microscopy (PCM), scanning electron microscopy (SEM) as well as DNA sequencing.
Materials and methods
Five samples of mosses and 2 samples of lichens were collected within the Cantera Oriente (19°19’00.5” N, 99°10’21.5” W; 2,260 m asl) on October 2, 2015, and August 30, 2016, respectively. The area is composed mainly of high elevation xerophilic scrub and is located in southern Mexico City and corresponds to the Buffer Zone (A3) of the Pedregal de San Ángel Ecological Reserve (REPSA) (Fig. 1), produced by the Xitle Volcano’s eruption approximately 1,670 years ago. This ecological reserve is a conservation area created in 1983 within the campus of the Universidad Nacional Autónoma de México (UNAM). The objective of the reserve is to maintain an area of biological and cultural diversity containing the last remnants of natural ecosystems in the southern Mexico Basin (Palacio & Guilbaud, 2015). The samples covered an area of approximately 5 cm2 and were deposited in brown paper bags and taken to the laboratory for examination. The specimens were collected under the Scientific Collector Permits FAUT-0027 and FAUT-209 granted by Semarnat and with project 361 issued by the Executive Secretariat of REPSA. Tardigrade specimens were deposited in the Colección de Tardígrados associated with the Colección Nacional de Ácaros (CNAC), Instituto de Biología, UNAM, Mexico City.
Tardigrades and eggs were extracted from the samples using the technique described by Dastych (1985). Specimens for light microscopy were mounted on slides with Hoyer’s liquid and were observed under the microscope Nikon Optiphot-2 using phase contrast microscopy (PCM). Some specimens were separated for Scanning Electron Microscopy (SEM) and were prepared according to the technique described by Stec et al. (2015). Images were obtained in a SEM Hitachi, model SU 1510 at the Laboratorio Nacional de la Biodiversidad (LANABIO), Instituto de Biología, Universidad Nacional Autónoma de México.
Figure 1. View of collection site within the buffer zone (A3), and map indicating location of the Cantera Oriente and Pedregal de San Ángel Ecological Reserve (REPSA), CDMX, Mexico. Map by D. López-Sandoval.
The sample size for morphometrics was chosen following recommendations by Stec et al. (2016). All measurements are in micrometers (µm). For the measurements, terminology of the structures and claws of the buccopharyngeal apparatus follow Pilato and Binda (2010) and Michalczyk and Kaczmarek (2003). The claw measurements were according to Beasley et al. (2008) and Kaczmarek and Michalczyk (2017). The macroplacoid length sequence was determined according to Kaczmarek, Cytan et al. (2014) and Kaczmarek and Michalczyk (2017). The terminology and measurements for Apochela follow Tumanov (2006), Michalczyk et al. (2012a, b), and Pilato et al. (2016). The pt ratio is the relation between the length of a given structure and the length of the buccal tube, expressed as a percentage (Pilato, 1981). Morphometric data was managed using templates “Parachela” and “Apochela”. Versions 1.2 for both templates are available in the Tardigrada Register (Michalczyk & Kaczmarek, 2013). Tardigrade taxonomy follows Bertolani et al. (2014) and Stec et al. (2021). The morphometric data is given in supplementary material (SM1).
The specimens examined were identified with taxonomic keys and compared with original species descriptions and other useful literature: Tumanov (2006, 2020), Pilato and Lisi (2006), Claxton (1998), Guidetti et al. (2009, 2022), Pilato and Binda (2010), Michalczyk et al. (2012a, b), Pilato et al. (2016), Kaczmarek et al. (2017), Gąsiorek, Stec, Morek et al. (2018), Stec, Morek et al. (2018), Moreno-Talamantes et al. (2019, 2020), Dueñas-Cedillo et al. (2020), Morek and Michalczyk (2020), Stec, Morek et al. (2018), Stec, Roszkowska et al. (2018), Stec, Kristensen et al. (2020), Stec, Krzywański et al. (2020), Rocha et al. (2022), Kayastha, Mioduchowska et al. (2023), Kayastha, Stec et al. (2023). For comparison with the new species, we also examined the following type material deposited at the Institute of Zoology and Biomedical Research, Jagiellonian University, Gronostajowa, Kraków, Poland: Paramacrobiotusareolatus (Murray, 1907) (slides NO.385.63 – NO.385.71, NO.385.75 – NO.385.78 and NO.385.81) and P. lachowskae Stec, Roszkowska, Kaczmarek and Michalczyk, 2018 (slides CO.018.04 – CO.018.21).
Before DNA extraction, specimens were mounted in water on a glass slide and examined under a Nikon Optiphot-2 optical microscope to confirm identification. The DNA was extracted from individual animals following a modified protocol by Casquet et al. (2012), using the Chelex® 100 resin (Bio-Rad) extraction method. Each specimen was placed individually in a 1.5 ml Eppendorf microcentrifuge tube, in 50 μl of a 5% suspension of 75-150 μm wet bead size Chelex® 100 resin (Bio-Rad) in ddH2O with the addition of 3.5 μl Proteinase K (A&A Biotechnology) and incubated at 56 ºC for 1 h. Then, tubes were incubated at 95 ºC for 30 min and centrifuged at 4,500 rpm for 15 min. After that, the supernatant was transferred to new 1.5 ml tubes and stored at -20 ºC. After the extraction, the hologenophores (Pleijel et al., 2008), were mounted in Hoyer’s medium. Four DNA fragments were sequenced: the small ribosome subunit (18S rRNA, nDNA), the large ribosome subunit (28S rRNA, nDNA), the internal transcribed spacer 2 (ITS-2, nDNA), and the cytochrome oxidase subunit I (COI, mtDNA). Primers and original references for specific PCR programs for amplification of the fragments are listed in Table 1.
For every PCR reaction, the solution contained 9.5 μl ddH2O, 3 μl 5x MyTaq Reaction Buffer (Bioline™), 0.2 μl 10 mM forward primer, 0.2 ml 10 mM reverse primer, 0.1 μl MyTaq™ DNA Polymerase, (Bioline™) (5U/μl), and 2 μl of genomic DNA extract. The PCR products were controlled by 1.5% agarose gel electrophoresis stained with GelRed Nucleic Acid Gel Stain, 10,000X (Biotium™) and purified with the ExoSap-IT enzyme (Applied Biosystems), following the manufacturer’s instructions. The sequence reaction was prepared with 4 μl of water, 2 μl of Buffer 5X, 2 μl of big dye Terminator v3.1 (Applied Biosystems), 1 μl of the primer, and 2.5 μl of the purified product. The reaction was placed in a PCR 2720 with the program suggested by the manufacturer. When finished, they were purified with Sephadex CentriSep™ plates (Princeton) and read in a 3730xl sequencer (Applied Biosystems), at the LANABIO.
All sequences were assembled, manually inspected, and processed in SeqTrace (Stucky, 2012) and submitted to GenBank.
The identity of the obtained sequences was verified using the Basic Local Alignment Search Tool (Altschul et al., 1990). As a support for the morphological comparisons between the new species and other Paramacrobiotus species, several sequences deposited in GenBank of the 4 sequenced markers were used to calculate the uncorrected genetic distances (p-distance), applying the program MEGA X (Kumar et al., 2018). The distance matrices are provided in the supplementary material (SM2).
In order to establish the phyletic position of the new species, a phylogenetic tree was constructed using the concatenated 18S rRNA + 28S rRNA + ITS-2 + COI sequences of the genus Paramacrobiotus with the sequences of 2 Minibiotus species as an outgroup (Table 2). Sequences of the newly barcoded species and sequences of species obtained from GenBank were aligned with the MAFFT algorithm version 7 (Katoh et al., 2002) implemented in the MAFFT online service (Katoh et al., 2019). Sequences were checked by visual inspection and translated to amino acids by using the invertebrate mitochondrial code implemented in MEGA X (Kumar et al., 2018) to check for the presence of pseudogenes. The sequences were concatenated using SequenceMatrix (Vaidya et al., 2011) and before partitioning, the concatenated alignment was divided into 6 data blocks constituting 3 separate blocks of ribosomal markers and 3 separate blocks of 3 codon positions in the COI data set. We selected the best scheme of partitioning with the program ModelFinder (Kalyaanamoorthy et al., 2017) and the best substitution model for the posterior phylogenetic analysis using ModelTest-NG (Darriba et al., 2020). The best-fit substitution model for each partition under the Bayesian Information Criterion (BIC) was: GTR+G4 for the first and the second codon positions and GTR+I+G4 for the third codon position in COI data set. As for the ribosomal markers the best-fit model was: HKY+G4 for ITS2 marker data set, HKY+I+G4 for 28S marker data set and HKY+I for 18S marker data set. Bayesian inference (BI) marginal posterior probabilities were calculated using MrBayes version 3.2 (Ronquist & Huelsenbeck, 2003). The analysis was run for 10 million generations using random starting trees and sampling the Markov chain every 1,000 generations. An average standard deviation of split frequencies of < 0.01 was used as a guide to ensure the 2 independent analyses had converged. To ensure Markov chains had reached stationarity and to determine the correct “burn-in” for the analysis (which was the first 10% of generations), the program Tracer version 1.7 (Rambaut et al., 2018) was used. The ESS values were > 200 and the consensus tree was obtained after summarizing the resulting topologies and discarding the “burn-in”. Additionally, a maximum likelihood (ML) analysis was run using Iqtree2 (Minh et al., 2020) and the branch support values of the ML tree were measured using 1,000 ultrafast bootstrap replicates (UFBoot) (Hoang et al., 2018). The final consensus trees were viewed and edited in FigTree version 1.4.4 available from http://tree.bio.ed.ac.uk/software/figtree
Results
We obtained 110 tardigrades and 27 eggs from the class Eutardigrada. The specimens examined belong to 2 orders (Apochela and Parachela), 4 families (Milnesiidae, Hypsibiidae, Macrobiotidae, and Ramazzottiidae), 6 genera (Milnesium, Hypsibius, Notahypsibius, Minibiotus, Paramacrobiotus, and Ramazzottius) and 9 species are recorded. We found 3 species which correspond to new records for Mexico and for Mexico City, and 1 species is new to science.
Class Eutardigrada Richters, 1926
Order Apochela Schuster, Nelson, Grigarick and Christenberry, 1980
Family Milnesiidae Ramazzotti, 1962
Genus Milnesium Doyère, 1840
Milnesium longiungue Tumanov, 2006
(Fig. 2A-C)
Taxonomic summary
Type locality: Hymalaia, India.
Material examined: Mexico: Mexico City: Cantera Oriente (19°19’00.5” N, 99°10’21.5” W; 2,260 m asl), 8 specimens (CNAC-Tar000243 – CNAC-Tar000250). Coll. D. López and G. Montiel.
Habitat: high elevation xerophilic scrub. Elevation: 2,260 m asl.
Microhabitat: mossesof the species Thuidium delicatulum (Hedw.) Schimp. collected on a rock.
Remarks. The specimens examined correspond well to the original description by Tumanov (2006). The cuticle is smooth and white colored, the eyes are present, 6 peribuccal lamellae are present, accessory points on primary branches are absent, secondary branches of external claws I-III and of posterior claws IV with 3 points (claw configuration [3-3] – [3-3]), pt of the primary branch IV length is between 82-91% and cuticular bars under the I-III are present. This species has been recorded previously in China (Beasley & Miller, 2007). This is the second record of the species outside the type locality in Hymalaia, India. New record for Mexico.
Milnesium cf. reductum
Taxonomic summary
Material examined: Mexico: Mexico City: Cantera Oriente (19°19’00.5” N, 99°10’21.5” W; 2,260 m asl), 5 specimens (CNAC-Tar000238 – CNAC-Tar000242). Coll. D. López and G. Montiel.
Table 1
PCR primers for amplification of the 4 DNA fragments sequenced in the present study.
DNA marker
Primer name
Primer direction
Primer sequence (5’-3’)
Source
PCR programme source
18S rRNA
SSU01_F
forward
AACCTGGTTGATCCTGCCAGT
Sands et al.(2008)
Zeller (2010)
SSU82_R
reverse
TGATCCTTCTGCAGGTTCACCTAC
28S rRNA
28S_Eutar_F
forward
ACCCGCTGAACTTAAGCATAT
Gąsiorek, Stec, Zawierucha et al. (2018)
Stec, Kristensen et al. (2020)
28SR0990
reverse
CCTTGGTCCGTGTTTCAAGAC
Mironov et al. (2012)
ITS-2
ITS2_Eutar_Ff
forward
CGTAACGTGAATTGCAGGAC
Stec, Morek et al. (2018)
Stec, Kristensen et al. (2020)
ITS2_Eutar_Rr
reverse
TCCTCCGCTTATTGATATGC
COI
COI_Para_F
forward
GGTCAACAAATCATAAAGATATTGG
Gąsiorek et al. (2017)
Michalczyk et al. (2012a)
COI_Mac_Rr
reverse
TAAACTTCAGGGTGACCAAAAAATCA
Stec, Krzywański et al. (2020)
Table 2
Accession numbers sequences used for phylogenetic analysis downloaded from GenBank.
Taxon
18S rRNA
28S rRNA
ITS-2
COI
Source
Paramacrobiotus aff. richtersi BR.009 1
MH664934
MH664952
MH666082
MH676000
Stec, Krzywański et al. (2020)
Paramacrobiotus aff. richtersi BR.009 2
–
–
–
MH676001
Stec, Krzywański et al. (2020)
Paramacrobiotus aff. richtersi BR.009 3
–
–
–
MH676002
Stec, Krzywański et al. (2020)
Paramacrobiotus aff. richtersi HU.012 1
MH664936
MH664954
MH666084
MH676005
Stec, Krzywański et al. (2020)
Paramacrobiotus aff. richtersi HU.012 2
–
–
–
MH676006
Stec, Krzywański et al. (2020)
Paramacrobiotus aff. richtersi MG.002 1
MH664938
MH664956
MH666086
MH676008
Stec, Krzywański et al. (2020)
Paramacrobiotus aff. richtersi MG.002 2
–
–
MH666087
–
Stec, Krzywański et al. (2020)
Paramacrobiotus aff. richtersi NO.386
MH664939
MH664957
MH666088
MH676009
Stec, Krzywański et al. (2020)
Paramacrobiotus aff. richtersi NZ.001
MH664940
MH664958
MH666089
MH676010
Stec, Krzywański et al. (2020)
Paramacrobiotus aff. richtersi TZ.018
MH664933
MH664951
MH666095
MH676017
Stec, Krzywański et al. (2020)
Paramacrobiotus arduus Guidetti et al., 2019
MK041032
–
–
MK041020
Guidetti et al. (2019)
Paramacrobiotus areolatus (Murray, 1907)
MH664931
MH664948
MH666080
MH675998
Stec, Krzywański et al. (2020)
Paramacrobiotus bengalenseis Basu et al., 2023
ON923868
–
–
OP531839
Basu et al. (2023)
Paramacrobiotus bifrons (Pontremoli) 1 Brandoli et al., 2024
–
–
PP240910
PP236542
Brandoli et al. (2024)
Paramacrobiotus bifrons (Pontremoli) 2 Brandoli et al., 2024
–
–
PP240911
PP236543
Brandoli et al. (2024)
Paramacrobiotus bifrons (Pontremoli) 3 Brandoli et al., 2024
–
–
PP240912
PP236544
Brandoli et al. (2024)
Paramacrobiotus bifrons (Pontremoli) 4 Brandoli et al., 2024
–
–
PP240913
PP236545
Brandoli et al. (2024)
Paramacrobiotus bifrons (Gombola) 1 Brandoli et al., 2024
–
–
–
PP236546
Brandoli et al. (2024)
Paramacrobiotus bifrons (Gombola) 2 Brandoli et al., 2024
–
–
PP240914
PP236547
Brandoli et al. (2024)
Paramacrobiotus bifrons (Gombola) 3 Brandoli et al., 2024
–
–
PP240915
PP236548
Brandoli et al. (2024)
Paramacrobiotus bifrons (Gombola) 4 Brandoli et al., 2024
–
–
PP240916
PP236549
Brandoli et al. (2024)
Paramacrobiotus bifrons (Gombola) 5 Brandoli et al., 2024
–
–
PP240917
PP236550
Brandoli et al. (2024)
Paramacrobiotus bifrons (Gombola) 6 Brandoli et al., 2024
–
–
PP240918
PP236551
Brandoli et al. (2024)
Table 2. Continued
Taxon
18S rRNA
28S rRNA
ITS-2
COI
Source
Paramacrobiotus bifrons (Sassi di Varana) Brandoli et al., 2024
–
–
–
PP236552
Brandoli et al. (2024)
Paramacrobiotus bifrons (Monte Sant’Angelo) 1 Brandoli et al., 2024
–
–
PP240919
PP236553
Brandoli et al. (2024)
Paramacrobiotus bifrons (Monte Sant’Angelo) 2 Brandoli et al., 2024
–
–
PP240920
PP236554
Brandoli et al. (2024)
Paramacrobiotus bifrons (Monte Sant’Angelo) 3 Brandoli et al., 2024
–
–
PP240921
PP236555
Brandoli et al. (2024)
Paramacrobiotus celsus Guidetti et al., 2019
MK041031
–
–
MK041019
Guidetti et al. (2019)
Paramacrobiotus cf. klymenki IT.048
MH664937
MH664955
MH666085
MH676007
Stec, Dudziak et al. (2020)
Paramacrobiotus cf. klymenki PT.006
MH664943
MH664960
MH666092
MH676013
Stec, Dudziak et al. (2020)
Paramacrobiotus depressus Guidetti et al., 2019
MK041030
–
–
MK041015
Guidetti et al. (2019)
Paramacrobiotus experimentalis Kaczmarek et al., 2020
MN073468
MN073465
MN073464
MN097837
Kaczmarek et al. (2020)
Paramacrobiotus fairbanksi
MH664941
MH664950
MH666090
MH676011
Stec, Krzywański et al. (2020)
Paramacrobiotus filipi 1Dudziak et al., 2020
MT261913
MT261904
–
MT260372
Stec, Dudziak et al. (2020)
Paramacrobiotus filipi 2 Dudziak et al., 2020
–
–
–
MT260373
Stec, Dudziak et al. (2020)
Paramacrobiotus gadabouti MD50.1 Kayastha et al., 2023
OP394210
–
–
OP394113
Kayastha, Stec et al. (2023)
Paramacrobiotus gadabouti MD50.4 Kayastha et al., 2023
OP394212
–
–
OP394114
Kayastha, Stec et al. (2023)
Paramacrobiotus gadabouti AU.044 Kayastha et al., 2023
MH664932
MH664949
MH666081
MH675999
Stec, Krzywański et al. (2020)
Paramacrobiotus gadabouti FR.077 1 Kayastha et al., 2023
MH664935
MH664953
MH666083
MH676003
Stec, Krzywański et al. (2020)
Paramacrobiotus gadabouti FR.077 2 Kayastha et al., 2023
–
–
–
MH676004
Stec, Krzywański et al. (2020)
Paramacrobiotus gadabouti PT.048 1 Kayastha et al., 2023
MH664944
MH664961
MH666093
MH676014
Stec, Krzywański et al. (2020)
Paramacrobiotus gadabouti PT.048 2 Kayastha et al., 2023
–
–
–
MH676015
Stec, Krzywański et al. (2020)
Paramacrobiotus gadabouti TN.014 Kayastha et al., 2023
MH664945
MH664962
MH666094
MH676016
Stec, Krzywański et al. (2020)
Paramacrobiotus lachowskae Stec et al., 2018
MF568532
MF568533
MF568535
MF568534
Stec, Roszkowska et al. (2018)
Paramacrobiotus metropolitanus Sugiura et al., 2022
LC637243
LC649795
LC649794
LC637242
Sugiura et al. (2022)
Paramacrobiotus puma sp. nov.
PP416751
PP416752
PP416753
PP414782
Present study
Paramacrobiotus richtersi (Murray, 1911)
MK041023
–
–
MK040994
Guidetti et al. (2019)
Paramacrobiotus richtersi S38 (Murray, 1911)
OK663224
OK663235
OK663213
OK662995
Vecchi et al. (2022)
Table 2. Continued
Taxon
18S rRNA
28S rRNA
ITS-2
COI
Source
Paramacrobiotus spatialis Guidetti et al., 2019
MK041024
–
–
MK040996
Guidetti et al. (2019)
Paramacrobiotus spatialis S107 Guidetti et al., 2019
OK663225
OK663236
OK663214
OK662996
Vecchi et al. (2022)
Paramacrobiotus tonolli US (Ramazzotti, 1956)
MH664946
MH664963
MH666096
MH676018
Stec, Krzywański et al. (2020)
Minibiotus ioculator Stec et al. 2020
MT023998
MT024041
MT024000
MT023412
Stec, Kristensen et al. (2020)
Minibiotus pentannulatus Londoño et al., 2017
MT023999
MT024042
MT024001
MT023413
Stec, Kristensen et al. (2020)
Habitat: high elevation xerophilic scrub. Elevation: 2,260 m asl.
Microhabitat: mossesof the species Thuidium delicatulum collected on a rock.
Remarks. The 5 specimens examined present a smooth and reddish colored cuticle, the eyes are present, 6 peribuccal lamellae are present, secondary branches of external claws I-III and of posterior claws IV with 2 points (claw configuration [2-3] – [3-2]), pt of the primary branch IV length is between 65-69% and the cuticular bars under legs I-III are present. Those characters correspond to the original description of Milnesium reductum Tumanov, 2006 (Tumanov, 2006); however, we were unable to confirm the presence or absence of accessory points on primary branches in all specimens. Therefore, due to the lack of a greater number of specimens for examination, for morphometric measurements and for sequencing of genetic material, this species cannot be identified with certainty.
Order Parachela Schuster, Nelson, Grigarick and Christenberry, 1980
Superfamily Hypsibioidea Pilato, 1969
Family Hypsibiidae Pilato, 1969
Subfamily Hypsibiinae Pilato, 1969
Genus Hypsibius Ehrenberg, 1848
Hypsibius cf. dujardini
Taxonomic summary
Material examined: Mexico: Mexico City: Cantera Oriente (19°19’00.5” N, 99°10’21.5” W, 2,260 m asl), 3 specimens (CNAC-Tar000224 – CNAC-Tar000226). Coll. D. López and G. Montiel.
Habitat: high elevation xerophilic scrub. Elevation: 2,260 m asl.
Microhabitat: mossesof the species Amblystegium varium (Hedw.) Lindb. collected on a rock.
Remarks. The specimen traits correspond to the redescription of Hypsibius dujardini (Doyère, 1840) made by Gąsiorek, Stec, Morek et al. (2018). However, we cannot confirm the presence or absence of cuticular bars on legs I-III in all specimens. Therefore, due to the lack of a greater number of specimens for morphometric measurements and for sequencing of genetic material, this species cannot be identified with certainty.
Subfamily Pilatobiinae Bertolani, Guidetti, Marchioro, Altiero, Rebecchi and Cesari, 2014
Genus Notahypsibius Tumanov, 2020
Notahypsibius pallidoides Pilato, Kiosya, Lisi, Inshina and Biserov, 2011
(Fig. 2D-F)
Taxonomic summary
Type locality: Ukraine.
Material examined: Mexico: Mexico City: Cantera Oriente (19°19’00.5” N, 99°10’21.5” W; 2,260 m asl), 10 specimens (CNAC-Tar000214 – CNAC-Tar000223). Coll. D. López and G. Montiel.
Habitat: high elevation xerophilic scrub. Altitude: 2,260 m asl.
Microhabitat: mossesof the species Orthostichella rigida (Müll. Hal.) B.H. Allen & Magill collected on a rock.
Remarks. The specimens examined present Ramazzottius-like claws (Fig. 2E), a smooth cuticle, the pt of the stylet support insertion point between 56.9-57.8%, the eyes are present, a pharyngeal bulb with 2 elongated macroplacoids and a minute dot-like septulum is present (Fig. 2E). The accessory points on primary branches and the lunules under the claws are present (Fig. 2F). The cuticular bars on all legs are absent. Specimen traits correspond to the original description of Notahypsibius pallidoides by Pilato et al. (2011). Also, they were compared with the redescription by Tumanov (2020). The species represents a new record for Mexico.
Family Ramazzottiidae Sands, McInnes, Marley, Goodall-Copestake, Convey and Linse, 2008
Genus Ramazzottius Binda & Pilato, 1986
Ramazzottius cf. oberhaeuseri
Taxonomic summary
Material examined: Mexico: Mexico City: Cantera Oriente (19°19’00.5” N, 99°10’21.5” W; 2,260 m asl), 11 specimens (CNAC-Tar000227 – CNAC-Tar000237) and 3 eggs (CNAC-Tar000282 – CNAC-Tar000284). Coll. D. López, G. Montiel, L. Piña and M. Hernández.
Habitat: high elevation xerophilic scrub. Elevation: 2,260 m asl.
Microhabitat: lichensof the species Heterodermia sp. collected on a tree.
Remarks. The specimens and eggs traits correspond to the redescription of Ramazzottius oberhaeuseri (Doyère, 1840) made by Stec, Morek et al. (2018). However, due to the lack of a greater number of specimens for morphometric measurements and for sequencing of genetic material, this species cannot be identified with certainty.
Superfamily Macrobiotoidea Thulin, 1928
Family Macrobiotidae Thulin, 1928
Genus Minibiotus R.O. Schuster, 1980
Minibiotus cf. continuus
Taxonomic summary
Material examined: Mexico: Mexico City: Cantera Oriente (19°19’00.5” N, 99°10’21.5” W; 2,260 m asl), 7 specimens (CNAC-Tar000282 – CNAC-Tar000288) and 3 eggs (CNAC-Tar000289 – CNAC-Tar000291). Coll. D. López and G. Montiel.
Habitat: high elevation xerophilic scrub. Elevation: 2,260 m asl.
Microhabitat: mossesof the species Syntrichia amphidiacea (Müll. Hal.) R.H. Zander collected on a tree.
Remarks. The traits of the specimens and eggs correspond to the original description of Minibiotuscontinuus Pilato and Lisi, 2006 (Pilato & Lisi, 2006). However, the eggs examined differ in size from the egg in the original description, which has a diameter of 46.2 µm excluding the processes, and 52.2 µm including them. In contrast, the eggs examined in the present study the diameter is between 42.5 – 44.3 µm excluding the processes and between 49.8 – 51.9 µm including them. Therefore, due to the lack of a greater number of specimens for morphometric measurements, this species cannot be identified with certainty.
Genus Paramacrobiotus Guidetti, Schill, Bertolani, Dandekar and Wolf, 2009
Paramacrobiotus gadabouti Kayastha, Stec, Mioduchowska and Kaczmarek, 2023
(Fig. 2G-I)
Taxonomic summary
Type locality: Portugal.
Material examined: Mexico: Mexico City: Cantera Oriente (19°19’00.5” N, 99°10’21.5” W; 2,260 m asl), 7 specimens (CNAC-Tar000204 – CNAC-Tar000210), 3 eggs (CNAC-Tar000211 – CNAC-Tar000213) and 2 eggs were prepared for SEM. Coll. D. López and G. Montiel.
Habitat: high elevation xerophilic scrub. Elevation: 2,260 m asl.
Microhabitat: mossesof the species Syntrichia amphidiacea collected on a tree.
Remarks. The specimens examined lack eyes, and present a smooth cuticle, a pt of the stylet support insertion point between 77.2-80.5%, granulation on the external surface of legs I-III, smooth lunules under all claws and accessory points on primary branches. The eggs are areolated, of richtersi type with a single ring of 10-12 areolae around each process. The top endings of the processes present cap like structures. Specimens and eggs traits correspond to the original description of Paramacrobiotus gadabouti (Kayastha, Stec et al., 2023), also they were examined following the diagnostic key by Kayastha, Mioduchowska et al. (2023). In addition to the type locality in Madeira Island, Portugal, this species has also been recorded in Australia, France and Tunisia (Kayastha, Stec et al., 2023). A new record for Mexico.
Figure 2. Tardigrade species that represent new records for Mexico. A-C, Milnesium longiungue: A, habitus; B, claws II; C, claws IV. D-F, Notahypsibiuspallidoides: D, habitus; E, buccopharyngeal apparatus; F, claws III; white arrows indicate the thickened region on the lunule margin. G-I, Paramacrobiotusgadabouti: G, habitus; H, egg seen on PCM; I, egg seen on SEM. Scale bars = μm.
Paramacrobiotus puma López-Sandoval, Montiel-Parra and Pérez sp. nov.
Type locality: Cantera Oriente (19°19’00.5” N, 99°10’21.5” W; 2,260 m asl). Mexico City, Mexico.
Material examined: Mexico: Mexico City: Cantera Oriente (19°19’00.5” N, 99°10’21.5” W; 2,260 m asl). Coll. D. López, G. Montiel, L. Piña and M. Hernández.
Microhabitat: lichens of the species Heterodermia cf. tremulans, collected from a tree trunk.
Type material. Holotype and 55 paratypes (32 specimens and 23 eggs). Additionally, 2 specimens and 2 eggs were prepared for SEM photographs, and 2 specimens were processed for DNA sequencing.
Holotype (CNAC-TTar000011). Mexico City, Mexico: Reserva Ecológica del Pedregal de San Ángel, Cantera Oriente (19°19’00.5” N, 99°10’21.5” W; 2,260 m asl).
Paratypes. (CNAC- TTar000001 – CNAC- TTar000056). The same data as for the holotype.
Type specimen’s depositories. Holotype (CNAC-TTar000011) and 51 paratypes (30 specimens and 21 eggs) (CNAC-TTar000001 – CNAC-TTar000056) are deposited at the Tardigrada Collection associated with the National Collection of Mites (CNAC) of the Instituto de Biología, UNAM, Mexico City (Mexico). Additionally, 4 paratypes (2 specimens and 2 eggs) (slides CNAC-TTar000030, CNAC-TTar000032, CNAC-TTar000050 and CNAC-TTar000053) are deposited in the Department of Animal Taxonomy and Ecology, Institute of Environmental Biology, Adam Mickiewicz University, Poznań, Poland, and 4 paratypes (2 specimens and 2 eggs) (slides CNAC-TTar000029, CNAC-TTar000031, CNAC-TTar000040 and CNAC-TTar000043) are deposited in the Institute of Zoology and Biomedical Research, Jagiellonian University, Kraków, Poland.
Etymology. The new species is named after the Puma, the official mascot which is the emblem of the National Autonomous University of Mexico (UNAM).
Description (measurements and statistics in Table 3).
White body in live specimens, transparent in specimens mounted in Hoyer’s medium (Fig. 3A-C). Eyes are present in live adult animals (present in 18 of the 25 specimens examined mounted in Hoyer’s medium) and absent in a hatching specimen examined (Fig. 3C). Cuticle smooth, without gibbosities, papillae, pores, spines, or ornaments. Small areas of granulation in the first 3 pairs of legs are present, specifically on the external surfaces near the claw bases, and as for the hind legs, the granulation is extended from the claws onto the entire dorsal surface of the legs (Fig. 4). Claws robust, of the hufelandi type (Fig. 4A, B). Smooth lunules are present under all claws (Fig. 4C, D). Accessory points on primary branches are present. Cuticular bars under the claws are absent.
Table 3
Measurements (in μm), and values of the pt index, of some structures of the holotype and paratypes of Paramacrobiotus puma sp. nov.
Character
N
Range
Mean
Sd
Holotype
µm
pt
µm
pt
µm
pt
µm
pt
Body length
25
364-678
814-1106
470
944
76
75
576
958
Buccal tube
Length
25
36-61.3
–
49.7
7.2
–
60.1
–
Stylet support insertion point
25
27.2-46.5
74.4-81.2
38.6
77.8
5.3
1.4
45.9
76.3
External width
25
5.6-11.8
15.6-25.2
9.6
19.3
1.6
1.2
10.5
17.5
Internal width
25
4.3-9.7
11.6-20
7.4
14.9
1.3
1.2
8.1
13.5
Ventral lamina length
15
21.7-40.3
54.8-75.5
30
62
5.6
3
34
56.6
Placoid lengths
Macroplacoid 1
25
5.5-12.7
13.8-20.7
8.6
17.2
1.9
1.5
11.7
19.5
Macroplacoid 2
25
4.9-9.6
10.5-18.4
6.6
13.3
1.4
1
8.6
14.3
Macroplacoid 3
25
5.7-13
15.8-21.5
9.5
19
2.2
1.8
12.8
21.3
Macroplacoid row
25
18-35.9
49.4-67.3
27.8
55.8
5
2.5
33.4
55.6
Claw 1 lengths
External primary branch
25
8.8-17.6
16.8-31.4
12.8
25.9
1.8
1.8
14.4
24
External secondary branch
22
7-12.8
13.4-26.2
9.6
19.2
1.4
2
11.2
18.6
Internal primary branch
23
6.4-14.8
12.2-28.9
11.6
23.5
1.7
1.7
14.1
23.5
Internal secondary branch
21
3.2-11.7
6.1-24.7
8.2
16.6
1.3
2
10.4
17.3
Claw 2 lengths
External primary branch
24
10.3-17.4
22-31.4
13.1
26.4
2.1
2.6
15.1
25.1
External secondary branch
25
6.4-12.9
12.2-25.3
9.8
19.7
1.8
2.1
12.8
21.3
Internal primary branch
25
7.2-16
13.8-28.9
12
24.1
2.1
1.8
14.8
24.6
Internal secondary branch
25
5.6-12.8
10.7-23.6
9.3
18.7
1.9
2.2
11.6
19.3
Claw 3 lengths
External primary branch
24
11.2-18.4
24.3-31.9
14.1
28.4
2
1.4
16
26.6
External secondary branch
23
8-13.2
15.7-24.5
10.3
20.7
1.7
1.5
13
21.6
Internal primary branch
23
9.6-17.6
23.6-31.5
13.3
26.9
2.1
2.1
15.2
25.3
Internal secondary branch
22
7.7-12.6
17-22.6
9.6
19.5
1.5
1.5
11.2
18.6
Claw 4 lengths
Anterior primary branch
24
10.2-20.8
19.5-33.9
14.7
29.6
2.3
1.8
17.6
29.3
Anterior secondary branch
23
5.6-15.2
10.7-24.8
10.6
21.2
2
1.7
13.6
22.6
Posterior primary branch
25
11.4-21.6
21.7-35.2
15.6
31.4
2.5
1.4
19.2
31.9
Posterior secondary branch
24
7.2-16
13.8-27.4
11.5
23.2
1.7
1.7
13.1
21.8
N = Number of specimens/structures measured; Range = the smallest and the largest structure among all measured specimens; Sd = standard deviation.
Table 4
Measurements (μm) of morphological structures of eggs of Paramacrobiotus puma sp. nov.
Character
N
Range
Mean
Sd
Diameter of egg without processes
22
72-107.1
89.9
8.1
Diameter of egg with processes
22
94.4-131.9
117.1
10.4
Process height
66
11.2-27
16.5
3.2
Process base width
66
9.9-21.1
15.7
2.3
Process base/height ratio
66
49%-144%
97%
18%
Distance between processes
66
5.6-10.4
7.8
1.1
Number of processes on the egg circumference
19
12-15
13.1
0.8
N = Number of eggs/structures measured; Range = the smallest and the largest structure among all measured specimens; Sd = standard deviation.
Figure 3. Paramacrobiotus puma sp. nov. Habitus: A, dorso-ventral projection of the entire animal (holotype, PCM); B, dorsal view of the entire animal (paratype, SEM); C, juvenile hatching from the egg (paratype); arrowhead indicates a sclerified line after the third macroplacoid. Scale bars = μm. Figure 4. Paramacrobiotuspuma sp. nov. Claws and leg granulation: A-B, claws II and IV, respectively (holotype PCM); C-D, claws II and IV, respectively, with smooth lunules seen in SEM (paratype); E-F, claws III seen in PCM (holotype) and SEM (paratype) respectively; arrows indicate the granulation on the external surface of the legs. Scale bars = μm.
Mouth antero-ventral with 10 peribuccal lamellae. Buccopharyngeal apparatus of the Macrobiotus type with ventral lamina present (Fig. 5A). The oral cavity armature is composed of 3 bands of teeth (Fig. 6). The first band of teeth consists of small cones (granules in PCM) positioned at the base of the buccal lamellae. The second band of teeth is composed of larger cones arranged in one row around the oral cavity and positioned in the rear of the oral cavity between the ring fold and the third band of teeth. The third band of teeth is positioned just before the buccal tube opening and is composed of dorsal and ventral transversal ridges, organized into 2 large lateral ridges and a smaller median ridge (Fig. 6C, D).
Figure 5. Paramacrobiotuspuma sp. nov. Buccopharyngeal apparatus (dorso-ventral projection in PCM): A, general view (paratype); B, dorsal placoids (paratype); arrows indicate the subterminal constriction in the third macroplacoid; arrowhead indicates a sclerified line and a rudimentary microplacoid-like thickening after the third macroplacoid. Scale bars = μm.
The pharyngeal bulb is spherical, with triangular apophyses and 3 rod-shaped macroplacoids (Fig. 5B). Macroplacoid length sequence is 2 < 1 < 3. The first macroplacoid is without constrictions but narrower anteriorly. The second macroplacoid is of uniform width and without constrictions. The third macroplacoid presents a sub-terminal constriction. Microplacoid is absent, however, a sclerified line and a rudimentary microplacoid-like thickening are present after the third macroplacoid in adult specimens (Fig. 5A, B). In the hatching specimen examined, the microplacoid-like thickening is also present (Fig. 3C).
Eggs (measurements and statistics in Table 4).Eggs of the richtersi type. Laid free, white, spherical, and with 12-15 cone-shaped processes on the circumference with a variable termination (Figs. 3C; 7A-D; 9A-F). The apices can be very short or thin and long (Fig. 8A-D). The labyrinth layer between the walls of the processes is visible under PCM as a reticular pattern (Fig. 8B). Between 12 and 14 areolae around each process. The internal surface of the areolae is sculpted with a reticular pattern with pores (Figs. 7D; 9E, F).
DNA sequences. We obtained DNA sequences for all 4 molecular markers from 1 hologenophore (voucher number: CNAC-TTar000033). The sequence length and GenBank accession number of each marker are as follows: 18s rRNA (GenBank: PP416751), 1632-bp long; 28s rRNA (GenBank: PP416752), 737-bp long; ITS-2 (GenBank: PP416753), 419-bp long; COI (GenBank: PP414782), 631-bp long.
Figure 6. Paramacrobiotuspuma sp. nov. Oral cavity armature: A-B, dorsal and ventral views, respectively (paratype, PCM); C-D, dorsal and ventral views, respectively (paratypes, SEM); the arrow indicates teeth of the first band; flat arrowheads indicate teeth of the second band; indented arrowheads indicate teeth of the third band; letters indicate lateral (L) and median (M) crests. Scale bars = μm.
Phenotypic differential diagnosis. The genus Paramacrobiotus is divided into 2 morphologically distinct species groups: the richtersi group (species with a microplacoid in the pharynx) and the areolatus group (species without a microplacoid or with rudimentary structures in the place of microplacoid in the pharynx). Also, there are 7 types of eggs, being the areolatus and richtersi the most common types (Kaczmarek et al., 2017; Kayastha, Mioduchowska et al., 2023). Since the microplacoid is absent in Paramacrobiotus puma sp. nov., it belongs to the areolatus group along with 12 other species: P. areolatus (Murray, 1907), P. bifrons Brandoli, Cesari, Massa, Vecchi, Rebecchi and Guidetti, 2024, P. centesimus (Pilato, 2000), P. csotiensis (Iharos, 1966), P. derkai (Degma, Michalczyk & Kaczmarek, 2008), P. huziori (Michalczyk & Kaczmarek, 2006), P. intii Kaczmarek, Cytan, Zawierucha, Diduszko and Michalczyk, 2014, P. klymenki Pilato, Kiosya, Lisi and Sabella, 2012, P. lachowskae Stec, Roszkowska, Kaczmarek and Michalczyk, 2018, P. spinosus Kaczmarek, Gawlak, Bartels, Nelson and Roszkowska, 2017, P. tonollii (Ramazzotti, 1956) and P. walteri (Biserov, 1998) (Biserov, 1998; Brandoli et al., 2024; Degma et al., 2008; Iharos, 1966; Kaczmarek, Michalczyk et al., 2014, 2017; Michalczyk & Kaczmarek, 2006; Murray, 1907; Pilato, 2000; Pilato et al., 2012; Ramazzotti, 1956; Stec, Roszkowska et al., 2018). Moreover, Paramacrobiotus puma sp. nov., presents the richtersi type of egg, and is most similar to 7 species within the areolatus group: P. areolatus, P. centesimus, P. intii, P. klymenki, P. lachowskae, P. spinosus and P. walteri. Nevertheless, the new species can be differentiated specifically from all species mentioned above by the following traits.
Figure 7. Paramacrobiotus puma sp. nov. Eggs seen in PCM: A-B, midsection; C, the surface of the egg seen in PCM; D, a closer look at the areolation around a process; the arrows indicate the smaller areoles. Scale bars = μm.
Paramacrobiotus puma sp. nov. differs from P. areolatus, restricted only to Svalbard and Greenland (McInnes, 1994; Stec, Krzywański et al., 2020), by the presence of smooth lunules under the IV claws (crenate in P. areolatus) and a different type of egg (richtersi type in P. puma sp. nov. vs. areolatus type in P. areolatus). From P. bifrons, recorded only in Italy (Brandoli et al., 2024), by the presence of smooth lunules under the IV claws (clearly indented larger lunules on legs IV in P. bifrons) and by a different type of egg (richtersi type in P. puma sp. nov. vs. 2 egg types in P. bifrons: areolatus type and csotiensis type). From P. centesimus, recorded only in Brazil and Ecuador (Kaczmarek et al., 2015; Pilato, 2000), by a different type of egg (richtersi type in P. puma sp. nov. vs. areolatus type in P. centesimus), longer egg processes (11.2-27.0 μm in P. puma sp. nov. vs. 7.0-11.0 μm in P. centesimus), and by larger full egg diameter (94.4-131.9 μm in P. puma sp. nov. vs. 76.0-91.0 μm in P. centesimus).From P. csotiensis, recorded only in Hungary (Iharos, 1966), by a different type of egg (egg processes shape blunt with a transparent cover [csotiensis type] in P. csotiensis vs egg processes shape conical without a transparent cover [richtersi type] in P. puma sp. nov.), and by different egg diameters (diameters with processes of 75-80 μm and without processes of 60-65 μm in P. csotiensis vs 94.4-131.9 μm with processes and of 72.0-107.1 μm without processes in P. puma sp. nov.).From P. derkai, recorded only in Colombia and Peru (Degma et al., 2008; Kaczmarek et al., 2016), by less protruding accessory points on primary branches, for a different type of egg (richtersi type in P. puma sp. nov. vs huziori type in P. derkai), spaces between neighbor areolae (narrower than areolae widths in P. puma sp. nov. vs. usually broader than the areolae widths in P. derkai), and by longer egg processes (11.2-27.0 μm P. puma sp. nov. vs. 8.0-17.1 μm in P. derkai). From P. huziori, recorded only in Costa Rica (Michalczyk & Kaczmarek, 2006; Kaczmarek, Michalczyk et al., 2014), by leg granulation in aggregations of small granules or cones absent (present in P. huziori), a different type of egg (richtersi type in P. puma sp. nov. vs. huziori type in P. huziori), shorter egg processes (11.2-27 μm in P. puma sp. nov. vs. 20.0-33.0 in P. huziori), and by the number of egg processes (12-15 in P. puma sp. nov. vs. 9-11 in P. huziori). From P. intii, recorded only in Peru (Kaczmarek, Cytan et al., 2014), by the oral cavity armature, showing bands I to III in PCM (only I and II in P. intii), a different type of egg (richtersi type in P. puma sp. nov. vs. areolatus type in P. intii), shorter egg processes (11.2-27 μm in P. puma sp. nov. vs. 15.4-24.4 in P. intii), and by the number of egg processes (12-15 in P. puma sp. nov. vs. 9-10 in P. intii). From P. klymenki, recorded only in Belarus (Pilato et al., 2012), by presenting eyes (absent in P. klymenki), lunules IV smooth (crenate in P. klymenki), a different type of egg (richtersi type in P. puma sp. nov. vs. areolatus type in P. klymenki), and by the number of egg processes (12-15 in P. puma sp. nov. vs. 10-11 in P. klymenki). From P. lachowskae, recorded only in Colombia (Stec, Roszkowska et al., 2018), by macroplacoid length sequence (2 < 1 < 3 in P. puma sp. nov. vs. 2 < 3 ≤ 1 in P. lachowskae), a different type of egg (richtersi type in P. puma sp. nov. vs. areolatus type in P. lachowskae), egg processes shape (conical processes with filaments not covered with hairs in P. puma sp. nov. vs. dome-like, wrinkled, and with long flexible spines/filaments covered by fine short hairs in P. lachowskae). From P. spinosus, recorded only in Ecuador (Kaczmarek et al., 2017), by the presence of eyes (absent in P. spinosus), egg processes shape (conical processes with transverse annulations smooth in P. puma sp. nov. vs. transverse annulations associated with short spines in the upper parts of egg processes in P. spinosus), by the number of egg processes (12-15 in P. puma sp. nov. vs. 10-11 in P. spinosus), and by the number of areolae on egg surface (between 12 and 14 areolae around each process in P. puma sp. nov. vs. 10 areolae in P. spinosus). From P. tonollii, recorded in Lapland (Finland), USA, and Canada (McInnes, 1994), by a different type of egg (richtersi type in P. puma sp. nov. vs. tonollii type in P. tonollii) and by the number of egg processes (12-15 in P. puma sp. nov. vs. 8-10 in P. tonollii). And from P. walteri, known only from Russia (Biserov, 1998), by the presence of smooth lunules under claws IV (dentate in P. walteri), and by a different type of egg (richtersi type in P. puma sp. nov. vs. areolatus type in P. walteri).
Genotypic differential diagnosis. The ranges of uncorrected genetic p-distances from the most to the least conservative between the new species and other species of the genus Paramacrobiotus for which sequences are available from GenBank, are as follows: 18S rRNA: 0.06-5.02% (1.66% on average), with the most similar being Paramacrobiotus lachowskae from Magdalena Province, Colombia (MF568532), and the least similar being a haplotype attributed to P. danielae (Pilato, Binda, Napolitano & Moncada, 2001) from undetermined location (MZ081363). In the 28S rRNA: 0.00-8.57% (5.98% on average), being identical to Paramacrobiotus lachowskae from Magdalena Province, Colombia (MF568533), and the least similar being P. tonollii (Ramazzotti, 1956) from the East Tennessee State University campus, USA (MH664963). In the ITS-2: 10.36-35.69% (25.29% on average), with the most similar being Paramacrobiotus lachowskae from Magdalena Province, Colombia (MF568535), and the least similar P. tonollii (Ramazzotti, 1956) from Oregon, USA (GQ403679). In the COI: 11.33-26.94% (21.78% on average), with the most similar being Paramacrobiotus lachowskae Stec, Roszkowska, Kaczmarek and Michalczyk, 2018 from Magdalena Province, Colombia (MF568534), and the least similar being a haplotype attributed to P. richtersi (Murray, 1911) from China (unpublished) (GU339056).
Figure 8. Paramacrobiotus puma sp. nov. Egg processes morphology seen in PCM: A, midsection of 2 processes; B, reticulum within the process walls; C-D, midsection of 2 processes with different apices. Scale bars = μm.
Phylogenetic analysis. The phylogenetic reconstruction performed using BI and ML methods resulted in trees with similar topology and mostly well supported nodes, although the lowest support values corresponded to the ML tree (Fig. 10). The results show that the Paramacrobiotus richtersi morphogroup was recovered as paraphyletic, and the areolatus morphogroup as polyphyletic, as the sequences of the new species obtained in this study clustered together with P. lachowskae from Colombia within the clade of the richtersi morphogroup. These results are largely consistent with the phylogenies previously presented by Stec, Krzywański et al. (2020) and Kayastha, Stec et al. (2023). Paramacrobiotus areolatus and P. tonolli from the USA are found at the base of the areolatus morphogroup clade and interestingly, P. cf. klymenky IT.048 from Italy was clustered with P. bifrons also from Italy, being P. cf. klymenky PT.006 from Portugal a sister lineage to that cluster.
Figure 9. Paramacrobiotus puma sp. nov. Egg seen in SEM: A-B, chorion; C, processes; D, areolae between the processes; E-F, a closer look at the areolation between 2 processes; the arrows indicate the pores inside the areolae. Scale bars = μm.
Discussion
To date, 83 species of tardigrades have been reported for Mexico. Particularly for the genus Milnesium, 5 species have been previously reported: Milnesium barbadosense Meyer and Hinton, 2012 (Moreno-Talamantes et al., 2019), M. cassandrae Moreno-Talamantes, Roszkowska, García-Aranda, Flores-Maldonado and Kaczmarek, 2019 (Moreno-Talamantes et al., 2019), M. fridae Moreno-Talamantes, León-Espinosa, García-Aranda, Flores-Maldonado and Kaczmarek, 2020 (Moreno-Talamantes et al., 2020), M. sp. (Moreno-Talamantes et al., 2020) and M. tardigradumtardigradum Doyère, 1840 (Schuster, 1971; Beasley, 1972; Kaczmarek et al., 2011; Moreno-Talamantes et al., 2019, 2020). However, currently, the geographical distribution of Milnesium tardigradum is restricted to Central and Western Europe (Kaczmarek et al., 2011; Michalczyk et al., 2012a, b; Morek et al., 2018), so the records provided by Schuster (1971) and Beasley (1972) are doubtful and it is necessary to inspect the specimens collected in Mexico since they are probably a different species. Milnesiumlongiungue and M. cf. reductum represent a new record for Mexico and the number of species of the genus Milnesium increases to 7.
Figure 10. Phylogeny constructed from concatenated sequences of the genus Paramacrobiotus (18S rRNA + 28S rRNA + ITS-2 + COI; Table 2). Numbers above branches indicate Bayesian posterior probabilities values (≥ 0.90), while number below branches indicate bootstrap support values (≥ 50). In agreement with previous phylogenies (Basu et al., 2023; Kayastha, Stec et al., 2023; Stec, Krzywański et al., 2020), taxa of the richtersi and areolatus morphogroups are indicated by blue and red branches, respectively. The outgroup is indicated in gray font. The new species is in bolded font. The scale bar represents substitutions per position.
Regarding the family Hypsibiidae, 4 subfamilies have been recorded: Diphasconinae, Hypsibiinae, Itaquasconinae and Pilatobiinae (Schuster, 1971; Ramazzotti & Maucci, 1983; Moreno-Talamantes et al., 2019; Dueñas-Cedillo et al., 2020). For the subfamily Hypsibiinae, 4 species belonging to the genus Hypsibius are present in the country: H. cf. convergens recorded by Schuster (1971), H. cf. microps and H. cf. pallidus recorded by Dueñas-Cedillo et al. (2020) and H. pallidus Thulin, 1911 recorded by Ramazzotti and Maucci (1983), and with the record of H. cf. dujardini, there are 5 species recorded for the genus. And as for the subfamily Pilatobiinae, Notahypsibius pallidoides represents the first species of this genus recorded for Mexico.
Specifically for the genus Paramacrobiotus, P. areolatus (Murray, 1907) and P. richtersi (Murray, 1911) were recorded by Schuster (1971), being the only 2 species of the genus that are present in Mexico. However, these records should be considered doubtful, because although both species were previously considered cosmopolitan (Kaczmarek et al., 2011, 2017), they are currently within 2 morphogroups of closely related species and their distribution is very restricted. Currently, Paramacrobiotusareolatus is restricted to Svalbard and Greenland (Stec, Krzywański et al., 2020), and P. richtersi to Ireland and Finland (Kayastha, Mioduchowska et al., 2023). Furthermore, in addition to the diagrams showing the buccopharyngeal apparatus and the egg type, Schuster (1971), did not provide more details of the chorion or the egg ornamentation. Therefore, it is necessary to inspect the specimens registered in Mexico that were attributed to P. areolatus and P. richtersi by Schuster, since they are most likely different species. Paramacrobiotusgadabouti is a new record for Mexico, and with the description of P. puma sp. nov., there are 4 species of the genus recorded for the country.
Phylogenetic analysis. The genus Paramacrobiotus has been studied on several occasions. Guidetti et al. (2009), erected the genus by separating it from Macrobiotus Schultze, 1834. Subsequently, the redescriptions of Paramacrobiotusrichtersi, the nominal taxon (Guidetti et al., 2019) and P. areolatus (Stec, Krzywański et al., 2020), contributed significantly by providing detailed morphological and molecular data from both species and several additional new species described. Recently, Basu et al. (2023) and Kayastha, Stec et al. (2023) described Paramacrobiotusbengalenseis and P. gadabouti, respectively, contributing to new phylogenetic hypotheses. Basu et al. (2023) demonstrated the monophyly of the richtersi group but found the areolatus group as paraphyletic, Kayastha, Stec et al. (2023) found the representatives of the areolatus group formed a paraphyletic group caused by P. lachowskae which was clustered together with the richtersi morphogroup.
In the present study, we found a tree topology very similar to those previously published by Stec, Krzywański et al. (2020) and Kayastha, Stec et al. (2023), however, the richtersi group was recovered as paraphyletic and the areolatus group as polyphyletic (Fig. 10). As for Paramacrobiotuspuma sp. nov., it was clustered together with P. lachowskae from Colombia, both species being the only neotropical representatives within the areolatus morphogroup along the phylogenies. These results indicate that Paramacrobiotuspuma sp. nov. is very close to P. lachowskae, as seen in the genetic distances (p-distances), particularly for the ribosomal marker 28s rRNA, which proved to be a similar haplotype between both species (see results above). Nevertheless, morphologically, several differences are found between both species, such as the macroplacoid length sequence, the type of eggs and the egg processes shape (see differential diagnosis).
Finally, according to the phylogenetic tree obtained, we recovered Paramacrobiotus cf. klymenky IT.048 from Italy, clustered with P. bifrons, which indicates that they may represent closely related species. Also, Paramacrobiotus cf. klymenky PT.006 is recovered as a sister taxon of that cluster (Fig. 10). In our study, the p-distances between Paramacrobiotus cf. klymenky IT.048 and P. bifrons, showed to be low (between 0.53-2.72%) for the COI marker, but very variable regarding the ITS-2 marker (between 0.55-6.55%) (Supplementary material, SM2). Stec, Krzywański et al. (2020) studied Paramacrobiotus cf. klymenky IT.048 along with P. cf. klymenky PT.006, where despite being morphologically identical (suggesting they were a single species), both species presented discordant genetic distances between the ITS-2 and COI markers. Moreover, regardless of the genetic distance method used, for the COI marker they were different species and as for the ITS-2 marker, they turned out to be the same species. Nevertheless, although in the different phylogenies they are clustered together (Basu et al., 2023; Kayastha, Stec et al., 2023; Stec, Krzywański et al., 2020), whether the Italian and the Portuguese populations are different, or the same species is difficult to answer so far, since a greater number of studies with an integrative approach are still needed to gradually gain a better resolution within this genus.
Acknowledgments
The first author thanks the Posgrado en Ciencias Biológicas, UNAM. Thanks to Francisco Martínez (deceased) for his support in obtaining the sample collections in the Cantera Oriente. To the Executive Secretary of REPSA for the permit granted. We thank the RMB Editor in chief and two anonymous reviewers for their comments and suggestions that improved our manuscript. We are grateful to Łukasz Michalczyk for kindly allowing DLS the inspection of type material of the genus Paramacrobiotus deposited at the Institute of Zoology and Biomedical Research, Jagiellonian University, which was used for morphological comparisons with the new species. To Lucero Piña and Mayreli Hernández for their help with the sample collections. To Dennis Escolástico for identifying the mosses. To Gustavo Epitacio for identifying the lichens. We are grateful for the service of the Laboratorio de Biología Molecular and the Laboratorio de Microscopía y Fotografía de la Biodiversidad I of the Instituto de Biología of the Universidad Nacional Autónoma de México, as part of the Laboratorio Nacional de Biodiversidad (LaNaBio) and in particular the technical support of Berenit Mendoza for her help with the SEM images and of A. Jiménez-Marin, N. López, and L. Márquez for their help with DNA extraction, amplification and sequencing.
References
Altschul, S. F., Gish, W., Miller, W., Myers, E. W., & Lipman, D. J. (1990). Basic local alignment search tool. Journal of Molecular Biology, 215, 403–410. https://doi.org/10.1016/S0022-2836(05)80360-2
Anguas-Escalante, A., Jesús-Navarrete, A., Demilio, E., Pérez-Pech, W. A., & Goulberg, J. H. (2020). A new species of Tardigrada from a Caribbean reef lagoon, Florarctusyucatanensis sp. nov. (Halechiniscidae: Florarctinae). Cahiers de Biologie Marine, 61, 377–385. https://doi.org/10.21411/CBM.A.CD1B185A
Basu, S., Babu, R., Siddique, A., & Purushothaman, J. (2023). Integrative description of Paramacrobiotus bengalensis sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae), a new limno-terrestrial tardigrade species from the state of West Bengal, India. European Journal of Taxonomy, 890, 23–48. https://doi.org/10.5852/ejt.2023.890.2249
Beasley, C. W. (1972). Some tardigrades from Mexico. Southwestern Naturalist, 17, 21–29. https://doi.org/10.2307/3669835
Beasley, C. W., Kaczmarek, Ł., & Michalczyk, Ł. (2008). Doryphoribiusmexicanus, a new species of Tardigrada (Eutardigrada: Hypsibiidae) from Mexico (North America). Proceedings of the Biological Society of Washington, 121, 34–40. https://doi.org/10.2988/07-30.1
Beasley, C. W., & Miller, W. R. (2007). Tardigrada of Xinjiang Uygur Autonomous Region, China. Proceedings of the Tenth International Symposium on Tardigrada. Journal of Limnology, 66 (Suppl. 1), 49–55. https://doi.org/10.4081/jlimnol.2007.s1.49
Bertolani, R., Guidetti, R., Marchioro, T., Altiero, T., Rebecchi, L., & Cesari, M. (2014). Phylogeny of Eutardigrada: new molecular data and their morphological support lead to the identification of new evolutionary lineages. Molecular Phylogenetics and Evolution, 76, 110–126. https://doi.org/10.1016/j.ympev.2014.03.006
Biserov, V. I. (1998). Tardigrades of the Caucasus with a taxonomic analysis of the genus Ramazzottius (Parachela: Hypsibiidae). Zoologischer Anzeiger, 236, 139–159.
Brandoli, S., Cesari, M., Massa, E., Vecchi, M., Rebecchi, L., & Guidetti, R. (2024). Diverse eggs, diverse species? Production of two egg morphotypes in Paramacrobiotus bifrons, a new eutardigrade species within the areolatus group. The European Zoological Journal, 91, 274–297. https://doi.org/10.1080/24750263.2024.2317465
Casquet, J., Thebaud, C., & Gillespie, R. G. (2012). Chelex without boiling, a rapid and easy technique to obtain stable amplifiable DNA from small amounts of ethanol-stored spiders. Molecular Ecology Resources, 12, 136–141. https://doi.org/10.1111/j.1755-0998.2011.03073.x
Claxton, S. K. (1998). A revision of the genus Minibiotus (Tardigrada: Macrobiotidae) with descriptions of eleven new species from Australia. Records of the Australian Museum, 50, 125–160. https://doi.org/10.3853/j.0067-1975.50.1998.1276
Darriba, D., Posada, D., Kozlov, A., Stamatakis, A., Morel, B., & Flouri, T. (2020). ModelTest-NG: A new and scalable tool for the selection of DNA and protein evolutionary models. MolecularBiology and Evolution, 37, 291–294, https://doi.org/10.1093/molbev/msz189
Dastych, H. (1985). West Spitsbergen Tardigrada. Acta Zoologica Cracoviensia, 28, 169–214.
Degma, P., & Guidetti, R. (2024). Actual checklist of Tardigrada species (2009–2024, 43th Edition: 01-07-2024). Available from http://www.tardigrada.modena.unimo.it/miscellanea/Actual%20checklist%20of%20Tardigrada.pdf [accessed 10 March 2024]. https://dx.doi.org/10.25431/11380_1178608
Degma, P., Michalczyk, Ł., & Kaczmarek, Ł. (2008). Macrobiotus derkai, a new species of Tardigrada (Eutardigrada, Macrobiotidae, huziori group) from the Colombian Andes (South America). Zootaxa, 1731, 1–23. https://doi.org/10.11646/zootaxa.1731.1.1
Dueñas-Cedillo, A., Martínez-Méndez, E., García-Román, J., Armendáriz-Toledano, F., & Ruiz, E. A. (2020). Tardigrades from Iztaccíhuatl Volcano (Trans-Mexican Volcanic Belt), with the description of Minibiotuscitlalium sp. nov. (Eutardigrada: Macrobiotidae). Diversity, 12, 271. https://dx.doi.org/10.3390/d12070271
Dueñas-Cedillo, A., Venegas, I., García-Román, J., Jurado, E., Cuellar-Rodríguez, G., Villegas-Guzmán, G. A. et al. (2024). Towards an inventory of Mexican tardigrades (Tardigrada): a survey on the diversity of moss tardigrades with an emphasis in conifer forests from the Valley of Mexico Basin. Check List, 20, 471–498. https://doi.org/10.15560/20.2.471
García-Román, J., Dueñas-Cedillo, A., Cervantes-Espinoza, M., Flores-Martínez, J. J., Vargas-Mendoza, C. F., Ruiz, E. A. et al. (2022). A strategy to provide a present and future scenario of Mexican biodiversity of Tardigrada. Diversity, 14, 280. https://doi.org/10.3390/d14040280
Gąsiorek, P., Stec, D., Morek, W., & Michalczyk Ł. (2017). An integrative redescription of Echiniscus testudo (Doyère, 1840), the nominal taxon for the class Heterotardigrada (Ecdysozoa: Panarthropoda: Tardigrada). Zoologischer Anzeiger, 270, 107–122. https://doi.org/10.1016/j.jcz.2017.09.006
Gąsiorek, P., Stec, D., Morek, W., & Michalczyk, Ł. (2018). An integrative redescription of Hypsibius dujardini (Doyère, 1840), the nominal taxon for Hypsibioidea (Tardigrada: Eutardigrada). Zootaxa, 4415, 45–75. https://doi.org/10.11646/zootaxa.4415.1.2
Gąsiorek, P., Stec, D., Zawierucha, Z., Kristensen, R. M., & Michalczyk, Ł. (2018). Revision of Testechiniscus Kristensen, 1987 (Heterotardigrada: Echiniscidae) refutes the polar-temperate distribution of the genus. Zootaxa, 4472, 261–297. https://doi.org/10.11646/zootaxa.4472.2.3
Glime, J. M. (2017). Tardigrade survival. Chapter 5-1. In J. M. Glime (Ed.), Bryophyte ecology. Volume 2.Bryological Interaction. Ebook sponsored by Michigan Technological University and the International Association of Bryologists. Accessed June 21, 2024 from: http://digitalcommons.mtu.edu/bryophyte-ecology2/
Guidetti, R., & Bertolani, R. (2005). Tardigrade taxonomy: an updated checklist of the taxa and a list of characters for their identification. Zootaxa, 845, 1–46. https://doi.org/10.11646/zootaxa.845.1.1
Guidetti, R., Cesari, M., Bertolani, R., Altiero, T., & Rebecchi, L. (2019). High diversity in species, reproductive modes and distribution within the Paramacrobiotusrichtersi complex (Eutardigrada, Macrobiotidae). Zoological Letters, 5, 1–28. https://doi.org/10.1186/s40851-018-0113-z
Guidetti, R., Cesari, M., Giovannini, I., Ebel, C., Förschler, M. I., Rebecchi, L. et al. (2022). Morphology and taxonomy of the genus Ramazzottius (Eutardigrada; Ramazzottiidae) with the integrative description of Ramazzottiuskretschmanni sp. nov. The European Zoological Journal, 89, 346–370. https://doi.org/10.1080/24750263.2022.2043468
Guidetti, R., Schill, R. O., Bertolani, R., Dandekar, T., & Wolf, M. (2009). New molecular data for tardigrade phylogeny, with the erection of Paramacrobiotus gen. nov. Journal of Zoological Systematics and Evolutionary Research, 47, 315–321. https://doi.org/10.1111/j.1439-0469.2009.00526.x
Heinis, F. (1911). Beitrag zur Kenntnis der zentralamericanischen Moosfauna. Revue Suisse de Zoologie, 19, 253–266.
Hoang, D. T., Chernomor, O., von Haeseler, A., Minh, B. Q., & Vinh, L. S. (2018). UFBoot2: Improving the ultrafast bootstrap approximation. Molecular Biology and Evolution, 35, 518–522. https://doi.org/10.1093/molbev/msx281
Iharos, G. (1966). Neue Tardigraden-Arten aus Ungarn (Neuere Beitrage zur Kenntnis der Tardigraden Fauna Ungarns VI). Acta Zoologica Hungarica, 12, 111–122.
Kaczmarek, Ł., & Michalczyk, Ł. (2017). The Macrobiotushufelandi (Tardigrada) group revisited. Zootaxa, 4363, 101–123. https://doi.org/10.11646/zootaxa.4363.1.4
Kaczmarek, Ł., Cytan, J., Zawierucha, K., Diduszko D., & Michalczyk, Ł. (2014). Tardigrades from Peru (South America), with descriptions of three new species of Parachela. Zootaxa, 3790, 357–379. https://doi.org/10.11646/zootaxa.3790.2.5
Kaczmarek, Ł., Diduszko, D., & Michalczyk, Ł. (2011). New records of Mexican Tardigrada. Revista Mexicana de Bio- diversidad, 82, 1324–1327. https://doi.org/10.22201/ib.20078706e.2011.4.754
Kaczmarek, Ł., Gawlak, M., Bartels, P. J., Neslon, D. R., & Roszkowska, M. (2017). Revision of the genus Paramacrobiotus Guidetti et al., 2009 with the description of a new species, re-descriptions and a key. Annales Zoologici, 67, 627–656. https://doi.org/10.3161/00034541ANZ2017.67.4.001
Kaczmarek, Ł., Michalczyk, Ł., & McInnes, S. J. (2014). Annotated zoogeography of non-marine Tardigrada. Part I: Central America. Zootaxa, 3763, 1–62. https://doi.org/10.11646/zootaxa.3763.1.1
Kaczmarek, Ł., Michalczyk, Ł., & McInnes, S. J. (2015). Annotated zoogeography of non-marine Tardigrada. Part II: South America. Zootaxa, 3923, 1–107. https://doi.org/10.11646/zootaxa.3923.1.1
Kaczmarek, Ł., Michalczyk, Ł., & McInnes, S. J. (2016). Annotated zoogeography of non-marine Tardigrada. Part III: North America and Greenland. Zootaxa, 4203, 1–249. https://doi.org/10.11646/zootaxa.4203.1.1
Kaczmarek, Ł., Roszkowska, M., Poprawa, I., Janelt, K., Kmita, H., Gawlak, M. et al. (2020). Integrative description of bisexual Paramacrobiotus experimentalis sp. nov. (Macrobiotidae) from republic of Madagascar (Africa) with microbiome analysis. Molecular Phylogenetics and Evolution, 145, 106–730. https://doi.org/10.1016/j.ympev.2019.106730
Kalyaanamoorthy, S., Minh, B., Wong, T., von Haeseler, A., & Jermiin, L. (2017). ModelFinder: fast model selection for accurate phylogenetic estimates. Nature Methods, 14, 587–589. https://doi.org/10.1038/nmeth.4285
Katoh K., Misawa, K., Kuma K., & Miyata, T. (2002). MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Research, 30, 3059–3066. https://doi.org/10.1093/nar/gkf436
Katoh, K., Rozewicki, J., & Yamada, K. D. (2019). MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Briefings in Bioinformatics, 20, 1160–1166. https://doi.org/10.1093/bib/bbx108
Kayastha, P., Mioduchowska, M., Warguła, J., & Kaczmarek, Ł. (2023). A review on the genus Paramacrobiotus (Tardigrada) with a new diagnostic key. Diversity, 15, 977. https://doi.org/10.3390/d15090977
Kayastha, P., Stec, D., Sługocki, Ł., Gawlak, M., Mioduchowska, M., & Kaczmarek, Ł. (2023). Integrative taxonomy reveals new, widely distributed tardigrade species of the genus Paramacrobiotus (Eutardigrada: Macrobiotidae). Scientific Reports, 13, 2196. https://doi.org/10.1038/s41598-023-28714-w
Kumar, S., Stecher, G., Li, M., Knyaz, C., & Tamura, K. (2018). Mega X: molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution, 35, 1547–1549. https://doi.org/10.1093/molbev/msy096
León-Espinosa, G. A., Marley, N., Moreno-Talamantes, A., Nelson, D., & Rodríguez-Almaraz, G. (2017). Biodiversity of tardigrades in Mexico. Accessed November 18, 2023 from: https://www.researchgate.net/publication/320597470_Biodiversity_of_Tardigrades_in_Mexico
León-Espinosa, G. A., Moreno-Talamantes, A., & Rodríguez-Almaraz, G. A. (2019). Ositos de agua (Tardigrada) de México: los famosos desconocidos. Biología y Sociedad, 4, 61–70. https://doi.org/10.29105/bys2.4-40
May, R. M. (1948). Nouveau genre et espèce de tardigrade du Mexique: Haplomacrobiotushermosillensis. Bulletin de la Société Zoologique de France, 73, 95–97.
McInnes, S. J. (1994). Zoogeographic distribution of terrestrial/freshwater tardigrades from current literature. Journal of Natural History, 28, 257–352. https://doi.org/ 10.1080/00222939400770131
Michalczyk, Ł., & Kaczmarek, Ł. (2003). A description of the new tardigrade Macrobiotus reinhardti (Eutardigrada, Macrobiotidae, harmsworthi group) with some remarks on the oral cavity armature within the genus Macrobiotus Schultze. Zootaxa, 331, 1–24. https://doi.org/10.11646/zootaxa.331.1.1
Michalczyk, Ł., & Kaczmarek, Ł. (2006). Macrobiotus huziori, a new species of Tardigrada (Eutardigrada: Macrobiotidae) from Costa Rica (Central America). Zootaxa, 1169, 47–59. https://doi.org/10.11646/zootaxa.1169.1.3
Michalczyk, Ł., & Kaczmarek, Ł. (2013). The Tardigrada register: a comprehensive online data repository for tardigrade taxonomy. Journal of Limnology, 72, 175–181. https://doi.org/10.4081/jlimnol.2013.s1.e22
Michalczyk, Ł., Wełnicz, W., Frohme, M., & Kaczmarek, Ł. (2012a). Redescriptions of three Milnesium Doyère, 1840 taxa (Tardigrada: Eutardigrada: Milnesiidae), including the nominal species for the genus. Zootaxa, 3154, 1–20. https://doi.org/10.11646/zootaxa.3154.1.1
Michalczyk, Ł., Wełnicz, W., Frohme, M., & Kaczmarek, Ł. (2012b). Corrigenda of Zootaxa, 3154: 1–20 Redescriptions of three Milnesium Doyère, 1840 taxa (Tardigrada: Eutardigrada: Milnesiidae), including the nominal species for the genus. Zootaxa, 3393, 66–68. https://doi.org/10.11646/zootaxa.3393.1.6
Minh, B. Q., Schmidt, H. A., Chernomor, O., Schrempf, D. S., Woodhams, M. D., von Haeseler, A. et al. (2020). IQ-TREE 2. New models and efficient methods for phylogenetic inference in the Genomic Era. Molecular Biology and Evolution, 37, 1530–1534. https://doi.org/10.1093/molbev/msaa015
Mironov, S. V., Dabert, J., & Dabert, M. (2012). A new feather mite species of the genus Proctophyllodes Robin, 1877 (Astigmata: Proctophyllodidae) from the Long-tailed Tit Aegithalos caudatus (Passeriformes: Aegithalidae): morphological description with DNA barcode data. Zootaxa, 3253, 54–61. https://doi.org/10.11646/zootaxa.3253.1.2
Morek, W., & Michalczyk, Ł. (2020). First extensive multilocus phylogeny of the genus Milnesium (Tardigrada) reveals no congruence between genetic markers and morphological traits. Zoological Journal of the Linnean Society, 188, 681–693. https://doi.org/10.1093/zoolinnean/zlz040
Morek, W., Stec, D., Gąsiorek, P., Surmacz, B., & Michalczyk, Ł. (2018). Milnesium tardigradum Doyère, 1840: The first integrative study of interpopulation variability in a tardigrade species. Journal of Zoological Systematics and Evolutionary Research, 57, 1–23. https://doi.org/10.1111/jzs.12233
Moreno-Talamantes, A., & León-Espinosa, G. A. (2019). Nuevo registro de Diaforobiotusislandicus (Richters, 1904) (Eutardigrada: Richtersiidae) para México. Árido-Ciencia, 6, 5–12.
Moreno-Talamantes, A., León-Espinosa, G. A., García-Aranda, M. A., Flores-Maldonado, J. J., & Kaczmarek, Ł. (2020). The genus Milnesium Doyère, 1840 in Mexico with description of a new species. Annales Zoologici, 70, 467–486. https://doi.org/10.3161/00034541ANZ2020.70.4.001
Moreno-Talamantes, A., Roszkowska, M., García-Aranda, M. A., Flores-Maldonado, J. J., & Kaczmarek, Ł. (2019). Current knowledge on Mexican tardigrades with a description of Milnesiumcassandrae sp. nov. (Eutardigrada: Milnesiidae) and discussion on the taxonomic value of dorsal pseudoplates in the genus Milnesium Doyère, 1840. Zootaxa, 4691, 501–524. https://doi.org/10.11646/zootaxa.4691.5.5
Moreno-Talamantes, A., Roszkowska, M., Guayasamín, P. R., Flores, J. J., & Kaczmarek, Ł. (2015). First record of Dactylobiotus parthenogeneticus Bertolani, 1982 (Eutardigrada: Murrayidae) in Mexico. Check List, 11, 1723. http://dx.doi.org/10.15560/11.4.1723
Murray, J. (1907). XXV. Arctic Tardigrada, collected by Wm. S. Bruce. Earth Environ. Transactions of the Royal Society of Edinburgh, Earth Sciences, 45, 669–681.
Nelson, D. R., Bartels, P. J., & Guil, N. (2018). Tardigrade ecology. In R. O. Schill (Ed.), Water bears: the biology of tardigrades (pp. 163–210). Cham: Springer.
Nelson, D., Guidetti, R., & Rebecchi, L. (2015). Chapter 17 – Phylum Tardigrada. In J. Thorp, & Rogers, C. (Eds.), Thorp and Covich’s freshwater invertebrates (Fourth edition) (pp. 347–380). San Diego: Academic Press.
Nelson, D., & Marley, N. J. (2000). The biology and ecology of lotic Tardigrada. FreshwaterBiology, 44, 93–108. https://doi.org/10.1046/j.1365-2427.2000.00586.x
Núñez, P. G., León-Espinosa, G. A., Vázquez, R., Peña-Salinas, M. E., Rodríguez-Almaraz, G. A., & Moreno-Talamantes, A. (2021). First tardigrade records from San Pedro Mártir, Baja California, Mexico. Check List, 17, 1131–1136. https://doi.org/10.15560/17.4.1131
Palacio, P. J. L., & Guilbaud, M. N. (2015). Patrimonio natural de la Reserva Ecológica del Pedregal de San Ángel y áreas cercanas: sitios de interés geológico y geomorfológico al sur de la Cuenca de México. Boletín de la Sociedad Geológica Mexicana, 67, 227–244.
Pérez-Pech, W. A., Anguas-Escalante, A., Cutz-Pool, L. Q., & Guidetti, R. (2017). Doryphoribiuschetumalensis sp. nov. (Eutardigrada: Isohypsibiidae) a new tardigrade species discovered in an unusual habitat of urban areas of Mexico. Zootaxa, 4344, 345–356. http://dx.doi.org/10.11646/zootaxa.4344.2.9
Pérez-Pech, W. A., Anguas-Escalante, A., De Jesús-Navarrete, A., & Hansen, J. G. (2018). Primer registro genérico de tardígrados marinos en costas de Quintana Roo, México. Academia Journal, 10, 1909–1912.
Pérez-Pech, W. A., De Jesús-Navarrate, A., Demilio, E., Anguas-Escalante, A., & Hansen, J. G. (2020). Marine Tardigrada from the Mexican Caribbean with the description of Styraconyxrobertoi sp. nov. (Arthrotardigrada: Styraconyxidae). Zootaxa, 4731, 492–508. http://dx.doi.org/10.11646/zootaxa.4731.4.3
Pleijel, F., Jondelius, U., Norlinder, E., Nygren, A., Oxelman, B., Schander, C. et al. (2008). Phylogenies without roots? A plea for the use of vouchers in molecular phylogenetic studies. Molecular Phylogenetics and Evolution, 48, 369–71. http://dx.doi.org/10.1016/j.ympev.2008.03.024
Pilato, G. (1981). Analisi di nuovi caratteri nello studio degli Eutardigradi. Animalia, 8, 51–57.
Pilato, G. (2000). Macrobiotus centesimus, new species of eutardigrade from the South America. Bollettino delle Sedute della Accademia Gioenia di Scienze Naturali in Catania, 33, 97–101.
Pilato, G. (2006). Remarks on the Macrobiotus polyopus group, with the description of two new species (Eutardigrada, Macrobiotidae). Zootaxa, 1298, 37–47. https://doi.org/10.11646/zootaxa.1298.1.4
Pilato, G., & Binda, M. G. (2010). Definition of families, subfamilies, genera and subgenera of the Eutardigrada, and keys to their identification. Zootaxa, 2404, 1–54. https://doi.org/10.11646/zootaxa.2404.1.1
Pilato, G., Kiosya, Y., Lisi, O., Inshina, V., & Biserov, V. (2011). Annotated list of Tardigrada records from Ukraine with the description of three new species. Zootaxa, 3123, 1–31. https://doi.org/10.11646/zootaxa.3123.1.1
Pilato, G., Kiosya, Y., Lisi, O., & Sabella, G. (2012). New records of Eutardigrada from Belarus with the description of three new species. Zootaxa, 3179, 39–60. https://doi.org/10.11646/zootaxa.3179.1.2
Pilato, G., & Lisi, O. (2006). Notes on some tardigrades from southern Mexico with description of three new species. Zootaxa, 1236, 53–68. https://doi.org/10.11646/zootaxa.1236.1.4
Pilato, G., Sabella, G., & Lisi, O. (2016). Two new species of Milnesium (Tardigrada: Milnesiidae). Zootaxa, 4132, 575–587. https://doi.org/10.11646/zootaxa.4132.4.9
Ramazzotti, G. (1956). Tre nouve specie di Tardigradi ed altre specie poco comuni. Atti della Società Italiana di Scienze Naturali e del Museo Civico di Storia Naturale di Milano, 10, 284–291.
Ramazzotti, G., & Maucci, W. (1983). Il Phylum Tardigrada. 3th Edition. Memorie dell’ Istituto Italiano di Idrobiologia, 41, 1–1012.
Rambaut, A., Drummond, A. J., Xie, D., Baele, G., & Suchard. M. A. (2018). Posterior summarisation in Bayesian phylogenetics using Tracer 1.7. Systematic Biology, 67, 901–904. https://doi.org/doi:10.1093/sysbio/syy032
Rocha, A. M., González-Reyes, A. X., Ostertag, B., & Lisi, O. (2022). The genus Milnesium (Eutardigrada, Apochela, Milnesiidae) in Argentina: description of three new species and key to the species of South America. European Journal of Taxonomy, 822, 1–54. https://doi.org/10.5852/ejt.2022.822.1807
Ronquist, F., & Huelsenbeck, J. P. (2003). MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinfor- matics, 19, 1572–1574. https://doi.org/10.1093/bioinformatics/btg180
Sands, C. J., McInnes, S. J., Marley, N. J., Goodall-Copestake, W. P., Convey, P., & Linse, K. (2008). Phylum Tardigarda: an “individual” approach. Cladistics, 24, 1–18. http://dx.doi.org/10.1111/j.1096-0031.2008.00219.x
Schuster, R. O. (1971). Tardigrada from Barranca del Cobre, Sinaloa and Chihuahua, Mexico. Proceedings of the Biological Society of Washington, 84, 2130–224.
Stec, D., Dudziak, M., & Michalczyk, Ł. (2020). Integrative descriptions of two new Macrobiotidae species (Tardigrada: Eutardigrada: Macrobiotoidea) from French Guiana and Malaysian Borneo. Zoological Studies, 59, e23. https://doi.org/10.6620/ZS.2020.59-23
Stec, D., Gąsiorek, P., Morek, W., Kosztyła, P., Zawierucha, K., Michno, K. et al. (2016). Estimating optimal sample size for tardigrade morphometry. Zoological Journal of the Linnean Society, 178, 776–784. https://doi.org/10.1111/zoj.12404
Stec, D., Kristensen, R. M., & Michalczyk, Ł. (2020). An integrative description of Minibiotusioculator sp. nov. from the Republic of South Africa with notes on Mini- biotuspentannulatus Londoño et al., 2017 (Tardigrada: Macrobiotidae). Zoologischer Anzeiger, 286, 117–134. https://doi.org/10.1016/j.jcz.2020.03.007
Stec, D., Krzywański, Ł., Zawierucha, K., & Michalczyk, Ł. (2020). Untangling systematics of the Paramacrobiotus areolatus species complex by an integrative redescription of the nominal species for the group, with multilocus phylogeny and species delineation in the genus Paramacrobiotus. Zoological Journal of the Linnean Society, 188, 694–716. https://doi.org/10.1093/zoolinnean/zlz163
Stec, D., Morek, W., Gąsiorek, P., & Michalczyk, Ł. (2018). Unmasking hidden species diversity within the Ramazzottius oberhaeuseri complex, with an integrative redescription of the nominal species for the family Ramazzottiidae (Tardigrada: Eutardigrada: Parachela). Systematics and Biodiversity, 16, 357–376. https://doi.org/10.1080/14772000.2018.1424267
Stec, D., Roszkowska, M., Kaczmarek, Ł., & Michalczyk, Ł. (2018). Paramacrobiotus lachowskae, a new species of Tardigrada from Colombia (Eutardigrada: Parachela: Macrobiotidae). New Zealand Journal of Zoology, 45, 43–60. https://doi.org/10.1080/03014223.2017.1354896
Stec, D., Smolak, R., Kaczmarek, Ł., & Michalczyk, Ł. (2015). An integrative description of Macrobiotus paulinae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group) from Kenya. Zootaxa, 4052, 501–526. https://doi.org/10.11646/zootaxa.4052.5.1
Stec, D., Vecchi, M., Calhim, S., & Michalczyk, Ł. (2021). New multilocus phylogeny reorganises the family Macrobiotidae (Eutardigrada) and unveils complex morphological evolution of the Macrobiotus hufelandi group. Molecular Phylogenetics and Evolution, 160, 106987. https://doi.org/10.1016/j.ympev.2020.106987
Stucky, B. J. (2012). SeqTrace: a graphical tool for rapidly processing DNA sequencing chromatograms. Journal of Biomolecular Techniques, 23, 90–93. https://doi.org/10.7171/jbt.12-2303-004
Sugiura, K., Matsumoto, M., & Kunieda, T. (2022). Description of a model tardigrade Paramacrobiotus metropolitanus sp. nov. (Eutardigrada) from Japan with a summary of its life history, reproduction and genomics. Zootaxa, 5134, 92–112. https://doi.org/10.11646/zootaxa.5134.1.4
Tumanov, D. V. (2006). Five new species of the genus Milnesium (Tardigrada, Eutardigrada, Milnesiidae). Zootaxa, 1122, 1–23. https://doi.org/10.11646/zootaxa.1122.1.1
Tumanov, D. V. (2020). Integrative redescription of Hypsibiuspallidoides Pilato et al., 2011 (Eutardigrada: Hypsibioidea) with the erection of a new genus and discussion on the phylogeny of Hypsibiidae. European Journal of Taxonomy, 681, 1–37. https://doi.org/10.5852/ejt.2020.681
Vaidya, G., Lohman, D. J., & Meier, R. (2011). SequenceMatrix: concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics, 27, 171–180. https://doi.org/10.1111/j.1096-0031.2010.00329.x
Vecchi, M., Stec, D., Vuori, T., Ryndov, S., Chartrain, J., & Calhim, S. (2022). Macrobiotusnaginae sp. nov., a new xerophilous tardigrade species from Rokua Sand Dunes (Finland). Zoological Studies, 61, e22. https://doi.org/10.6620/ZS.2022.61-22
Zeller, C. (2010). Untersuchung der phylogenie von Tardigraden anhand der Genabschnitte 18S rDNA und Cytochrom c Oxidase Untereinheit 1 (COX I) (MSc. Thesis). Technical University of Applied Sciences Wildau. Wildau, Germany.
Yolanda Arana-Gabriel a, Cristina Burrola-Aguilar a, Roberto Garibay-Orijel b, *, Adriana Montoya c
a Universidad Autónoma del Estado de México, Facultad de Ciencias, Centro de Investigación en Recursos Bióticos, Carretera Toluca-Atlacomulco Km 14.5, 50200 Toluca, Estado de México, México
b Universidad Nacional Autónoma de México, Instituto de Biología, Departamento de Botánica, Circuito Exterior s/n, Ciudad Universitaria, Coyoacán, 04510 Ciudad de México, México
c Universidad Autónoma de Tlaxcala, Centro de Investigación en Ciencias Biológicas, Km 10.5 Autopista Texmelucan-Tlaxcala, 90120 Ixtacuixtla, Tlaxcala, México
*Autor para correspondencia: rgaribay@ib.unam.mx (R. Garibay-Orijel)
Recibido: 22 septiembre 2023; aceptado: 11 diciembre 2024
Resumen
Las especies del género Lyophyllum son ampliamente valoradas por su importancia cultural y biotecnológica. Las especies de la sección Difformia son polimórficas debido a su plasticidad fenotípica, lo que dificulta su correcta determinación; en el centro de México estas especies se conocen tradicionalmente como “clavitos”. En el presente trabajo se describe la morfología macroscópica y microscópica, filogenia, interacción ecológica, importancia cultural y se presentan los resultados preliminares de bioensayos de fructificación de Lyophyllum herrerae sp. nov. dentro de la sección Difformia. Lyophyllum herrerae se encuentra entre las 10 especies con mayor importancia cultural en el centro de México, es saprótrofa y altamente variable (aun en cultivo); crece, predominantemente, en bosques de pino aunque también en bosques de oyamel y encino. Aquí demostramos que esta especie es susceptible de cultivo, obteniendo cuerpos fructíferos a nivel experimental. Adicionalmente, se presenta una clave taxonómica para las especies de la sección Difformia. Estos hallazgos representan una alternativa en el aprovechamiento de este patrimonio biocultural, generando beneficios alimenticios y económicos para las comunidades locales contribuyendo a la soberanía alimentaria.
Lyophyllum herrerae sp. nov, one of the most cultural important mushrooms of Central Mexico with potential for cultivation
Abstract
Lyophyllum species are widely valued for their cultural and biotechnological importance. Species of Difformia section are polymorphic due to their phenotypic plasticity, which makes their correct identification difficult; in central Mexico, these species are traditionally known as “clavitos”. This paper describes the macroscopic and microscopic morphology, phylogeny, ecological interactions, and cultural importance of Lyophyllum herrerae sp. nov. within the section Difformia, and presents preliminary results of fruiting bioassays. Lyophyllum herrerae is among the 10 most culturally important species in central Mexico. It is saprotrophic and highly variable (even in cultivation); it grows predominantly in pine forests, although it also grows in fir and oak forests. Here, we demonstrate that this species is susceptible to cultivation, obtaining fruiting bodies experimentally. Additionally, a taxonomic key is presented for the species in the Difformia section. These findings represent an alternative for harnessing this biocultural heritage, generating nutritional and economic benefits for local communities and contributing to food sovereignty.
A nivel mundial, algunas especies del género Lyophyllum P. Karst., como L. aggregatum (Schaeff.) Kühner, L. connatum (Schumach.) Singer, L. decastes (Fr.)Singer, L. fumosum (Pers.)P.D. Orton, L. shimeji (Kawam.) Hongo, L. sykosporum Hongo y Clémençon, y L. ulmarium (Bull.) Kühner, son utilizadas como alimento y/o como medicina (Boa, 2009; Ukawa et al., 2000). Lyophyllum shimeji es una de las especies comestibles más costosas y buscadas en los mercados internacionales junto con otras especies como Tuber melanosporum Vittad., Tricholoma matsutake (S. Ito y S. Imai) Singer, Boletus edulis Bull., Cantharellus cibarius Fr., Amanita caesarea (Scop.) Pers. y Lactarius deliciosus (L.) Gray. Lyophyllum shimeji es conocido como “honshimeji” y es considerado como un manjar en Japón y China (Wang y Chen, 2015). A L. decastes y L. semitale (Fr.) Kühner se les atribuyen propiedades medicinales por sus efectos antineoplásicos e hipoglucémicos (Ukawa et al., 2000). El cultivo de Lyophyllum sigue siendo un proceso complejo y largo. Lyophyllum shimeji se cultiva de manera comercial, mientras que L. connatum y L. decastes de manera experimental (Sánchez y Mata, 2012).
En México se han citado 5 especies de Lyophyllum con uso alimentario: L. aggregatum, L. decastes, L. fumosum, L. loricatum y L. aff. shimeji; éstas fructifican entre junio y agosto en bosques de Abies religiosa, Pinus, Quercus, Abies-Pinus y Pinus-Alnus (Burrola-Aguilar et al., 2012; Estrada-Martínez et al., 2009; Montoya et al., 2004; Garibay-Orijel y Ruan-Soto, 2014; Servín-Campuzano y Alarcón-Cháires, 2018). Las 5 especies son apreciadas por su sabor y, en conjunto, se reportan dentro de las 10 especies con mayor importancia cultural en diversas localidades de estudio, junto con A. caesarea s.l., Cantharellus cibarius s.l. y Lactarius indigo (Garibay-Orijel y Ruan-Soto, 2014). Burrola-Aguilar et al. (2012) reportan a L. decastes y Lyophyllum sp. entre los hongos más difíciles de encontrar por los recolectores en Amanalco, Estado de México; sin embargo, Montoya et al. (2004) mencionan que Lyophyllum sp. es muy abundante en el Parque Nacional La Malinche, Tlaxcala.
El género Lyophyllum es polifilético, de acuerdo con Bellanger et al. (2015). Las especies morfológicas agrupadas en este género se sitúan en 5 clados diferentes (clados: I, Va, Vb, IX, XI) cada uno de los cuales merecería un rango genérico al incluirse miembros de otros géneros como: Hypsizygus, Tephrocybe, Clitocybe, Calocybe y Rugosomyces. El clado Va corresponde a Lyophyllum sección Lyophyllum y el clado Vb a Lyophyllum sección Difformia (Bellanger et al., 2015). Las especies con uso comestible se encuentran dentro de la sección Difformia, un clado bien soportado por estudios como los deBellanger et al. (2015), Sundberg (2010) y Larsson y Sundberg (2011). La sección Difformia es monofilética y está integrada por L. loricatum, L. decastes s.l., L. fumosum y L. shimeji (Kalamees, 2004; Knudsen y Vesterholt, 2008; Li et al., 2019; Sundberg, 2010). Bellanger et al. (2015) consideran dentro del clado Difformia a L. decastes s.l., L. fumosum y L. shimeji, especies morfogenéticas e incluyen en la sección 2 filoespecies crípticas no nombradas formalmente. Lavorato y Contu (2015) incluyeron en esta sección a L. mariae y Wei et al. (2023) a L. subdecastes.
Lyophyllum sección Difformia se caracteriza porque sus especies presentan forma tricolomatoide o clitocyboide, hábito fasciculado, conado u ocasionalmente solitario; el contexto del esporoma no tiene tonos de color azul ni se ennegrece, en ocasiones es ligeramente pardo; las láminas presentan “hematomas”, las basidiosporas tienen la pared lisa, la forma puede variar de globosas a elipsoides (Kalamees, 2004; Knudsen y Vesterholt, 2008). Su interacción ecológica es muy variada, se ha reportado que L. shimeji es una especie micorrizógena facultativa que se asocia con Pinus y Quercus (Larsson y Sundberg, 2011; Pera y Alvares, 1995; Yamada et al., 2001) ycon Quercus serrata (Yamanaka, 2009); L. fumosum se asocia con P.silvestris (Yamada et al., 2001), mientras que L. loricatum se ha reportado como saprótrofa y L. decastes como saprótrofa y como micorrízica con P. pinaster (Pera y Álvarez, 1995; Yamada et al., 2001).
Las especies dentro de la sección Difformia han sido reportadas como polimórficas, trabajos como los de Bellanger et al. (2015), Hofstetter et al. (2002) y Moncalvo et al. (2000) mencionan que esta variación morfológica puede estar sujeta a factores como su plasticidad fenotípica o evolución paralela de algunas especies. Esto dificulta su estudio taxonómico, ya que ocasiona confusión en la determinación de las especies generando un gran número de sinonimias.
Dada su importancia cultural y potencial de cultivo, es fundamental realizar taxonomía integral para resolver la problemática de las especies del género. Aspectos como su distribución, interacción ecológica, cultivo y aspectos culturales proporcionan datos relevantes para la delimitación de las especies. Esto permitirá contribuir con el conocimiento del patrimonio micocultural y a desarrollar estrategias de aprovechamiento con enfoques biotecnológicos en beneficio de la seguridad alimentaria y económica de las comunidades locales y originarias.
Por lo tanto, el presente trabajo, tiene como objetivo el empleo de análisis filogenéticos, características macro y micromorfológicas, interacciones ecológicas, aspectos culturales y biotecnológicos (asociados a bioensayos de fructificación)(Wang et al., 2013) para describir a Lyophyllum herrerae como una nueva especie con importancia cultural y biotecnológica en el centro de México.
Materiales y métodos
Los ejemplares se recolectaron en bosques de Abies religiosa (Kunth) Schltdl. y Cham., Pinus spp., Quercus spp. y bosques mixtos en Tlaxcala, Estado de México y Ciudad de México. Algunos ejemplares se obtuvieron a partir de un muestreo dirigido con ayuda de la población local y otros se compraron en mercados tradicionales (tabla 1).
La descripción de caracteres macroscópicos se realizó en fresco de acuerdo con las sugerencias de Delgado et al. (2005). Los colores se registraron en fresco considerando los códigos de Kornerup y Wanscher (1978). Los ejemplares fueron fotografiados en fresco y herborizados a no más de 60 ºC de acuerdo con Cifuentes et al. (1986). Posteriormente, se etiquetaron y se depositaron en la Colección de Hongos del Herbario Nacional de México en el Instituto de Biología, UNAM (MEXU-HO), Herbario Universitario TLXM y en el Centro de Investigación en Recursos Bióticos de la Universidad Autónoma del Estado de México.
Para la descripción de caracteres microscópicos y evidenciar la granulación siderófila se utilizó acetocarmín; así como KOH (10%), agua, azul de algodón, rojo Congo y Melzer para la caracterización de basidios, basidiosporas, subhimenio, trama himenoforal, pileipellis y estipitipellis (Largent et al., 1977). Para las medidas de las esporas (n = 20) se realizaron preparaciones temporales a partir de cortes de las láminas y se obtuvo el cociente de forma (Q = largo/ancho) (Largent et al., 1977); para los basidios y células marginales (n = 20) se realizaron cortes transversales de las láminas. Todas las preparaciones se observaron con aumento de 1,000x con un microscopio óptico Motic® y el software Motic digital Microscope DMB3-223 (Motic China Group Co., Ltd., 2001-2004).
Debido a la alta variabilidad morfológica en las basidiosporas de los ejemplares estudiados, se citan los valores promedios y extremos del holotipo y también los tamaños extremos en el resto de los ejemplares revisados de la siguiente manera: (Al) al-Cl-bl (Bl) × (Aa) aa-Ca-ba (Ba). Donde: Cl es el promedio del largo del holotipo, al y bl son los extremos de las medidas de largo del holotipo; Ca es el promedio del ancho del holotipo, aa y ba son los extremos del ancho del holotipo; Al, Bl son las medidas extremas del largo de todos los ejemplares revisados, Aa y Ba son las medidas extremas del ancho de todos los ejemplares revisados. El cociente de las esporas se representa como: Qa-Qc-Qb; donde Qa es el valor mínimo del cociente entre las medias de todos los ejemplares, Qc es el valor del holotipo y Qb corresponde al valor máximo del cociente entre las medias de todos los ejemplares.
Todos los análisis estadísticos se realizaron en el software R (R Core Team, 2024). Se utilizaron las pruebas de Shapiro-Wilk y Lilliefors para determinar la normalidad de los datos; así como la prueba de Levene para la homocedasticidad de varianza. Para el caso en el que los datos no presentaron una distribución normal, se utilizó la prueba no paramétrica de Kruskal-Wallis y para los casos de normalidad se realizó un Anova de Welch para determinar diferencias significativas del largo, ancho y Q de los ejemplares analizados. Para la diferencia entre los grupos se realizó la prueba de Dunn (p < 0.05), además de la prueba de Bonferroni para corregir los errores en las comparaciones múltiples. Los resultados obtenidos fueron graficados utilizando la función ggplot. Las librerías utilizadas en el software R fueron, “car” (Fox y Weisberg, 2019), “ggplot 2” (Wickham, 2016), “readr” (Wickham et al., 2022)., “dunn.test” (Dunn, 1964), “FSA” (Ogle et al., 2023), “dplyr” (Wickham et al., 2023) y “viridis” (Garnier et al., 2024).
Tabla 1
Ejemplares estudiados.
Número de recolecta
Número de herbario
Nombre común
Vegetación
Fecha de recolecta
Estado
Región
GO-2009-278
MEXU 26748
Clavitos
desconocida
Edo. Mex.
Mercado de Amecameca
HC-PNNT-078
MEXU 26594
Clavo de oyamel
Bosque de Abies religiosa
23/07/2008
Edo. Mex.
Zinacantepec
HC-PNNT-246
MEXU 26689
Clavitos
Bosque de Pinus sp.
29/08/2008
Edo. Mex.
Zinacantepec
A. Montoya 3005
TLXM 7001
Xolete regadito
Bosque de Pinus sp.
Tlaxcala
A. Montoya 3022
TLXM 7002
sin nombre
Bosque de Quercuscrasifolia, Q. laeta, Q. laurina
_______
Tlaxcala
_______
Jaime-Salinas 24
TLXM 7003
Xolete de encino
Bosque de Quercus sp.
_______
Tlaxcala
Tlaxco
Jaime-Salinas 36
TLXM 7004
Hongo blanco de monte, xolete blanco
_______
_______
Tlaxcala
Parque Nacional La Malinche
Lorant-Flores A. 47
MEXU 30216
Clavito, Hongo de mata, Güeritos, Negritos, Hongo blanco
______
12/07/2017
CdMx
Milpa alta, Santa Ana Tlacotenco
Lorant-Flores A. 49
MEXU 30357
Clavito de encinal
Bosque de Quercus sp.
13/07/2017
CdMx
Milpa alta, Santa Ana Tlacotenco
Lorant-Flores A. 52
MEXU 30358
Cuaresmeño
_______
13/07/2017
CdMx
Milpa alta, Santa Ana Tlacotenco
Lorant-Flores A. 66
MEXU 30217
Clavitos
_______
05/08/2017
CdMx
Milpa alta, Santa Ana Tlacotenco
Lorant-Flores A. 42
MEXU 30359
Clavito de encinal
Bosque de Quercus sp.
05/07/2017
CdMx
Milpa alta, Santa Ana Tlacotenco
AGYLyo-5.3
MEXU 28149
Clavitos
Bosque de Abies religiosa
01/07/2015
Edo. Mex.
Zinacantepec
CIRB-H01
CIRB HO1
Clavo
Bosque de Pinus sp.
20/07/2019
Edo. Mex.
Coatepec Harinas
CIRB-H02 (holotipo)
MEXU 30365
Clavitos
Bosque de Pinus sp.
25/07/2019
Edo. Mex.
Isidro Fabela
CIRB-H03
CIRB H03
Clavitos
Bosque de Pinus sp.
25/07/2019
Edo. Mex.
Otzolotepec
CIRB-H04
CIRB HO4
Clavo
Bosque de Pinus sp.
27/07/2019
Edo. Mex.
Toluca
CIRB-H05
MEXU 30368
Clavo
Bosque de Pinus sp.
27/07/2019
Edo. Mex.
Zinacantepec
CIRB-H06
CIRB H06
Clavitos
Bosque de Pinus sp.
25/07/2019
Edo. Mex.
Capulhuac
CIRB-H07-cultivo
MEXU 30360
______
Ejemplares cultivados de la cepa IE 983 del ejemplar MEXU 28149
13/06/2023
_______
__________
Para la extracción de ADN, amplificación por PCR y secuenciación Sanger se usaron los protocolos de Sambrook et al. (1989) y Sánchez-Ledesma et al. (2022). El ADN se extrajo de ejemplares secos por el método CTAB y se amplificó por PCR en reacciones de 25 μl. Para los análisis filogenéticos se usó la región de los espaciadores transcritos internos ribosomales (ITS), pues ha demostrado discriminar adecuadamente las especies en L. sección Difformia (Kalamees, 2004; Knudsen y Vesterholt, 2008; Lavorato y Contu, 2015; Li et al., 2019; Sundberg, 2010; Wei et al., 2023). La región de los ITS se amplificó con los oligonucleótidos ITS1F e ITS4. La amplificación se llevó a cabo en un termociclador MiniAmp Plus (Applied Biosystems, EUA). Los productos de PCR se limpiaron con ExoSAP-IT (Thermofisher, EUA). Las secuencias de los ITS se obtuvieron en el Laboratorio de Secuenciación de la Biodiversidad y la Salud del Instituto de Biología de la UNAM, utilizando BigDye Terminator 3.1 (Thermofisher), en ambas direcciones.
Las secuencias de ADN se editaron y alinearon en Geneious Prime 2023 con el algoritmo de Muscle 5.1 (Edgar, 2004). Las secuencias de ADN nuevas se depositaron en GenBank (tabla 2). El alineamiento para los análisis filogenéticos (material suplementario 1) incluyó las secuencias generadas en este estudio, las incluidas previamente en análisis de Lyophyllum sección Difformia y secuencias de alta similitud de nucleótidos obtenidas de GenBank con el algoritmo Blast (Altschul et al., 1990; tabla 2). Se alinearon un total de 60 secuencias de 11 taxones de la sección Difformia y 3 especies de Tephrocybe como grupo externo. El alineamiento tuvo 540 posiciones, éste se revisó manualmente y las regiones de alineamiento ambiguo fueron excluidas.
Se realizaron análisis filogenéticos por el método de inferencia bayesiana y el de máxima verosimilitud. Primero, se eligió el modelo evolutivo más adecuado con Jmodel test 2 (Darriba et al., 2012), que resultó el HKY85 con proporción de sitios invariables. Los valores de probabilidad posterior bayesiana (PPB) se obtuvieron en MrBayes 3.2.6 (Ronquist y Huelsenbeck, 2003), se corrieron 4 cadenas de Monte Carlo con 10 millones de generaciones, se muestreó cada 100 y se descartó el primer 10% de los árboles. Se usó Tracer 1.7 para calcular el tamaño efectivo de muestra (ESS, por sus siglas en inglés) y para visualizar la convergencia de las cadenas (Rambaut et al., 2018). Los valores de máxima verosimilitud (MV) se obtuvieron en PhyML 3.3.2 (Guindon et al., 2010) con mil réplicas de bootstrap y optimizando tanto la topología del árbol como el largo de las ramas. Estos análisis se implementaron en Geneiuos Prime 2023.
Se realizó una clave taxonómica con base en caracteres morfológicos e interacción ecológica para las especies que han sido reportadas dentro de la sección Difformia. Se realizó una revisión bibliográfica detallada sobre las investigaciones enfocadas en el conocimiento micológico tradicional (CMT) en México, con atención en las especies reportadas del género Lyophyllum para recabar información relacionada a sus usos, nombres comunes, interacción ecológica, época de fructificación e importancia cultural.
Los cuerpos fructíferos obtenidos de cultivo experimental fueron donados por MycoSeta® para su caracterización macro y microscópica en el presente estudio y para evidenciar la plasticidad morfológica en sus diferentes etapas de desarrollo. Los cuerpos fructíferos fueron obtenidos a partir de la cepa IE 983 aislada de MEXU 28149.
Resultados
Los análisis filogenéticos de máxima verosimilitud y bayesianos de Lyophyllum sección Difformia resultaron en la misma topología. Para los análisis bayesianos, todos los parámetros de las cadenas convergieron con un ESS siempre mayor a 4,592. En la figura 1 se observan 2 clados principales: el primero con muy buen soporte (PPB/MV = 1/98) en donde se encuentran L. littoralis, L. loricatum y L. decastes s.l., el segundo clado no tiene soporte y en él se encuentran 3 clados que incluyen a: L. shimeji, L. fumusum y Lyophyllum herrerae. Los ejemplares de esta especie resultaron en un clado monofilético no descrito previamente y bien soportado con PPB = 0.95 y soporte de bootstrap moderado de MV = 78%; es un clado con características morfológicas y microscópicas diagnósticas particulares. Por lo que, a continuación, se describe a Lyophyllum herrerae como nueva especie.
Tabla 2
Secuencias de DNA usadas en el análisis filogenético
Especie
GenBank
Voucher
Referencia
Lyophyllum aff. fumosum
KT875064
CB08330
este trabajo
Lyophyllum aff. fumosum
KT875066
AR09641
este trabajo
Lyophyllum aff. fumosum
KY195931
IE981
este trabajo
Lyophyllum cf. lanzonii
KP192546
LIP: PAM060928030
Bellanger et al. (2015)
Lyophyllum conglobatum var. albidopallidum
KP192602
FR2014020
Bellanger et al. (2015)
Lyophyllum decastes
AB269928
Miyagi LD1 Gou
Babasaki et al. (2007)
Lyophyllum decastes
AB285107
Miyagi LD1 Gou (Variety No. 8121)
Babasaki et al. (2007)
Lyophyllum decastes
AB301605
NBRC 33134
Maeta et al. (2008)
Lyophyllum decastes
AF357059
JM87/16(T1)
Hofstetter et al. (2002)
Lyophyllum decastes
FJ810160
dd08054
no publicado
Lyophyllum decastes
HM119485
Ld418
no publicado
Lyophyllum decastes
HM572547
LAS06-152
Larsson y Sundberg (2011)
Lyophyllum decastes
JN983979
Ldec6Q106
Visnovsky et al. (2014)
Lyophyllum decastes
JN983983
Ldec3Q106
Visnovsky et al. (2014)
Lyophyllum fumosum
HM572537
Sundberg090813
Larsson y Sundberg (2011)
Lyophyllum fumosum
HM572538
Lipovac090903
Larsson y Sundberg (2011)
Lyophyllum fumosum
HM572539
SJ02-006
Larsson y Sundberg,(2011)
Lyophyllum fumosum
HM572540
Aase810721
Larsson y Sundberg, (2011)
Lyophyllum fumosum
HM572541
LAS00-144
Larsson y Sundberg, (2011)
Lyophyllum fumosum
JF908340
16077
Osmundson et al. (2013)
Lyophyllum fumosum
JN983977
LfumNlf24
Visnovsky et al. (2014)
Lyophyllum fumosum
JX966309
L2010512370
no publicado
Lyophyllum fumosum
JX966310
L2010512371
no publicado
Lyophyllum herrerae
KT875068
HC-PNNT-078
este trabajo
Lyophyllum herrerae
KT875069
GO-2009-278
este trabajo
Lyophyllum herrerae
KT875070
HC-PNNT-246
este trabajo
Lyophyllum herrerae
KY195933
UBC F-32192
este trabajo
Lyophyllum herrerae
OR116953
am3005a
este trabajo
Lyophyllum herrerae
OR116954
am3022
este trabajo
Lyophyllum herrerae
OR116955
CIRB-H01
este trabajo
Lyophyllum herrerae holotipo
OR116956
CIRB-H02
este trabajo
Lyophyllum herrerae
OR116957
CIRB-H03
este trabajo
Lyophyllum herrerae
OR116958
CIRB-H04
este trabajo
Lyophyllum herrerae
OR116959
CIRB-H05
este trabajo
Lyophyllum herrerae
OR116960
CIRB-H06
este trabajo
Lyophyllum herrerae
OR116961
Jasq24
este trabajo
Lyophyllum herrerae
OR116962
Jasq36
este trabajo
Lyophyllum herrerae
OR116963
Lorant-FloresA.47
este trabajo
Tabla 2. Continúa
Especie
GenBank
Voucher
Referencia
Lyophyllum herrerae
OR116964
Lorant-FloresA.49
este trabajo
Lyophyllum herrerae
OR116965
Lorant-FloresA.52
este trabajo
Lyophyllum herrerae
OR116966
Lorant-FloresA.66
este trabajo
Lyophyllum herrerae
OR116967
Lorant-FloresA.92
este trabajo
Lyophyllum littoralis
JX280410
CA20091210
no publicado
Lyophyllum loricatum
JF908336
13175
Osmundson et al. (2013)
Lyophyllum loricatum
JX280406
CA20090202.03
no publicado
Lyophyllum loricatum f. subxanthum holotipo
JX280407
01.12.09
no publicado
Lyophyllum shimeji
HM572522
“Cultivar”
Larsson y Sundberg (2011)
Lyophyllum shimeji
HM572530
Olsen821006
Larsson y Sundberg (2011)
Lyophyllum shimeji
HM572536
Fallman090927
Larsson y Sundberg (2011)
Lyophyllum shimeji
JN983958
AT608
Visnovsky et al. (2014)
Lyophyllum shimeji
JN983959
AT713
Visnovsky et al. (2014)
Lyophyllum shimeji
JN983967
JS10
Visnovsky et al. (2014)
Lyophyllum shimeji
JN983975
INA1
Visnovsky et al. (2014)
Lyophyllum shimeji
JN983985
NZ4Q88
Visnovsky et al. (2014)
Lyophyllum shimeji
MF955187
UBC F-32192
no publicado
Lyophyllum sp.
KF702394
ql-6
no publicado
Lyophyllum tenebrosum
KP192615
LIP:RC11100801
Bellanger et al. (2015)
Tephrocybe ambusta
AF357057
CBS452.87
Hofstetter et al. (2002)
Tephrocybe anthracophila
AF357055
HC79/132
Hofstetter et al. (2002)
Tephrocybe atrata
AF357053
CBS709.87
Hofstetter et al. (2002)
Descripción
Lyophyllum herrerae Arana-Gabriel, Burrola-Aguilar, Garibay-Orijel y Montoya, sp.nov.
Fig. 2a-m
Mycobank: MB858523
Diagnosis. Cap of 30-90 (-195) mm in diameter; its surface is dry in most cases, but it can be humid or hygrophanous, in a dark brown color. As it matures, the color turns clearer, predominately light pale yellow, pastel grey or brownish-orange, predominately with a greyish-brown, with yellowish-brown to champagne color spots; from convex to flat-convex; incurved margin to straight margin with a crenulated wavy edge; generally showing dark brown, radial fibrils. Gills are subdecurrent to adherent, edge generally smooth to slightly wavy or fimbriated, lamellulae attenuated; in cream color, greyish-white or pale yellow, in some cases, they present champagne-colored spots. Stipe of 30-100 (-270) mm long and 5-20 mm wide, central, and sinuous with fibrilous surface; with a cream to yellowish, pale greyish yellow, with some champagne-colored spots that, in certain occasions when manipulating, accentuate to dark brown. Basidia (22.3) 26.6-30.5-33.3 (36.7) × (4.6) 5.3-6.8-9.0 (9.3), 3-4 sterigmata. Basidiospores (3.7) 4.3-4.8-6.0 (7.0) ± 0.58 × 2.3-3.4-4.3 (5.7) ± 0.51 μm, Q = 1.2-1.4-1.6 ± 0.19, ellipsoid to amplified ellipsoid to elongated, hyaline, uni or two-guttulated, cyanophilic and inamyloid. Marginal cells (cheilocystidia) 22.9-41.0 × 3.0-5.2 μm, inconspicuous, filiform-fusiform to cylinder-flexuous, hyaline and they can even be absent in some specimens.
Esporoma: píleo de 30-90 mm de diámetro, en algunos casos alcanza los 195 mm; en estado juvenil es convexo, conforme madura es plano-convexo, en algunos casos llega a ser plano o giboso, con el disco obtuso, vista apical orbicular; margen de incurvado a decurvado o recto dependiendo del estado de maduración; borde ondulado, crenulado o entero. La superficie es de seca a húmeda, higrófana o ligeramente aceitosa; generalmente tiene fibrillas del mismo color que el píleo, en algunos casos glabra. Unión con el contexto homogénea. El color es muy variable en las diferentes etapas de maduración, por la exposición y la vegetación asociada. En estado juvenil es color café claro en el margen (6D5, 6D3) con el disco café oscuro (5F4-6F5-6F3) y con algunas manchas café claro (5D3, 5E4, 5D1) en todo el píleo (fig. 2a, f). En muchos casos este color puede prevalecer en estado adulto; sin embargo, en algunos otros casos el color es más claro, llegando a ser amarillo claro (4A4), gris pastel (5C1) o naranja parduzco (5C3), predomina el color café grisáceo (5E2) (fig. 2b, c); a veces con manchas de color café amarillento (5F6) a champán (4B4) (fig. 2h, i, l). También pueden ser café oscuro (6F8) a café (8F6) (fig. 2d, e) o crema (4A3) (fig. 2j, l) con tonos grises (5C1) (fig. 2m) o con el disco color café oscuro (6F4) (fig. 2g, k).
Figura 1. Árbol de máxima verosimilitud de Lyophyllum sección Difformia. En los nodos se muestran los valores de soporte de probabilidades posteriores bayesianas/porcentaje de bootstrap de máxima verosimilitud.
Contexto del píleo y estípite: blanco (A1), sólido, sin cambios de color al maltrato, olor dulce.
Láminas: juntas, subadheridas, adheridas, en algunos casos subdecurrentes, o sinuadas, anchas; borde liso a ligeramente ondulado o fimbriado; con lamélulas atenuadas, color crema (4A3), blanco grisáceo (30B1), amarillo pálido (4A3) o blanco amarillento (2A2), en algunos casos con manchas de color champán (4B4). Esporada blanquecina-crema (4A3).
Estípite: 30-100 mm × 5-20 mm, en algunos casos alcanza los 270 mm de longitud; generalmente central a excéntrico; recto, sinuoso, en algunos casos atenuado a la base; superficie fibrilosa, consistencia carnosa-fibrosa, contexto sólido. Color blanco (A1), crema (4A3), blanco grisáceo (30B1), amarillo pálido(4A3) o blanco amarillento (2A2) igual que las láminas, con algunas manchas de color champán (4B4) o café claro (5D3, 5E4, 5D1), las cuales pueden acentuarse a café oscuro (6F8) con la manipulación; en algunos ejemplares se observa tomento basal o cordones miceliares.
Figura 2. Variación morfológica en los esporomas silvestres de Lyophyllum herrerae. a, HC-PNNT-078; b, HC-PNNT-246; c, AGYLyo-5.3; d, GO-2009-278; e, Lorant-Flores A. 66; f, CIRB-H02 (holotipo); g, CIRB H01; h, CIRB H03; i, CIRB H06; j, Lorant-Flores A. 47; k, CIRB H05; l, Jaime-Salinas 24; m, Jaime-Salinas 36. Barras de escala: 20 mm.
Basidios: (22.3) 26.6-30.5-33.3 (36.7) × (4.6) 5.3-6.8-9.0 (9.3) μm, claviformes, de 3-4 esterigmas, con fíbulas basales, hialinos y con granulación siderófila (fig. 3a-c).
Basidiosporas: (3.7) 4.3-4.8-6.0 (7.0) ± 0.58 × 2.3-3.4-4.3 (5.7) ± 0.51 μm, Q = 1.2-1.4-1.6 ± 0.19, de elipsoides a ampliamente elipsoides a elongadas; hialinas, con pared delgada y lisa, uni o bigutuladas, cianófilas e inamiloides (fig. 3d-f).
En algunos casos se observan células marginales de 22.9-41.0 × 3.0-5.2 μm, filiforme-fusiformes a cilindro-flexuosas, hialinas, inconspicuas (fig. 4a-e). Subhimenio ramificado. Trama himenóforal regular. Pileipellis compuesta por hifas paralelas o ligeramente entrelazadas, de (2.0-) 5.1 (-6.8) μm de diámetro, con pigmentación intraparietal de color marrón grisáceo (6E3) con tonalidades café (5F4), la pared de las hifas es gruesa (1 μm), presentan abundantes fíbulas, con algunas hifas tromboplerosas (hifas oleíferas). Estipitipellis, cutis con hifas alargadas y con presencia de fíbulas. Fíbulas presentes en la mayoría de las hifas (fig. 4f).
Figura 3. Himenio de Lyophyllumherrerae. a-c, Basidios con 3 y 4 esporas; d-f, esporas de Lyophyllum herrerae. Tinción con rojo Congo a 1,000x. Barras de escala: 10 μm. Figura 4. Otras estructuras microscópicas de Lyophyllumherrerae. a-e, Células marginales de tipo filiforme-fusiforme y cilindro-flexuoso (cada flecha muestra células marginales); f, fíbulas del subhimenio. Tinción con rojo Congo a 1,000 x. Barras de escala: 10 μm.
Resumen taxonómico
Holotipo: México, Estado de México, Isidro Fabela, Las Palomas, julio 25, 2019, MEXU 30365, GenBank OR116956. Figura 2f.
Especímenes examinados: México, Estado de México: Zinacantepec, Agua Blanca, julio 23, 2008, recolectados en APFFNT (Área de Protección de Flora y Fauna Nevado de Toluca), Sergio Franco Maass, HC-PNNT-078 (MEXU 26594) (fig. 2a), julio 01, 2015, Yolanda Arana Gabriel, AGYLyo-5.3 (MEXU 28149) (fig. 2c); raíces, agosto 29, 2008, José Enrique Figueroa Morales, HC-PNNT-246 (MEXU 26689) (fig. 2b). México, Estado de México: Amecameca, mercado de Amecameca, junio 6, 2009, recolecta, Roberto Garibay Orijel, GO-2009-278 (MEXU 26748) (fig. 2d). Ciudad de México: Milpa Alta, julio, Santa Ana Tlacotenco, julio 12, 2017, recolecta, Angélica Lorant Flores Lorant-Flores A. 47 (MEXU 30216) (fig. 2j), Lorant-Flores A. 66 (MEXU 30217) (fig. 2e), Lorant-Flores A.49 (MEXU 30357), Lorant-Flores A. 52 (MEXU 30358), Lorant-Flores A. 42 (MEXU 30359). México, Estado de México: Coatepec Harinas, paraje de las placas, julio 7, 2019, compra en el seminario, Toluca, CIRB-H01 (fig. 2g); Zinacantepec, Llano Redondo, julio 27, 2019, compra en el seminario, Toluca, CIRB-H05 (MEXU 30368) (fig. 2k); Capulhuac, julio 25, 2019, compra en Otzolotepec, CIRB-H06 (fig. 2i); Otzolotepec, julio 25, 2019, compra en Otzolotepec, CIRB-H03 (fig. 2h); Isidro Fabela, Las Palomas, julio 25, 2019, compra en Temoaya, CIRB-H02 (holotipo MEXU 30365) (fig. 2f). México, Tlaxcala: mercado de Huamantla, Tlaxcala, mayo 27, 2005, recolectados en el PNLM (Parque Nacional La Malinche), Cándida Rodríguez, A. Montoya3005 (TLXM 7001) (fig. 5); 1 km al NO de San Mateo Huexoyucan, julio 18, 2015, A. Montoya, 3022 (TLXM 7002); Tlaxco, El Peñón, sin fecha, Maricarmen Jaime Salinas, Jaime-Salinas 24 (TLXM 7003) (fig. 2l); Parque Nacional La Malinche, 4-7 km al O de Javier Mina, julio 5, 2018, Maricarmen Jaime, Salinas Jaime-Salinas 36 (TLXM 7004) (fig. 2m). Ejemplares cultivados de la cepa IE 983 del ejemplar MEXU 28149, CIRB-H07-cultivo (MEXU 30360) (fig. 6).
Etimología: en honor al Dr. Teófilo Herrera, pionero de la Micología en México quien falleció en el año 2020.
Hábito de crecimiento: pueden presentar crecimiento epigeo o subhipogeo con crecimiento cespitoso, connado, a veces solitario.
Interacción ecológica y distribución: es una especie saprótrofa, crece predominantemente en bosques de Pinus spp. (entre las acículas o en la base del zacatonal), aunque también puede encontrarse en bosques de Abies religiosa y ocasionalmente en bosque de Quercus spp.
Nombres comunes: clavitos, clavo, clavo de oyamel, xolete regadito, xolete de encino, hongo blanco de monte, xolete blanco, hongo de mata, güeritos, negritos, hongo blanco, ahuaxulet, ocoxulet, cuaresmeño.
Cepa: el micelio crece en medio EMA-PL (agar extracto de malta adicionado con peptona y levadura) a 18 ºC, es de color blanco, forma circular, margen fimbriado.
Cultivos: depositados en el INECOL, Xalapa, México, IE 983 aislado de MEXU 28149 (fig. 2c).
Extype culture: IE 983
Observaciones: el tamaño y la forma de las esporas de L. herrerae no es homogéneo entre los ejemplares analizados. Las pruebas de normalidad de Shapiro-Wilk y Lilliefors indican que los datos de largo y ancho de las esporas presentan una distribución no normal (p < 0.05) y el valor de Q una distribución normal (p > 0.05). De acuerdo con la homocedasticidad de las varianzas basadas en la prueba de Levene se presenta homogeneidad en el largo (F15, 304 = 1.6644, p > 0.05) y ancho (F15, 304 = 0.9572, p > 0.05) de las esporas y heterogeneidad para el valor de Q (F15, 304 = 2.9504, p < 0.05). Para el ancho (χ2 = 79.094, gl = 14, p < 0.05) y largo (χ2 = 91.417, gl = 14, p < 0.05) de las esporas la prueba de Kruskal-Wallis y Welch de ANOVA para valor de Q (F14 = 7.8179, p < 0.05) arrojaron que hay diferencias significativas entre los ejemplares analizados (fig. 7).
La similitud nucleotídica intraespecífica en el ITS entre los ejemplares de L. herrerae va de 99 a 100%. Mientras que la similitud interespecífica con L. shimeji es alrededor de 2% y con L. fumosum, L. conglobatum y L. tenebrosum, es de 3%.
Clave taxonómica para las especies reportadas dentro de Lyophyllum sección Difformia
1a Cociente de las esporas Q > 1.2 ……………………………………………………………………………………………………………………………… 2
1b Cociente de las esporas Q < 1.2 ……………………………………………………………………………………………………………………………… 3
2a Esporas de 5-6 × 4-5 μm, globosas a ampliamente elipsoides, Q = 1-1.4, lisas; basidios con 4 esporas. Laminas separadas, ventricosas, adheridas; estípite cilíndrico a clavado, en ocasiones retorcido, hueco con superficie pruinosa, y habito solitario ……………………………………………………………………………………………………………………………… L. mariae
2b Esporas de 4.3-6.0 × 3.0-4.5 μm, elipsoides, ampliamente elipsoides a elongadas, Q = 1.23-1.49, lisas; basidios con 3 a 4 esporas. Píleo con fibrillas, láminas de subdecurrentes a adheridas; estípite sinuoso con superficie fibrilosa, saprótrofo, y habito cespitoso o connado ……………………………………………………………………………………………………………………………… L. herrerae
3a Pleurocistidios presentes y dispersos de 2.63-47.57 × 5.23-11.19 μm, fusoide-ventricosos. Esporas de 3.7-5.0 μm, globosas a subglobosas, Q = 1.0-1.1, lisas; basidios con 4 esporas, raramente 2, y hábito gregario ……………………………………………………………………………………………………………………………… L. subdecastes
4a Píleo viscoso, higrófano, cartilaginoso. Láminas emarginadas, algunas veces cambian de color a marrón cuando se maltratan. Estípite cilíndrico o ensanchado de la base, algunas veces ligeramente radicante. Esporas de 5-7 × 4.5-6 μm, globosas a subglobosas, Q = 1-1.1, lisas, saprótrofo, y hábito fasciculado ……………………………………………………………………………………………………………………………… L. loricatum
4b Píleo deprimido o umbonado ……………………………………………………………………………………………………………………………… 5
5a Píleo deprimido o umbonado y fibriloso. Láminas emarginadas, estípite cilíndrico a clavado, a menudo excéntrico, fibriloso, pruinoso. Esporas de 5-6 × 4.5-5.5 μm, globosas a globosas-elipsoides, Q = 1-1.2, lisas, forma micorrizas con Pinus, saprótrofo, y habito fasciculado ……………………………………………………………………………………………………………………………… L. decastes
5b Píleo de color café a café obscuro ……………………………………………………………………………………………………………………………… 6
6a Píleo de color gris, gris oscuro o marrón grisáceo hemisférico a convexo o plano con margen incurvado, superficie lisa. Láminas con una ligera depresión o ligeramente decurrentes, estípite ventricoso a cilíndrico y esporas globosas; forma micorrizas con Pinus y Quercus, yhabito fasciculado ……………………………………………………………………………………………………………………………… L. shimeji
6b Píleo de color café, café oscuro o café grisáceo, con fibrillas, margen tomentoso incurvado y enrollado. Láminas adheridas a decurrentes. Estípite cilíndrico con la base ensanchada, en ocasiones excéntrico, ligeramente tomentoso-pruinoso; forma micorrizas con Pinus y hábito connado ……………………………………………………………………………………………………………………………… L. fumosum
Figura 5. Lyophyllum herrerae en el mercado de Huamantla, Tlaxcala, recolectado en el Parque Nacional La Malinche.
Conocimiento tradicional
Lyophyllum es uno de los géneros más utilizados con fines comestibles y/o alimenticios en el centro de México, sus especies son recolectadas para venta y autoconsumo (Garibay-Orijel y Ruan-Soto, 2014); cada especie utilizada recibe más de un nombre común. Diferentes investigaciones reportan el uso comestible de L. decastes, L. fumosum, L. loricatum, L. sp. y Lyophyllum aff. shimeji. Los clavitos, macoyitas, hongo de mata, montones o xolete, nombres con los que comúnmente se les conocen, se encuentran dentro de las 10 especies con mayor importancia etnomicológica y económica en México (Burrola-Aguilar et al., 2012; Estrada-Martínez et al., 2009; Montoya et al., 2004; Ramírez-Carbajal, 2017; Servín-Campuzano y Alarcón-Cháires, 2018).
Bioensayos de fructificación
Los esporomas obtenidos en bioensayos de fructificación (MEXU 30360) (fig. 6) presentaron variaciones morfológicas y de crecimiento asociadas con las condiciones ambientales. En las primeras etapas de desarrollo los píleos presentan una forma convexa con margen incurvado y coloración café (30E5, 5A5), con el borde ondulado o entero; conforme maduran, el píleo se torna plano-convexo y de coloración más clara siendo amarillo claro (4A4) o naranja parduzco (5C3) con el centro del píleo de color café claro (5D3). En las primeras etapas de desarrollo tanto el píleo como el estípite presentan fibrillas de color café (5D3), las cuales suelen perderse conforme maduran; en algunos otros casos, prevalecen durante todo el tiempo. El estípite puede ser de 2 formas, central o excéntrico. Presentaron un crecimiento epigeo y subhipogeo con hábito cespitoso y solitario. Actualmente, se continúa trabajando con adecuaciones en el cultivo, para identificar las condiciones que se requieren para el desarrollo óptimo de la especie y producción de cuerpos fructíferos bajo condiciones controladas.
Comentarios taxonómicos
Lyophyllum herrerae se ubica dentro de L. sección Difformia, es un clado no descrito previamente y de gran importancia cultural que recibe los nombres genéricos de xolete o clavito en el centro de México. Su posición filogenética y la combinación de sus caracteres morfológicos y ecológicos permiten distinguirla como una nueva especie con potencial de fructificación en cultivo.
Plasticidad morfológica. Lyophyllum herrerae presenta variación en la coloración, tamaño, forma y ornamentación del esporoma, así como el tamaño y forma de las esporas. Esta variación se observa en los diferentes estados de maduración y asociado a las condiciones sometidas en los bioensayos de fructificación (fig. 6). Otras variables como la vegetación, origen geográfico y factores ambientales también influyen en su morfología como se ha reportado para otras especies de la sección Difformia (Bellanger et al., 2015; Hofstetter et al., 2002; Moncalvo et al., 2000). En estados juveniles la coloración del píleo es más oscura y conforme madura la coloración se vuelve más clara hasta tomar tonalidades crema o amarillo claro o amarillo grisáceo; la presencia de fibrillas de color café en el píleo y el estípite fibriloso son las características que más prevalecen en la mayoría de los ejemplares en particular en estado inmaduro; sin embargo, éstas pueden estar ausentes o perderse en ejemplares maduros. Al igual que las otras especies de la sección Difformia (Kalamees, 2004; Knudsen y Vesterholt, 2008), esta especie no presenta cambio de coloración en el contexto al maltrato, pero sí presenta algunas manchas cafés en las láminas y estípite, las cuales en ocasiones son más evidentes con la manipulación.
En la mayoría de los casos, las láminas son subadheridas, adheridas, en algunos casos subdecurrentes o sinuadas. Lyophyllum herrerae se distingue por presentar el estípite central o excéntrico, recto, sinuoso, uniforme o atenuado hacia la base. El hábito de crecimiento es otra de sus características distintivas. Lyophyllum herrerae presenta hábito cespitoso y connado e incluso pueden llegar a presentarse de manera solitaria, de aquí el nombre común de xolete regadito (tabla 1). Las variaciones morfológicas de L. herrerae son comunes en los taxones que integran la sección Difformia (Kalamees, 2004; Larsson y Sundberg, 2011; Yamanaka, 2009), lo cual genera confusión pues comparten caracteres morfológicos en alguna etapa de desarrollo. Esto se atribuye a que las especies de la sección Difformia son polimórficas debido a la plasticidad fenotípica intraespecífica y homoplasia (Hofstetter et al., 2002; Moncalvo et al., 1990), hábitat en el que se desarrollan y origen geográfico (Bellanger et al., 2015; Larsson y Sundberg, 2011).
En relación con las características microscópicas, las especies de esta sección presentan esporas de pared lisa, con forma globosa, subglobosa a ampliamente elipsoide (Q = 1-1.2). En contraste, Lyophyllum herrerae presenta esporas con una forma distinta; el largo y ancho de las esporas es más grande y variable entre ejemplares y son ampliamente elipsoides a elongadas (fig. 7a, b). Para la descripción de la especie se utilizaron las medidas del holotipo y los extremos son los valores mínimos y máximos del resto de los ejemplares. Como se muestra en la figura 7a, el ejemplar CIRB-H01 tiene esporas considerablemente menos largas y los ejemplares CIRB-H07-cultivo y Lorant-Flores A 47 tienen esporas significativamente más largas que el holotipo. En cuanto al ancho de las esporas, el ejemplar CIRB-H04 tiene esporas significativamente menos anchas que el resto de los ejemplares y los ejemplares CIRB-H07-cultivo y HC-PNNT-078 tienen esporas significativamente más anchas que el holotipo (fig. 7b). En cuanto a la forma de las esporas, hay 3 rangos (fig. 7c); en el primero se encuentran los ejemplares CIRB-H01 y HC-PNNT-246 con esporas ampliamente elipsoides (Q = 1.2), el segundo, que es mayoritario e incluye al holotipo y a los ejemplares cultivados CIRB-H07-cultivo (tanto esporas de esporada como de cuerpos fructíferos) tiene esporas elipsoides (Q = 1.3-1.5) y el tercer rango (ejemplar CIRB-H04) tiene esporas elongadas (Q = 1.6) (fig. 7c). En los mapas de calor se muestran todas las comparaciones significativas entre los ejemplares para el largo (material suplementario 2a), ancho (material suplementario 2b) y valor de Q (material suplementario 2c), lo que refuerza aún más la variación en el tamaño y la forma de las esporas.
Figura 6. Variación morfológica en los esporomas cultivados de Lyophyllum herrerae Cultivo de la cepa IE 983 obtenida del esporoma MEXU 28140.
Los basidios e hifas de la pileipellis se encuentran dentro del rango de tamaño y forma de las especies de la sección (2-15 μm). Los basidios al igual que los del resto de la sección presentan de 3-4 esporas (fig. 3a-c) (Kalamees, 2004; Knudsen y Vesterholt, 2008; Li et al., 2019; Sundberg, 2010). Sin embargo, L. herrerae en contraste con las otras especies de la sección (Kalamees, 2004; Knudsen y Vesterholt, 2008; Li et al., 2019; Sundberg, 2010), sí presenta células marginales y son de tipo filiforme-fusiforme a cilindro-flexuoso (fig. 4a-e). Las células marginales pueden estar ausentes o si se presentan suelen ser inconspicuas, por lo que se recomienda poner atención en la caracterización microscópica. Sin embargo, éstas no son exclusivas de L. herrerae, ya que en otras especies del género han sido reportados como en L. turcicium, L. atrofuscum, L. subdecastes, L. fuscobrunneum, L. impudicum, L. rosa-mariae (Dähncke at al., 2011; Kalamees, 2004; Sesli et al., 2015; Vizzini y Contu, 2010; Wei et al., 2023).
Interacción ecológica de Lyophyllum herrerae. En cuanto a su nutrición, L. decastes ha sido reportada como saprótrofa y formando ectomicorrizas; L. loricatum como saprótrofa, L. fumosum y L. shimeji como ectomicorrizógenas. Para L. subdecastes y L. mariae no se reporta interacción; su distribución es en bosque subalpino donde predomina Picea crassifolia (Wei et al., 2023) y en bosque de Pinus halepensis x brutia, Quercus ilex y Quercus virgiliana (Lavorato y Contu, 2015), respectivamente. Nosotros consideramos a L. herrerae como saprótrofa debido a que puede completar su ciclo de vida en cultivo y no se ha reportado que realice asociación simbiótica con alguna especie arbórea. El crecimiento del micelio en cultivo in vitro ha sido en medios de cultivo generalistas como EMA y PDA (Arana-Gabriel et al., 2018) y para la obtención de cuerpos fructíferos en cultivo experimental, tampoco se ha requerido de establecer una micorrización.
Lyophyllum herrerae tiene un intervalo amplio de distribución y habita en los bosques templados del centro de México, se ha recolectado en bosques de Abies religiosa, Pinus spp. y Quercus spp. Se reporta su presencia en primavera, ya que son los primeros en fructificar en la temporada de lluvia (Burrola-Aguilar et al., 2012; Caamal-Caamal et al., 2016; Domínguez et al., 2015; Estrada-Martínez et al., 2009, Franco-Maass et al., 2012; Lara-Vázquez et al., 2013; Montoya et al., 2004; Ramírez-Carbajal, 2017; Servín-Campuzano y Alarcón-Cháires, 2018). En general, las especies de la sección Difformia se desarrollan en bosques de Pinus y Quercus; la similitud en el entorno en el que crecen podría ser una de las principales causas para que ocurra una evolución paralela a pesar de que se encuentran en diferentes puntos geográficos generando así la plasticidad morfológica que tanto dificulta la correcta determinación de las especies.
Figura 7. Diagrama de caja y bigotes del largo (a), ancho (b) y Q (c) de las esporas de los ejemplares de Lyophyllum herrerae. El diagrama de caja muestra la mediana (“línea en negrita”), el primer y tercer cuartiles (“bisagras”) y los valores atípicos (puntos negros). El asterisco (*) corresponde al holotipo.
La distribución geográfica e interacción ecológica puede resultar un carácter importante para discriminar entre especies de la sección Difformia (Larson y Sundberg, 2011). Wei et al. (2023) mencionan que existen caracteres morfológicos que son diferentes entre ejemplares dependiendo de la zona donde se encuentran, la altitud y la vegetación. En especies como L. subdecastes, la distribución es en áreas de gran altitud en el noroeste de China, generalmente a una elevación de 3,000 m. Su distribución subalpina en Asia ayudaría a distinguirla de especies morfológicamente parecidas de Europa y EUA (Wei et al., 2023). La condición saprótrofa de Lyophyllum herrerae que permite obtener cuerpos fructíferos en condiciones controladas sin necesidad de establecer una micorrización, podría ser considerado un carácter que la distinga de especies como L. shimeji.
Importancia cultural de los clavitos (Lyophyllum spp.) en México. Debido a la plasticidad morfológica de las especies de la sección Difformia existe imprecisión en la determinación de las especies en trabajos taxonómicos o etnomicológicos.Los ejemplares de L. herrerae habían sido anteriormente identificados como L. decastes, L. aff. shimeji y Lyophyllum sp. Por lo tanto, es importante corroborar la identidad de las especies estudiadas debido a la importancia cultural, económica y biotecnológica del género Lyophyllum en México.
Lyophyllum es uno de los géneros más utilizados con fines alimenticios en el centro de México, sus especies son recolectadas para venta y autoconsumo (fig. 5), y a una sola especie se le puede asignar incluso más de un nombre común. Para la región de la Sierra Nevada L. decastes s.l.es una de las especies más consumidas por los pobladores, principalmente por su sabor (Estrada-Martínez et al., 2009; Montoya et al., 2004; Ramírez-Carbajal, 2017), se encuentra dentro de las 10 especies con mayor importancia etnomicológica y económica. Incluso los habitantes de la comunidad p’urhépecha de Comachuén, Nahuatzen, Michoacán, consideran que los hongos dan identidad y espiritualidad a las personas. Ellos mencionan que es un honor que compartan atapakua (platillo regional) de terékua pachakua / pa- chakua / Lyophyllum aff. decastes en la fiesta de Corpus (Servín-Campuzano y Alarcón-Cháires, 2018). Lyophyllum spp. alcanza precios en el mercado de hasta $200 pesos por kilo y un mínimo de $100 pesos dependiendo de su disponibilidad (Ramírez-Carbajal, 2017). En algunas zonas como en Amanalco en el Estado de México, los clavitos se conservan en almíbar para consumirlos en otra temporada (Burrola-Aguilar et al., 2012), este es uno de los pocos reportes de este tipo de prácticas con Lyophyllum. Estos hongos también son deshidratados para la elaboración de collares o rosarios por su peso y dimensiones (Moreno-Fuentes, 2013). Los diferentes nombres comunes que se les asigna a las especies de la sección Difformia están relacionados a la vegetación en la que se desarrollan como clavito de encino o cholete de encinar y clavo de oyamel; en cuanto al hábito de crecimiento y forma, se les nombran macoyitas, clavitos, nchjo chixtyu (clavito de acotalera o mata), pata gorda, lengua de vaca, hongo rugoso y para el caso de L. herrerae, xolete regadito, haciendo referencia a su hábito solitario u hongo de mata a su hábito cespitoso y connado.
De acuerdo con la temporada en la que aparecen, en la región de los Tlahuicas, en el Estado de México, L. decastes s.l. es nombrado cómo nchjo nda que se traduce al español como clavito vidrioso. Su nombre también se relaciona con el agua debido a que se desarrollan en temporada de lluvia o de acuerdo con otros caracteres morfológicos como el color, negritos, hongo blanco de monte, xolete blanco, güeritos (para L. herrerae, debido a que llega a presentar coloraciones más claras). Algunos otros nombres con los que se les conocen son: cuaresmeño, auexolete, montones, kanghamundo, tablero, chompuetawi o chonjeki (matlatzinca) y uachitas (Burrola-Aguilar et al., 2012; Caamal-Caamal et al., 2016; Domínguez et al., 2015; Estrada-Martínez et al., 2009; Lara-Vázquez, et al., 2013; Molina-Castillo et al., 2019; Montoya et al., 2004; Ramírez-Carbajal, 2017; Salinas-Rodríguez et al., 2017; Servín-Campuzano y Alarcón-Cháires, 2018).
Potencial económico de Lyophyllum herrerae. Debido a su importancia cultural y a su forma de nutrición, Lyophyllum es un género con potencial para cultivo comercial y, en particular, las especies que se localizan dentro de la sección Difformia, que además tienen propiedades funcionales y medicinales (Pokhrel et al., 2006). Lyophyllum shimeji se cultiva a nivel industrial pese a ser reportada como una especie micorrízica facultativa, por lo que las demás especies al ser saprótrofas o facultativas son altamente susceptibles para cultivarse (Sánchez y Mata, 2012). Este es el caso de L. herrerae que desarrolla cuerpos fructíferos bajo condiciones controladas a partir de cepas nativas de la región de alta montaña del Estado de México (fig. 6).
La domesticación de cepas nativas es una buena alternativa para el manejo regional de germoplasma adaptado a las condiciones climáticas y del sustrato donde se desarrolla de forma natural, eliminando la dependencia de cepas de otros países. El cultivo de Lyophyllumherrerae puede ser fomentado en las comunidades rurales en donde tiene importancia cultural y crece en los bosques aledaños. Esto como una estrategia para minimizar el impacto en las poblaciones naturales y para generar un beneficio, alimentario y económico para las familias. Sin embargo, aún es preciso realizar más investigaciones enfocadas en la caracterización de las propiedades nutricionales y medicinales, así como un proceso de domesticación para identificar las características deseables para el sector.
Agradecimientos
La caracterización molecular y análisis filogenéticos fueron apoyados financieramente a RGO por el proyecto PAPIIT-UNAM IN212521. El trabajo etnomicológico y la recolecta de ejemplares en el Estado de México formaron parte del proyecto “Valoración ecológica y etnomicológica de hongos comestibles silvestres de alta montaña en el Estado de México”, Ciencia de Frontera 2019 del Conacyt 140621 a cargo de CBA y YAG. Se agradece a Gala Viurcos por la elaboración de la versión final de la figura 1, al Dr. Armando Sunny por el apoyo en el análisis estadístico y a Myco Seta® por los cultivos de Lyophyllum herrerae.
Referencias
Altschul, S. F., Gish, W., Miller, W., Myers, E. W. y Lipman, D. J. (1990). Basic local alignment search tool. Journal of Molecular Biology, 215, 403–410. https://doi.org/10.1016/S0022-2836(05)80360-2
Arana-Gabriel, Y., Burrola-Aguilar, C., Garibay-Orijel, R., Matías-Ferrer, N., Franco-Maass, S. y Mata, G. (2018). Genetic characterization, evaluation of growth and pro- duction of biomass from wild edible mushrooms of Lyophyllum of Central Mexico. Brazilian Journal of Micro- biology, 49,632–640. https://doi.org/10.1016/j.bjm.2017.12.002
Babasaki, K., Neda, H. y Murata, H. (2007). MegB1, a novel macroevolutionary genomic marker of the fungal phylum Basidiomycota. Bioscience, Biotechnology, and Biochemistry, 71, 1927–1939. https://doi.org/10.1271/bbb.70144
Bellanger, J. M., Moreau, P. A, Corriol, G., Bidaud, A., Chalange, R., Dudova, Z. et al. (2015). Plunging hands into the mushroom jar: a phylogenetic framework for Lyophyllaceae (Agaricales, Basidiomycota). Genetica, 143, 169–194. https://dx.doi.org/10.1007/s10709-015-9823-8
Boa, E. (2005). Los hongos silvestres comestibles. Perspectiva global de su uso e importancia para la población. Roma: FAO.
Burrola-Aguilar, C., Montiel, O., Garibay-Orijel R. y Zizumbo-Villarreal, L. (2012). Conocimiento tradicional y aprovechamiento de los hongos comestibles silvestres en la región de Amanalco, Estado de México. Revista Mexicana de Micología, 35,1–16.
Caamal-Caamal, L. G., Montoya, A., Trejo-Hernández, L. y Castillo-Guevara, C. (2016). Estado del arte relativo al conocimiento tradicional de los hongos silvestres en el estado de Tlaxcala, México. Mexican Journal of Biotechnology, 1,1–14.
Cifuentes, B. J., Villegas, M. R. y Pérez, L. R. (1986). Hongos. En A. Lot y F. Chiang (Eds.), Manual de herbario: administración y manejo de colecciones, técnicas de recolección y preparación de ejemplares botánicos. México D.F.: Consejo Nacional de la Flora de México.
Dähncke, R. M., Contu, M. y Vizzini, A. (2011). Two new species of Lyophyllum s.l. (Basidiomycota, Agaricomycetes) from La Palma (Canary Islands, Spain). Mycotaxon, 115, 65–71.
Darriba, D., Taboada, G. L., Doallo, R. y Posada, D. (2012). jModelTest 2: more models, new heuristics and high-performance computing. Nature Methods, 9, 772. https://doi.org/10.1038/nmeth.2109
Delgado, F. A., Villegas, R. M. y Cifuentes, B. J. (2005). Glosario ilustrado de los caracteres macroscópicos en Basidiomycetes con himenio laminar. México D.F.: Las Prensas de Ciencias, Facultad de Ciencias, UNAM.
Domínguez, R. D., Arzaluz, R. J. I., Valdés, V. C. y Romero, P. N. P. (2015). Uso y manejo de hongos silvestres en cinco comunidades del municipio de Ocoyoacac, Estado de México. Tropical and Subtropical Agroecosystems, 18,133–143.
Dunn, O. J. (1964). Multiple comparisons using rank sums. Technometrics, 6, 241–252.
Edgar, R. C. (2004). MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research, 32,1792–1797.
Estrada-Martínez, E., Guzmán, G., Cibrián-Tovar, D. y Ortega-Paczka, R. (2009). Contribución al conocimiento etnomicológico de los hongos comestibles silvestres de mercados regionales y comunidades de la sierra nevada (México). Interciencia, 34,25–33.
Franco-Maass, S., Burrola-Aguilar, C. y Arana-Gabriel, Y. (2012). Hongos comestibles silvestres: un recurso forestal no maderable del Nevado de Toluca. México D.F.: EON.
Fox, J. y Weisberg, S. (2019). An R companion to applied regression. Tercera edición. Thousand Oaks, CA: SAGE Publishing.
Garnier, S., Ross, N., Rudis, R., Camargo, P. A., Sciaini y Scherer, C. (2024). viridis(Lite) – Colorblind-Friendly color maps for R., viridis package version 0.6.5 https://sjmgarnier.github.io/viridis/, https://doi.org/10.5281/zenodo.4679423
Garibay-Orijel, R. y Ruan-Soto, F. (2014). Listado de hongos silvestres consumidos como alimento tradicional en México. En A. Moreno-Fuentes y R. Garibay-Orijel (Eds.), La etnomicología en México. Estado del arte (pp. 91–109). México D.F: Conacyt/ UAEH/ UNAM.
Guindon, S., Dufayard, J. F., Lefort, V., Anisimova, M., Hordijk, W. y Gascuel, O. (2010). New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Systematic Biology, 59,307–321.
Hofstetter, V., Clémençon, H., Vilgalys, R. y Moncalvo, J. M. (2002) Phylogenetic analyses of the Lyophylleae (Agaricales, Basidiomycota) based on nuclear and mitochondrial rDNA sequences. Mycological Research, 106, 1043–1059. https://doi.org/10.1017/S095375620200641X
Kalamees, K. (2004). Palearctic Lyophyllaceae (Tricholomatales) in Northern and Eastern Europe and Asia. Scripta Mycologica Tartu, 18,1.135.
Knudsen, H. y Vesterholt, J. (2008). Funga Nordica: Agaricoid, Boletoid and Cyphelloid Genera, Volumen 1. Dinamarca: Nordsvamp Publishers.
Kornerup, A. y Wanscher, J. H. (1978). Methuen handbook of color. 3rd Ed. London: Eyre Methuen Ltd.
Largent, D. L., Johnson, D. y Watling, R. (1977). How to identify mushrooms to genus III: microscopic features. Eureka, CA: Mad River Press.
Lara-Vázquez, F., Romero-Contreras, A. T. y Burrola-Aguilar, C. (2013). Conocimiento tradicional sobre los hongos silvestres en la comunidad otomí de San Pedro Arriba; Temoaya, Estado de México. Agricultura, Sociedad y Desarrollo, 10,305–333.
Larsson, E. y Sundberg, H. (2011). Lyophyllum shimeji, a species associated with lichen pine forest in northern Fennoscandia. Mycoscience, 52, 289–295. http://dx.doi.org/10.1007/s10267-010-0104-1.1
Lavorato, C. y Contu, M. (2015). Lyophyllum mariae: a new species of section Difformia with showy colours from Calabria Italy. Micologia e Vegetazione Mediterranea, 30,97–102.
Li, Q., Wang, Q., Jin, X., Chen, Z., Xiong, C., Li, P. et al. (2019). Characterization and comparison of the mitochondrial genomes from two Lyophyllum fungal species and insights into phylogeny of Agaricomycetes. International Journal of Biological Macromolecules, 121,364–372. https://doi.org/10.1016/j.ijbiomac.2018.10.037
Maeta, K., Ochi, T., Tokimoto, K., Shimomura, N., Maekawa, N., Kawaguchi, N. et al. (2008). Rapid species identification of cooked poisonous mushrooms by using real-time PCR. Applied and Environmental Microbiology, 74, 3306–3309. https://doi.org/10.1128/AEM.02082-07
Molina-Castillo, S., Thomé-Ortiz, T. y Espinoza-Ortega, A. (2019). Conocimiento ecológico tradicional y aprovechamiento de los hongos comestibles silvestres en el centro de México. Agro Productividad, 12,3–8.https://doi.org/10.32854/agrop.v0i0.1394
Moncalvo, J. M., Toriola, D. y Clémençon, H. (1990). Analyse taxonomique du complexe Lyophyllum decastes sensu lato (Agaricales, Basidiomycetes) sur la base des caractéres culturaux. Mycologia Helvetica, 3,397–415.
Moncalvo, J. M., Lutzoni, F., Rehner, S. A., Johnson, J. y Vilgalys, R. (2000). Phylogenetic relationships of agaric fungi based on nuclear large subunit ribosomal DNA sequences. Systematic Biology, 49,278–305. https://doi.org/10.1093/sysbio/49.2.278
Montoya, A., Kong, A., Estrada-Torres, A., Cifuentes, J. y Caballero, J. (2004). Useful wild fungi of La Malinche Nacional Park, Mexico. Fungal Diversity, 17, 115–143.
Moreno-Fuentes, A. (2013). Un recurso alimentario de los grupos originarios y mestizos de México: los hongos silvestres. Anales de Antropología, 48,241–272. https://doi.org/10.1016/S0185-1225(14)70496-5
Ogle, D. H., Doll, J. C., Wheeler, A. P. y Dinno, A. (2023). FSA: Simple fisheries stock assessment methods. R package version 0.9.5. https://CRAN.Rproject.org/package=FSA
Osmundson, T. W., Robert, V. A., Schoch, C. L., Baker, L. J., Smith, A., Robich, G. et al. (2013). Filling gaps in biodiversity knowledge for macrofungi: contributions and assessment of an herbarium collection DNA barcode sequencing project. Plos One, 8, e62419. https://doi.org/10.1371/journal.pone.0062419
Pera, J. y Álvarez, I. F. (1995). Ectomycorrhizal fungi of Pinus pinaster. Mycorrhiza, 5,193–200. https://doi.org/10.1007/BF00203337
Pokhrel, C., Sumikawa, S., Iida, S. y Ohga, S. (2006). Growth and productivity of Lyophyllum decastes on compost enriched with various supplements. Micología Aplicada International, 18,21–28.
Rambaut, A., Drummond, A. J., Xie, D., Baele, G. y Suchard, M. A. (2018). Posterior summarization in Bayesian phylogenetics using Tracer 1.7. Systematic Biology, 67, 901–904. https://doi.org/10.1093/sysbio/syy032
Ramírez-Carbajal, E. (2017). Etnomicología en la zona Tlahuica-Pjiekakjoo del Estado de México (Tesis). Universidad Intercultural del Estado de México, México.
R Core Team (2024). R: a language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria.
Ronquist, F. y Huelsenbeck J. P. (2003). MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19,1572–1574. https://doi.org/10.1093/bioinformatics/btg180
Salinas-Rodríguez, M., Gómez-Reyes, V. y Blanco-García, A. (2017). Conocimiento tradicional de los hongos silvestres comestibles y venenosos de dos localidades del municipio de Pátzcuaro, Michoacán. Biológicas, 19,28–34.
Sambrook, J., Fritsch, E. y Maniatis, T. (1989). Molecular cloning: alaboratory manual. 2a Ed. Long Cold Island, Nueva York: Cold Spring Harbor Laboratory Press.
Sánchez, J. E. y Mata, G. (2012). Cultivo y aprovechamiento de macromicetos. Una tendencia global en crecimiento. En J. E. Sánchez y G. Mata (Eds.), Hongos comestibles y medicinales en Iberoamérica: investigación y desarrollo en un entorno multicultural. Xalapa: ECOSUR/ INECOL.
Sánchez-Ledesma, J. A., Guevara-Guerrero, G., Garibay-Orijel, R., Ángeles-Argáiz, R., Ávila-Rodríguez, V., Arreola-Ávila, J. G. et al. (2022). Tuber caryophilum, a new truffle species growing in Carya illinoinensis orchards. Revista Mexicana de Biodiversidad, 93, e934893. https://doi.org/10.22201/ib.20078706e.2022.93.4893
Servín-Campuzano, L. S. y Alarcón-Cháires, P. E. (2018). Conocimiento tradicional de los hongos silvestres comestibles en la comunidad p’urhépecha de Comachuén, Nahuatzen, Michoacán. Acta Universitaria, 28,15–29. https://doi.org/10.15174/au.2018.1277
Sesli, E., Vizzini, A. y Contu, M. (2015). Lyophyllum turcicum (Agaricomycetes: Lyophyllaceae), a new species from Turkey. Turkish Journal of Botany, 39,512–519. https://doi.org/10.3906/bot-1407-16
Sundberg, H. (2010). Phylogeny of Lyophyllum Section Difformia: Does Hon-shimeji (L. shimeji) occur in Sweden? Department of Plant and Environmental Sciences, Faculty of Science, Universidad de Gothenburg, Suecia.
Ukawa, Y., Ito, H. y Hisamatsu, M. (2000). Antitumor effects of (1–>3)-beta-D-glucan and (1–>6)-beta-D-glucan purified from newly cultivated mushroom, Hatakeshimeji (Lyophyllum decastes Sing.). Journal of Bioscience and Bioengineering, 90,98–104. https://doi.org/10.1016/S13891723(00)80041-9
Visnovsky, S. B., Cummings, N., Guerin-Laguette, A., Wang, Y., Yamada, A., Kobayashi, H. et al. (2014). Detection of the edible ectomycorrhizal fungus Lyophyllum shimeji colonising seedlings of cultivated conifer species in New Zealand. Mycorrhiza, 24, 453–463. https://doi.org/10.1007/s00572-013-0552-5
Vizzini, A. y Contu, M. (2010). Lyophyllum rosae-mariae sp. nov. (Basidiomycota, Agaricomycetes) from la Palma (Canary Islands, Spain). Mycosphere, 1,83–86.
Wang, X. Q., Zhou D. Q. y Zhang, X. L. (2013). Taxonomic study on the genus Lyophyllum in sustainable environment engineering. Applied Mechanics and Materials, 340,975–978. https://doi.org/10.4028/www.scientific.net/AMM.340.975
Wang, Y. y Chen, Y. L. (2015). Recent advances in cultivation of edible mycorrhizal mushrooms. En Z. M. Solaiman (Ed.), Mycorrhizal Fungi: use in sustainable agriculture and land restoration. Soil Biology, 41, 375–397. https://doi.org/10.1007/978-3-662-45370-4_23
Wei, S. W., Lu, B. Y., Wang, Y., Dou, W. J., Wang, Q. y Li, Y. (2023). Morphology and phylogeny of Lyophylloid mushrooms in China with description of four new species, Journal of Fungi, 9,77. https://doi.org/10.3390/jof9010077
Wickham, H. (2016). ggplot2: Elegant graphics for data analysis. New York: Springer-Verlag.
Wickham, H., Hester, J. y Bryan, J. (2022). readr: Read rectangular text data. https://readr.tidyverse.org, https://github.com/tidyverse/readr
Wickham, H., François, R., Henry, L., Müller, K. y Vaughan, D. (2023). dplyr: a grammar of data manipulation. R package version 1.1.4. https://github.com/tidyverse/dplyr; https://dplyr.tidyverse.org
Yamada, A., Ogura, T. y Ohmasa, M. (2001). Cultivation of mushrooms of edible ectomicorrhizal fungi associated with Pinus densiflora by in vitro mycorrhizal synthesis. Mycorrhiza, 11,59–66. https://doi.org/10.1007/s005720000093
Yamanaka, K. (2009). Commercial cultivation of Lyophyllum shimeji. En J. I. Lelley y J. A. Buswell (Eds.), Mushroom biology and mushroom products. Proceedings of the 6th International Conference on Mushroom Biology and Mushroom Products. Bonn, Alemania.
In her 1945 study on the Tertiary fossil mollusks of northeastern Mexico, Gardner listed only 2 taxa of land snails: Holospira eva Gardner, 1945 and “Helix” sp. The latter is recognized here as a new species of Lysinoe Adams & Adams, 1855 (Helicoidea, Xanthonychidae). The new species can be diagnosed from its congeners by its flattened shell profile, a lower body whorl with a faint angulation on its median portion, a ridge-like angulation around the umbilicus, and a likely wide umbilicus. The species is known to occur in 2 nearby Upper Middle Oligocene outcrops in the eastern part of the state of Nuevo León.
Keywords: Mollusca; Land snail; Fossil; Nuevo León; Stylommatophora; Xanthonychidae
Una especie nueva de Lysinoe (Gastropoda: Helicoidea) del Oligoceno de México
Resumen
En su estudio de 1945 sobre los moluscos fósiles del Terciario del noreste de México, Gardner enumeró solo 2 taxones de caracoles terrestres: Holospira eva Gardner, 1945 y “Helix” sp. Esta última se reconoce aquí como una especie nueva de Lysinoe Adams et Adams, 1855 (Helicoidea, Xanthonychidae). La nueva especie se puede diagnosticar a partir de sus congéneres por el perfil aplanado de su concha, la vuelta del cuerpo es más baja y con una leve angulación en su porción media, una angulación en forma de cresta alrededor del ombligo y un ombligo probablemente ancho. La especie se encuentra en 2 afloramientos cercanos del Oligoceno Medio Superior en la parte oriental del estado de Nuevo León.
Palabras clave: Mollusca; Caracol terrestre; Fósil; Nuevo León; Stylommatophora; Xanthonychidae
Introduction
In 1945, Julia Gardner published an important paper describing the Tertiary fossil molluscan fauna of northeastern Mexico (Gardner, 1945), with information and specimens collected by the United States Geological Survey (USGS). Virtually all fossils were marine or freshwater, with 2 exceptions: the land snail taxa Holospira eva Gardner, 1945 (Urocoptidae) and “Helix” sp.
Gardner (1945) assigned the fossils the broad identity of “Helix” sp. to signify they were helicoid snails (superfamily Helicoidea). Still, she alluded to the possibility that those fossils were closely related to the Mexican and Central American genus Lysinoe Adams & Adams, 1855 (Helicoidea, Helminthoglyptidae). Later, Roth (1984) described a new species, Lysinoe breedlovei Roth, 1984, from the Vieja Group (Upper Eocene; Texas, USA) and included Gardner’s “Helix” sp. in that species. It is uncertain why Roth (1984) did that, as the morphological differences between his new species and Gardner’s “Helix” sp. are quite striking. Furthermore, the discrepancy in age between the 2, alongside the large geographical distance, would also have been good indicators that they were 2 separate species.
Herein, Gardner’s “Helix” sp. is recognized as a distinct species belonging to the genus Lysinoe and described as new.
Materials and methods
The single specimen representative of the new species is housed in the Paleobiology Collection of the National Museum of Natural History (NMNH, Smithsonian Institution, Washington D.C., USA) under the registration number USNM MO 497132. A historical background and further details regarding the USGS collection efforts in Mexico can be found in Gardner (1945).
Description
Family Xanthonychidae Strebel & Pfeffer, 1880
Genus Lysinoe Adams & Adams, 1855 (type species Helix ghiesbreghti Nyst, 1841)
Shell large (height 23.0 mm, width 41.3 mm), helicoid, of ca. 4 whorls, with a low spire. Whorls growing regularly in size, but final ½ whorl suddenly expands towards aperture. Body whorl slightly flattened, with faint angulation on its median portion and light ridge-like angulation around the umbilicus. Aperture seemingly rounded, prosocline. Umbilicus seemingly deep and relatively wide. The fossil is an internal mold, so not all shell structures can be observed; features such as the umbilicus’ width might be misleading.
Even though Gardner (1945: 18, 267) alludes to further material, no specimens beyond the holotype (Gardner’s figured specimens) were available for study at the NMNH. According to that author’s remarks, a few additional morphological features could be gleaned from the specimens then available (Gardner, 1945: 267): the number of whorls could grow a little beyond 4; shell moderately heavy (observed in fragments of shell adhered to some of the molds); the body whorl angulation in juvenile shells was more pronounced than in the adults.
Taxonomic summary
Type locality: Mexico, Nuevo León, General Bravo, USGS station 13517: “[a]t and just west of Rancho Paulino Ríos” (Gardner, 1945: 23, quadrant N-15 on map).
Type material: USNM MO 497132 (holotype).
Etymology: the specific epithet refers to the type locality.
Type stratum: base of Upper Middle Oligocene sandstone, described as a “hard conglomeratic, shaly, locally silicious sandstone” (Gardner, 1945: 18).
Age: Middle Oligocene.
Distribution: also known from nearby USGS station 14023: Nuevo León, General Bravo, Zacate, “[o]n a high hill 3,750 meters S. 68° W. from Zacate well No. 1” (Gardner, 1945: 32, quadrant N-13 on map).
Diagnosis: Shell large, helicoid with a flattened profile. Body whorl low, with faint median angulation. Ridge-like angulation around umbilicus. Umbilicus likely wide.
Previous mentions in the literature: “Helix” sp.: Gardner, 1945: 267, pl. 18, figs. 1-3. Helix s. l. near Lysinoe sp.: Gardner, 1945: 18. Lysinoe breedlovei [in part]: Roth, 1984: 203.
Remarks
Roth (1984, 1988) included Lysinoe and related forms in Helminthoglyptidae (Sei et al., 2017), while current classification (MolluscaBase, 2023; Thompson, 2011) places it in Xanthonychidae instead. That interpretation of Xanthonychidae was shown to be polyphyletic, with branches scattered throughout Helicoidea (Calcutt et al., 2020; Cuezzo, 1998; Zhang et al., 2024). The classification of Lysinoe in Xanthonychidae is maintained here, but it is noted that this could potentially change with new phylogenetic studies.
Considering the overall shell shape, the present fossil is consistent with helminthoglyptid snails, in particular with Lysinoe spp., which include animals with large helicoid shells with similar features, including the wide umbilicus and the periumbilical angulation (Schileyko, 2004; Zilch, 1960). Species in related genera, e.g., Leptarionta Fischer & Crosse, 1872 and Helminthoglypta Ancey, 1887, have smaller shells (Schileyko, 2004; Zilch, 1960). The shells of Helminthoglypta spp. are also much more globular. Leptarionta spp. often display a median angulation on the body whorl, but the shells typically have higher spires and a more conical profile.
Figure 1. Lysinoe bravoensis sp. nov., holotype USNM MO 497132. A, Apertural view; B, lateral view; C, apical view; D, umbilical view. Scale bar = 2 cm.
The holotype and only specimen available is an internal mold of the shell, so interpretations of the species systematics must be done with caution. While the classification in Lysinoe seems the best solution at the moment, it must remain tentative until better-preserved fossils are found. There are minor morphological differences observed in the fossil (more flattened shell, light median angulation of body whorl; Fig. 1) that are not seen in recent representatives of Lysinoe: L. eximia (Pfeiffer, 1844), L. ghiesbreghti (Nyst, 1841), L. sebastiana (Dall, 1897), and L. starretti Thompson, 1963. Those differences, alongside the old age of the fossil, could indicate that this species belongs to a still unrecognized and extinct genus. Nevertheless, only the discovery of additional material (both, of the new species and L. breedlovei), in a better state of preservation, can shed more light on this matter.
Therefore, the same shell features mentioned above (i.e., more flattened shell, light median angulation of body whorl) can be used to diagnose Lysinoe bravoensis sp. nov. from its extant congeners. Importantly, the more flattened shell, lower spire, the median angulation on the body whorl, the ridge-like angulation surrounding the umbilicus, and the larger umbilicus (Fig. 1) diagnose Lysinoe bravoensis sp. nov. from Roth’s Lysinoe breedlovei.
Discussion
Living Lysinoe spp. are distributed from central and southern Mexico to El Salvador and Honduras (Schileyko, 2004; Thompson, 2011; Zilch, 1960). As such, an occurrence in the Oligocene of northern Mexico is outside the genus’s current distribution but hardly surprising, particularly considering that Lysinoe breedlovei is from the Late Eocene of Texas, close to the border with Mexico (Roth, 1984).
Still, Lysinoe bravoensis sp. nov. represents the first fossil record of the genus in Mexico. The oldest record of the genus (and of other closely-related xanthonychid genera) is Lysinoe breedlovei. The superfamily Helicoidea, to which they belong, originated in North America, with its oldest records (family Labyrinthidae) dating from the Paleocene and Eocene (Calcutt et al., 2020; Roth, 1988).
Gardner (1945: 18) noted that in USGS station 14023, Lysinoe bravoensis sp. nov. was part of an assemblage with marine mollusks (both gastropods and bivalves) and the freshwater snail Hemisinusmiralejas Gardner, 1945. Thus, Gardner (1945) suggested an estuarine paleoenvironment for the area, such as the mouth of a stream where sea shells could have accumulated alongside freshwater and terrestrial snail shells. Further, fossil Hemisinus spp. are also common in other deltaic deposits of northeastern Mexico (e.g., Vega & Perrilliat, 1992), supporting Gadner’s (1945) interpretation. At the type locality USGS station 13517, no accompanying fauna was found (Gardner, 1945); however, considering the sedimentological similarity between the 2 stations (Gardner, 1945), a similar paleoenvironment could be expected.
An actualistic genus-level approach can be used to hypothesize further paleoenvironmental aspects (Rasser et al., 2019), though this must be done with caution considering the relatively old age of the fossil and its uncertain generic affinities. Based on the current distribution and habitats of living Lysinoe spp., a humid forest environment would have been expected for the region in the past (cf. Roth, 1984), contrary to today’s xeric shrublands of the Tamaulipan mezquital.
Acknowledgements
I am very grateful to Mark Florence and Jessica Nakano (NMNH) for the loan of the material; to Erik Kjellman and Andreas Altenburger (UiT) for the help with the photographs of the specimen; and to the two anonymous reviewers and the editor, Xochitl Vital, for their helpful comments.
References
Calcutt, J., Cuezzo, M. G., Jackson, M., & Salvador, R. B. (2020). Phylogenetic relationships and classification of Solaropsidae (Gastropoda: Stylommatophora). Archiv für Molluskenkunde, 149, 181–193. https://doi.org/10.1127/arch.moll/149/181-193
Cuezzo, M. G. (1998). Cladistic analysis of the Xanthonychidae (=Helminthoglyptidae) (Gastropoda: Stylommatophora: Helicoidea). Malacologia, 39, 93–111.
Gardner, J. (1945). Mollusca of the Tertiary formations of northeastern Mexico. Geological Society of America Memoir, 11, 1–332. https://doi.org/10.1130/MEM11-p1
Rasser, M. W., Höltke, O., & Salvador, R. B. (2019). Gastropod paleohabitats of Miocene Lake Randeck Maar and its hinterland defined by an actualistic genus-level approach. Lethaia, 53, 229–241. https://doi.org/10.1111/let.12353
Roth, B. (1984). Lysinoe (Gastropoda: Pulmonata) and other land snails from Eocene-Oligocene of Trans-Pecos Texas, and their paleoclimatic significance. The Veliger, 27, 200–218.
Roth, B. (1988). Camaenid land snails (Gastropoda: Pulmonata) from the Eocene of southern California and their bearing on the history of the American Camaenidae. Transactions of the San Diego Society of Natural History, 21, 203–220.
Schileyko, A. A. (2004). Treatise on recent terrestrial pulmonate molluscs. Part 12. Bradybaenidae, Monadeniidae, Xan- thonychidae, Epiphragmophoridae, Helminthoglyptidae, Elonidae, Humboldtianidae, Sphincterochilidae, Cochli- cellidae. Ruthenica, 2 (Suppl.), 1627–1763.
Sei, M., Robinson, D. G., Geneva, A. J., & Rosenberg, G. (2017). Doubled helix: Sagdoidea is the overlooked sister group of Helicoidea (Mollusca: Gastropoda: Pulmonata). Biological Journal of the Linnean Society, 122, 697–728. https://doi.org/10.1093/biolinnean/blx082
Thompson, F. G. (2011). An annotated checklist and bibliography of the land and freshwater snails of México and Central America. Florida Museum of Natural History Bulletin, 50, 1–299. https://doi.org/10.58782/flmnh.bnej7351
Vega, F. J., & Perrilliat, M. C. (1992). Freshwater gastropods from Early Eocene Difunta Group, Northeastern Mexico. Journal of Paleontology, 66, 603–609. https://doi.org/10. 1017/S002233600002446X
Zhang, G., Naggs, F., Andrus, P. S., & Wade, C.M. (2024). Phylogenetic insights into the terrestrial snails Helicoidei (Gastropoda: Stylommatophora) with special emphasis on the Camaenidae. Zoological Journal of the Linnean Society, 200, 1–13. https://doi.org/10.1093/zoolinnean/zlae027
Zilch, Α. (1960). Euthyneura. In O. H. Schindewolf (Ed.), Handbuch der Paläozoologie (pp. 1–835). Berlin: Gebrüder Borntraeger.
Jesús García-Jiménez a, Olivia Ayala-Vásquez a, b, Javier Isaac de la Fuente a, b, Roberto Garibay-Orijel c, Fortunato Garza-Ocañas d, Edgardo Ulises Esquivel-Naranjo e, Felipe Manuel Ferrusca-Rico e, Fidel Landeros e, *
a Tecnológico Nacional de México, Instituto Tecnológico de Ciudad Victoria, Boulevard Emilio Portes Gil #1301, 87010 Ciudad Victoria, Tamaulipas, Mexico
b Colegio de Postgraduados, Microbiología, Edafología, Km 36.5 Carretera México-Texcoco, Montecillo, 56230 Texcoco, Estado de México, Mexico
c Universidad Nacional Autónoma de México, Instituto de Biología, Circuito exterior s/n, Ciudad Universitaria, Coyoacán, 04510 Mexico City, Mexico
d Universidad Autónoma de Nuevo León, Campus Linares, Facultad de Ciencias Forestales, Carretera Nacional Km 145, 67700 Linares, Nuevo León, Mexico
e Universidad Autónoma de Querétaro, Facultad de Ciencias Naturales, Carretera a Chichimequillas s/n, 76140 Santiago de Querétaro, Querétaro, Mexico
Cyanoboletus abieticola is described as a new species to science. This species is characterized by the viscid pileus, cylindric to bacilliform basidiospores ([14.1] 16.2 ± 1.1 [17.5] × [5] 5.5 ± 0.3 [5.9] µm, Q [2.8] 3.0 ± 0.1 [3.2]), and its gregarious habit in mixed coniferous forests dominated by Abies religiosa or A. guatemalensis. Photographs, drawings, and the phylogenetic analysis of 3 genetic data sets (ITS, nucLSU, and RPB2) of the new species are presented.
Cyanoboletus abieticola (Boletaceae, Basidiomycota), una especie nueva de México
Resumen
Cyanoboletus abieticola es descrita como una especie nueva para la ciencia. Esta especie se caracteriza por el píleo víscido, basidiosporas cilíndricas a baciliformes ([14.1] 16.2 ± 1.1 [17.5] × [5] 5.5 ± 0.3 [5.9] µm, Q [2.8] 3.0 ± 0.1 [3.2]) y su hábito gregario en bosques mixtos de coníferas dominados por Abies religiosa o A. guatemalensis. Se presentan fotografías, dibujos y el análisis filogenético de 3 conjuntos de datos genéticos (ITS, nucLSU y RPB2) de la nueva especie.
The family Boletaceae comprises pileate-stipitate or sequestrate species, with poroid or lamellate hymenophore. Boletaceae species are an important component of ecosystems because most of them form ectomycorrhizal associations with a great diversity of angiosperms and gymnosperms (Binder & Hibbet, 2006; Ortíz-Santana et al., 2007). They are common in different vegetation types, such as deciduous, conifer, and mixed forest; mediterranean shrublands, tropical and montane cloud forests (Bessette et al., 2010; Gelardi, 2020; Leonardi et al., 2020; Wu et al., 2016). In addition to their ecological importance, many species are valued edibles in several regions of the world (Garibay-Orijel et al., 2009; Gelardi, 2020).
Wu et al. (2014) recognized 7 major clades at the subfamily level and 59 genus-level clades, placing Boletus pulverulentus within the “Pulveroboletus group”, which also includes the genera Butyriboletus D. Arora & J.L. Frank, Cacaoporus Raspé & Vadthanarat, Caloboletus Vizzini, Crocinoboletus N.K. Zeng, Zhu L. Yang & G. Wu, Gymnogaster J.W. Cribb, Lanmaoa G. Wu & Zhu L. Yang, Pulveroboletus Murrill, Rubroboletus Kuan, Rugiboletus G. Wu & Zhu L. Yang, Suillellus Murrill, and Sutorius Halling, Nuhn & N.A. Fechner. Members of the “Pulveroboletus group” share certain common characteristics such as poroid hymenium, usually yellowish, reddish or brown hymenophore, Boletus-type hymenophoral trama (Snell & Dick, 1958), and smooth spores.
Gelardi et al. (2014) proposed the new genus Cyanoboletus, within the “Pulveroboletus group”, for those species characterized mainly by their strong blue reaction of basidiomata and context to cutting. They included 3 species in this genus: C. pulverulentus (Opat.) Gelardi, Vizzini & Simonini, C. sinopulverulentus (Gelardi & Vizzini) Gelardi, Vizzini & Simonini, and C. rainisiae (Bessette & O.K. Mill.) Gelardi, Vizzini & Simonini. The latter one was transferred to the genus Xerocomellus, but without type studies, and is currently known as X. rainisiae (Bessette & O.K. Mill.) N. Siegel, C.F. Schwarz & J.L. Frank (see discussion in Frank et al. [2020]).
Later, 4 more species were transferred to this genus: C. cyaneitinctus (Murrill) A. Farid, A.R. Franck & J.A. Bolin (Farid et al., 2021), C. instabilis (W. F. Chiu) G. Wu & Zhu L. Yang (Wu et al., 2016), C. poikilochromus (Pöder, Cetto & Zuccherelli) M. Carbone, D. Puddu & P. Alvarado (Carbone et al., 2023), and C. flavosanguineus (Lavorato & Simonini) Pierotti (Pierotti, 2015). However, the latter species was placed in the genus Neoboletus in 2021: N. flavosanguineus (Lavorato & Simonini) Biketova, Wasser, Simonini & Gelardi (Biketova et al., 2021).
Additionally, 5 Cyanoboletus species have been recently described: C. brunneoruber G. Wu & Zhu L. Yang from China (Wu et al., 2016), C. hymenoglutinosus D. Chakr., K. Das, A. Baghela, S.K. Singh & Dentinger nom. inval. from India (Li et al., 2016), C. bessettei A.R. Bessette, L.V. Kudzma, & A. Farid from the USA (Farid et al., 2021), C. macroporus Sarwar, Naseer & Khalid from Pakistan (Sarwar et al., 2021), and C. mediterraneensis Biketova, A. Rinaldi & Simonini from Israel and Italy (Biketova et al., 2016, 2022). Therefore, 10 species are currently known for the genus. These species are distributed mainly in Asia, Europe and North America and associated with Abies, Arbutus, Buxus, Carya, Castanopsis, Cistus, Crataegus, Cryptomeria, Erica, Juniperus, Lithocarpus, Ostrya, Pinus, Pistacea,and Quercus trees, as well as with Halimium shrub (Biketova et al., 2022; Farid et al., 2021; García et al., 1998; Li et al., 2016; Wu et al., 2016).
This paper describes Cyanoboletus abieticola as a new species from Mexico associated with mixed conifer forests dominated by Abies religiosa (Kunth) Schltdl. & Cham. and A. guatemalensis Rehder.
Materials and methods
Collections were carried out in central and southern Mexico (Fig. 1), in mixed coniferous forests, during the rainy season from June to October (2000-2017). Morphological characteristics were described according to Largent (1977) and Lodge et al. (2004). Chemical reactions with KOH 5% and Melzer reagent were tested on pileus, hymenophore, and stipe surface. Photographs of basidiomata were taken on site, as well as data regarding plant species. The colors for the taxonomic description were based on Kornerup and Wanscher (1978). A light microscope (Carl Zeiss GmbH 37081, Germany) was used to observe the microscopic characteristics. Only structures from mature basidiomes were measured. Twenty basidiospores, basidia, pleurocystidia, cheilocystidia and caulocystidia were measured by specimen. If the specimen consisted of several basidiomes, only the structures of 2 of them were measured. The mean of each variable of every collection was computed. Dimensions are given according to the following format: (lower mean) mean of means ± standard deviation (upper mean), Q = (lower mean) mean of means ± standard deviation (upper mean).
Vouchers were deposited in the “Herbario Nacional de México” (MEXU), in the José Castillo Tovar herbarium (ITCV), and in the mycological herbarium of the Universidad Autónoma de Querétaro (MUAQ). Additional materials were obtained in loan from the following herbaria: Escuela Nacional de Ciencias Biológicas-Instituto Politécnico Nacional herbaria (ENCB-IPN), Instituto de Biología Universidad de Guadalajara (IBUG), Instituto Nacional de Ecología (INECOL) and Universidad Autónoma de Nuevo León (UNL). All acronyms of herbaria and mycological collections follow Index Herbariorum (Thiers, 2024).
Samples of dehydrated basidiomata were used for DNA extraction. The DNA was extracted using the DNeasy Power-Soil kit (QIAGEN). Cell lysis was performed by grinding in a mortar with liquid nitrogen. Three nuclear loci (ITS, LSU and RPB2) were amplified with Platinum Taq DNA Polymerase (Invitrogen-Thermo Fisher Scientific) or Taq & Load PCR Mastermix (MP Biomedicals) in a thermal cycler (BIO-RAD). The PCR parameters were as follows: 95 ºC initial denaturation 4 min; 35 cycles of denaturation at 94 ºC for 1 min, annealing at 54 ºC for 1 min, extension at 72 ºC for 1 min, and a final extension step at 72 ºC for 10 min. The primers ITS1/ITS4 (White et al., 1990) were used for the ITS region; LR0R/LR5 (Vilgalys & Hester, 1990) for nucLSU; and RPB2-B-F2/RPB2-B-R (Wu et al., 2014) for the RPB2 gene. The PCR products were examined by 1% agarose gel electrophoresis, the gel was stained with GelRed (Biotium) and observed under an UVP Multidoc-It transilluminator (Analytikjena). Successful PCR products were cleaned with diluted 1:1 ddH2O: ExoSAP-IT (Thermo Fisher Scientific) and incubated at 37 ºC for 45 min and 80 ºC for 15 min. Sanger sequencing of clean PCR products was performed in the “Laboratorio de secuenciación genómica de la biodiversidad y la salud” at Instituto de Biología, Universidad Nacional Autónoma de México. Samples were sequenced in both directions with PCR primers using BigDye Terminator v3.1 (Thermo Fisher Scientific). Sequences were edited in Chromas Pro Vers. 1.41 (Technelysium Pty, Ltd, Tewantin, Qld, Australia).
For phylogenetic analyses we used Cyanoboletus sequences from the ITS, nucLSU and RPB2 regions listed in the Table 1. A total of 32 concatenated sequences were used (Supplementary material 1). Two Lanmaoa species were chosen as an outgroup. The sequences of each locus were aligned separately using MacClade 4.0 (Maddison & Maddison, 2000) and concatenated in Mesquite 3.40 (Maddison & Maddison, 2018). The alignments were manually edited to eliminate ambiguous regions.
Table 1
List of DNA sequences used for Cyanoboletus phylogenetic analyses.
Species
Code
Country
GenBank
Reference
ITS
nucLSU
RPB2
Lanmaoa sublurida
USF 288426
USA
MW675740
MW662575
MW737499
Farid et al., 2021
L. sublurida
USF 300104
USA
MW675736
MW662572
MW737498
Farid et al., 2021
Cyanoboletus abieticola
MUAQ13 Paratype
Mexico
MW750332
MW750369
–
This study
C. abieticola
ITCV-1010 Paratype
Mexico
–
MW750367
–
This study
C. abieticola
MEXU-30111 Paratype
Mexico
MW209739
MW750366
PP108649
This study
C. abieticola
MEXU-30106 Paratype
Mexico
MW209740
MW750365
–
This study
C. abieticola
MEXU-30109 Holotype
Mexico
MW209738
MW750368
PP108650
This study
Table 1. Continued
Species
Code
Country
GenBank
Reference
ITS
nucLSU
RPB2
C. abieticola
MEXU-26275 Paratype
Mexico
KC152077
–
–
This study
C. abieticola
MEXU-26276 Paratype
Mexico
KC152076
–
–
This study
C. abieticola
MEXU-26278 Paratype
Mexico
KC152075
–
–
This study
C. bessettei
USF 301500 (A) Holotype
USA
MW675737
MW662571
MW737457
Farid et al., 2021
C. bessettei
USF 301500 (B) Holotype
USA
MW675738
–
MW737458
Farid et al., 2021
C. brunneoruber
HKAS63504
China
–
KF112368
KF112702
Wu et al., 2014
C. brunneoruber
HKAS80579 1
China
–
KT990568
KT990401
Wu et al., 2016
C. brunneoruber
HKAS80579 2
China
–
KT990569
KT990402
Wu et al., 2016
C. cyaneitinctus
USF 288424
USA
MW675739
MW662574
MW737461
Farid et al., 2021
C. cyaneitinctus
USF 301499 Epitype
USA
MW675744
MW662579
MW737503
Farid et al., 2021
C. cyaneitinctus
JAB184
USA
MW675731
MW662584
MW737467
Farid et al., 2021
C. cyaneitinctus
JAB324
USA
MW675732
MW662586
MW737469
Farid et al., 2021
C. cyaneitinctus
JAB325
USA
MW675733
–
MW737470
Farid et al., 2021
C. hymenoglutinosus
AB2016
India
KT907355
KT860060
–
Li et al., 2016
C. instabilis
FHMU1839
China
MG030473
MG030466
–
Chai et al., 2018
C. instabilis
HKAS59554
China
–
KF112412
KF112698
Wu et al., 2014
C. macroporus
DC21-02
India
OQ860238
OQ860239
ON364552
Das et al., 2023
C. macroporus
DC21-04
India
OQ860240
OQ860241
OQ876894
Das et al., 2023
C. mediterraneensis
K-M000265123 Holotype
Israel
–
OM801212
–
Biketova et al., 2023
C. mediterraneensis
K-M000265124 Paratype
Israel
OM801199
–
–
Biketova et al., 2023
C. mediterraneensis
TUR-A 209199
Italy
MZ265183
MZ265198
MZ277228
Carbone et al., unpublished
C. paurianus
KD22-008
India
–
OQ859920
OQ914389
Das et al., 2023
C. paurianus
KD22-009 Holotype
India
–
OQ859919
OQ914388
Das et al., 2023
C. poikilochromus
GS10070
Italy
KT157051
KT157060
KT157068
Gelardi et al., 2015
C. poikilochromus
GS11008
Italy
KT157050
KT157059
KT157067
Gelardi et al., 2015
C. poikilochromus
TO HG 100091987 Epitype
Italy
KT157047
KT157056
–
Gelardi et al., 2015
C. pulverulentus
MG126a
Italy
KT157053
KT157062
–
Gelardi et al., 2015
C. pulverulentus
MG 456a
Portugal
KT157054
KT157063
–
Gelardi et al., 2015
C. pulverulentus
MG 628a
Italy
KT157055
KT157064
KY157069
Gelardi et al., 2015
C. sinopulverulentus
HKAS59609
China
–
KF112366
KF112700
Wu et al., 2014
C. sinopulverulentus
HMAS266894
China
KC579402
–
–
Gelardi et al., 2015
Cyanoboletus. sp.
HKAS76850
China
–
KF112343
KF112697
Wu et al., 2014
Phylogenetic analyses were partitioned for both Maximum Likelihood (ML) and Bayesian Inference (BI) analyses. Best evolutionary models were selected with jModelTest 2.1.10 (Darriba et al., 2012), using the Akaike information criteria. Table 2 summarizes the evolutionary model of each region. The ML analysis was performed in RAxML 7.2.6 (Stamatakis, 2006), with 1,000 bootstrap replicates. The BI analysis was performed in MrBayes 3.2.5 (Ronquist & Huelsenbeck, 2003) with 5,000,000 generations, 4 Monte Carlo chains and sampling every 100 trees, chain convergence was determined using Tracer 1.7.2 (Rambaut et al., 2018), we discarded the first 25% of trees as burning. ML bootstrap support (BS) over 50% and Bayesian posterior probability (PP) values exceeding 0.90 are reported in the resulting tree.
Table 2
Nucleotide substitutions models by each partition obtained from jModelTest with the corrected Akaike information criterion.
Gene/Partition
Length
Evolutifon model
Nst-rates
nucLSU
747 pb
TIM1+G
6 – Gamma
ITS
603 pb
TPM3ef+G
6 – Gamma
RPB2
688 pb
TIM3ef+G
6 – Gamma
Results
The phylogenetic analyses (Fig. 1) based on the ITS, nucLSU and RPB2 concatenated dataset using ML analyses and BI showed that all Cyanoboletus species cluster in a monophyletic clade with strong support (PP 1 / BS 100). Trees obtained from separate ITS and RPB2 analyses are presented in Supplementary material 2. Sequences of all C.abieticola sp. nov. samples form a strongly supported clade (PP 1/BS 99) within the genus Cyanoboletus. Consequently, based on morphological, phylogenetic and ecological data, we describe it as a new species, which is also the first species of the genus Cyanoboletus reported from Mexico.
To determine whether the ITS or RPB2 region is more informative as a barcode, in Table 3 we show the percentages of nucleotide similarity between species. The RPB2 region commonly has more variation and generates fewer ambiguous regions than the ITS. Even while the ITS region has been considered as the fungal genetic barcode, the RPB2 region has higher resolution for species delineation in Cyanoboletus.
Description
Cyanoboletus abieticola J. García, Ayala-Vásquez & Landeros,sp. nov.
Diagnosis. Pileus 13-50 mm in diameter, viscid, widely convex, convex to plane convex, brown, yellow, pale brown, reddish-brown, cinnamon. Stipe 40-75 × 7-8 mm, viscid, cylindrical, yellow when young, middle section and apex yellow when mature, basal area red brown to red-vinaceous, and basidiospores (14.1) 16.2 ± 1.1 (17.5) × (5) 5.5 ± 0.3 (5.9) µm. It grows on the ground of neotropical Abies forests.
Description. Macroscopic characters (Fig. 2). Pileus 13-50 mm diameter, widely convex, convex to plane convex, brown yellow (4B6), pale brown (6B5), reddish-brown, cinnamon, furfuraceous, very viscid when young, incurved margin, sterile. Hymenophore attached, pores 0.3-0.7 mm in diameter, pale yellow (2A8-2A4), yellow (3A8) to yellow-olive (30B8-30B7) it stains dark blue (22F8) when touched, with some brown tones, young specimens exude a somewhat acidic astringent-flavored yellow liquid from hymenophore; tubes 2-6 mm diameter, concolor to pores, immediately changing to dark blue (25F8) when cut. Context white, 5 mm thick, dark blue (22F8) when cut; stipe context pale yellow (3A6) base red-vinaceous (10F8), turning blue (25F8) when cut. Stipe 40-75 × 7-8 mm, cylindrical, yellow when young, middle section and apex yellow when mature, basal area red brown (9C8-9C5) to red-vinaceous (10F8), surface pruinose to furfuraceous, immediately turning dark blue (22F8) when touched. Mycelium white.
Chemical reactions: pileus surface and context turning dark brown (6F8) with KOH 5%, hymenophore turning brown (5F3) with KOH 5%.
Microscopic characters (Fig. 3). Basidiospores 14.1-17.5 × 5-5.9 µm, mean values 16.2 ± 1.1 × 5.5 ± 0.3 µm, Q 2.8-3.2, means values 3.0 ± 0.1, cylindric to bacilliform, yellow in KOH, inamyloid with Melzer’s reagent, with visible suprahilar depression (Fig. 3A). Basidia 27.3-37.6 × 9.5-10.7 µm, mean values 33.3 ± 4.0 × 10.3 ± 0.5 µm, clavate, hyaline in KOH, tetrasporic (Fig. 3B). Hymenophoral trama divergent (Boletus-type), with a medium and lateral stratum of cylindrical hyphae, hyaline to yellowish brown in KOH, inamyloid with Melzer’s reagent, with gelatinized wall. Pleurocystidia 52.2-71.2 × 10.6-13.9 µm, mean values 63.2 ± 7.5 × 12.4 ± 1.4 µm, arise from subhymenium, mucronate, clavate, fusoid-ventricose, hyaline to brown in KOH (Fig. 3C), with reddish brown incrustations on Melzer. Cheilocystidia 39.6-58.4 × 8.9-11 µm, mean values 47.7 ± 7.5 × 9.9 ± 0.8 µm, fusoid-ventricose, mucronate, clavate, reddish to brown on KOH, with reddish brown incrustations (dextrinoid) in Melzer’s reagent, thick-walled (Fig. 3D). Pileipellis formed by an ixotrichoderm 250-300 µm thick, with terminal cells 34.8-45.4 × 4-5.6 µm, mean values 38.4 ± 4.8 × 4.7 ± 0.6 µm, cylindrical, yellow-reddish brown in KOH, reddish brown (dextrinoid) with Melzer’s reagent, some with thick wall, sometimes gelatinized (Fig. 3E). Stipitipellis 100-120 µm thick, ixocutis, hyphae subparallel to loosely intermingled, formed of caulocystidia 34-47 × 9.6-11.4 µm, mean values 40.6 ± 5.2 × 10.3 ± 0.7 µm, in clusters, fusoid-mucronate, clavate, some ventricose, arise from the middle or surface, hyaline to brown in KOH, with reddish brown incrustations (dextrinoid) in Melzer’s reagent.
Figure 1. Bayesian tree using the concatenated alignment (LSU, ITS and RPB2). The values in the phylogram branches represent the maximum likelihood bootstrap (MLB)/Bayesian posterior probabilities (BPP). Only MLB 50 ≥ and 90 BPP ≥ are displayed. Cyanoboletus abieticola is in bold.
Taxonomic summary
Holotype: Mexico, Oaxaca, Santa Catarina Ixtepeji, La Cumbre, Abiesguatemalensis, 17º11’ N, 96º38’ W, 2,902 m asl, 4 November 2017, Ayala-Vásquez (MEXU-30109).
Isotype: ITCV-1141
Mycobank: MB 838523.
Etymology: the name of the species is due to its association with Abies forests.
Habitat: scattered or solitary in mixed neotropical conifer forests dominated by Abies religiosa and A. guatemalensis.
Table 3
Percent nucleotide similarity between Cyanoboletus species based on their sequences, ITS/RPB2 DNA sequences. Above ITS and below RPB2 percentage ranges (WD: without data).
C. abieticola
C. bessettei
C. brunneoruber
C. cyaneitinctus
C. hymenoglutinosusus
C. instabilis
C. macroporus
C. mediterraneensis
C. paurianus
C. poikilochromus
C. pulverulentus
C. sinopulverulentus
C. abieticola
0.0-0.5 0.0
C. bessettei
5.6-6.2 8.7
0.0 0.0
C. brunneoruber
WD 5.9
WD 8.7
WD 0.0
C. cyaneitinctus
6.7-7.2 7.0
8.1 10.2
WD 5.9
0.0 0.0
C. hymenoglutinosus
3.6-3.9 WD
4.6 WD
WD WD
5.7 WD
WD WD
C. instabilis
5.7-7.0 7.5
5.7 8.3
WD 7.8
6.3 8.7
6.3 WD
WD WD
C. macroporus
4.4-4.6 6.0
5.4 8.8
WD 5.3
4.9 3.6
1.8 WD
7.0 7.9
0.0 0.0
C. mediterraneensis
2.9-3.9 2.7
2.9-3.4 7.0
WD 5.4
2.0-5.9 6.0
2.3 WD
5.1 5.8
3.1-3.2 5.4
0.0-0.3 WD
C. paurianus
WD 6.2
WD 9.2
WD 4.6
WD 3.6
WD WD
WD 8.0
WD 2.7
WD 4.9
WD 0.0
C. poikilochromus
4.2-5.9 6.9-7.1
3.9 8.5-8.7
WD 7.1-7.4
5.9-7.6 7.7-7.8
2.0-3.4 WD
7.0-7.1 7.8-8.0
3.3-4.6 7.5
1.7-3.0 6.3-6.7
WD 7.1-7.2
0.0 0.0-0.5
C. pulverulentus
3.6-3.9 6.5
4.9-5.2 9.1
WD 5.2
4.6 2.2
2.1-2.3 WD
6.3 8.4
1.8-2.1 2.8
2.3-2.8 5.1
WD 2.8
3.6-4.9 7.8
0.0-0.3 WD
C. sinopulverulentus
3.8-4.1 6.1
5.2 9.3
WD 4.6
4.0 3.9
2.8 WD
6.3 7.4
1.0 2.7
2.3-3.1 4.7
WD 2.1
3.1-4.7 7.0-7.1
1.3-1.6 3.3
WD WD
Additional material studied. Mexico, Hidalgo: El Chico National Park, Abies religiosa, 13 August 1988, J. García (ITCV-5874), 13 August 1988, J. García (ITCV-5878), 23 August 2018, J. García (ITCV-21996); Jalisco: Road to Tamazula, 15 km to Mazamitla, between Guayabos and Cabañas, A. religiosa, 24 August 1974, G. Guzmán (ENCB-11869); Road from San Sebastián del Oeste to Santa Ana, A. religiosa, 29 August 1994, L. Guzmán-Dávalos (IBUG-5349); Nevado de Colima, A. religiosa, 13 October 1984, A. Tamayo and R. González (IBUG); 11 August 1990, J. García (ITCV-6633); Estado de México: Road to Chalma, Lagunas de Zempoala National Park, A. religiosa, 1 August 1982, R. E. Chio (ENCB-368, ITCV-368), 23 September 1985, E. Perez-Silva (MEXU-19733), 17 July 1985, García (ITCV-4784); Nevado de Toluca National Park, near Ranchería La Puerta, A. religiosa, 21 August 1983, L. Colón 208-a (ENCB); Naucalpan-Toluca highway, road to Villa Alpina, La Glorieta, A. religiosa, without date, A. González-Velázquez (ENCB-965); Mpio. Amanalco, Corral de Piedras, A. religiosa, without date, A. González-Velázquez (ENCB-1454); Zone E of San Rafael Atlixco, Escualango, A. religiosa, 7 October 1983, A. Hernández (ENCB-145); La Marquesa, A. religiosa, 7 July 1963, Gispert-Imaz (MEXU-9873), 12 August 1962, G. Guzman (ENCB-3198); Ciudad de México: Former Mexico-Cuernavaca highway 3 km S. of Parres, A. religiosa, 17 July 1982, S. Chacón (ENCB-183); Michoacán: Morelia-Cd Road. Hidalgo, Sierra de Mil Cumbres, km 45, A. religiosa, 21 July 1983, J. García (UNL-3665, ITCV-3665), 15 July 1982, J. García (UNL-1998, ITCV-1998); Morelos: Road to Chalma, 5 km Huitzilac, A. religiosa, 17 July 1982, S. Chacón (ENCB-234); Oaxaca: Santa Catarina Ixtepeji, La Cumbre, 17°11’ N, 96°38’ W, A. guatemalensis, 18 July 2017, Ayala-Vásquez (ITCV-846), 20 August 2017, Ayala-Vásquez (ITCV-1002), 21 August 2017, Ayala-Vásquez and Victores-Aguirre, (ITCV-1010); 8 October 2017, Ayala-Vásquez, (MEXU-30106, ITCV-1129), Ayala-Vásquez (MEXU-30111, ITCV-1128); 4 November 2017, Ayala-Vásquez (ITCV-1136); Ayala-Vásquez (MEXU-30109, ITCV-1141), Ayala-Vásquez, (ITCV-1142); Querétaro: Mpio. Cerro El Zamorano, A. religiosa, 16 September 1995, J. García (ITCV-9560), 23 September 2017, Ferrusca 390 (MUAQ13), 19 october 2019, Ferrusca 462 (MUAQ14), Ferrusca 467 (MUAQ15), 16 september 2022, Landeros 3770 (MUAQ16); Tlaxcala: road from Tlaxco to Chignahuapan, Cerro de Teapa, El Conejo, A. religiosa, 26 June 1979, J. García (UNL-496, ITCV-496); Huamantla, road to La Malinche hilltop, A. religiosa, 29 August 2010, T. Bruns (MEXU-26275) (MEXU-26276) (MEXU-26278); Veracruz: Xico, Los Gallos, 1.5 km to N. from Ingenio El Rosario, Zona del Cofre de Perote, A. religiosa, 27 October 1983, Villarreal 1024 (INECOL-1068), 31 July 1990, J. García (ITCV-6459).
Figure 2. Cyanoboletus abieticola morphology. A) Basidiomata (holotype), B) context, C) basidiomata at different stages. Bar = 10 mm.
Figure 3. Microscopic characteristics of Cyanoboletus abieticola. A) Basidiospores, B) basidia, C) cheilocystidia, D) pleurocystidia, E) stipitipellis, F) pileipellis. Bar = 10 µm.
Remarks
Cyanoboletus abieticola is a new species with a strong phylogenetic support (PP1 / BS 99) and distinctive taxonomic characters. This species is characterized by a small pileus 13-50 mm diameter, very viscid, pale brown, yellowish-brown, brown, red to cinnamon; pileus sterile margin somewhat involute when young; hymenophore distills a liquid with sweaty acidic flavor when young, pores and tubes yellow; stipe yellow cylindrical in the middle and apex, basal area red brown to red-vinaceous, when touched immediately turns to dark blue. It is distributed in mixed coniferous forests in central and southern Mexico at altitudes ranging from 2,700 to 3,000 m asl (Fig. 4).
Figure 4. Distribution of Cyanoboletus abieticola in Mexico.
Previously, only 2 species of Cyanoboletus (C. bessettei and C. cyaneitinctus) have been recorded from North America (Farid et al., 2021). Cyanoboletus bessettei and C. cyaneitinctus have similar small basidiomata as C. abieticola, nevertheless, both species are associated with oak forests in the United States, in contrast, C. abieticola is distributed from central to southern Mexico in mixed conifer forests with a strong association with Abies. Morphological and microscopical comparisons of the American species of Cyanoboletus are shown in the Table 4. They are similar by morphology, however, C. bessettei has blue-green then reddish-brown staining in its stipe when handled, while C. abieticola and C. cyaneitinctus are bluing, also their basidiospores are bigger than those in C. bessettei (9-11 ´ 3.5-5 mm). Cyanoboletus cyaneitinctus and C. abieticola are very similar by morphology and microscopical characters, however they are not phylogenetically close, and the first one has shorter basidiospores in length (11.5-15 mm) and associates with Carya and Quercus.
Table 4
North American Cyanoboletus species morphology comparison.
Characteristic
C. bessettei
C. cyaneitinctus
C. abieticola
Pileus color
Buffy brown when young, darker brownish at maturity
Most Cyanoboletus species are morphologically similar, so to separate them, a combination of microscopic, geographic and molecular characteristics is necessary. With the description of this new species, the genus Cyanoboletus reaches its southernmost distribution in America, developing in forests of central and southern Mexico forests. Its occurrence in Abies forests is also highlighted, since in North America the genus has been recorded in mixed Pinus–Quercus forests (Farid et al., 2021).
Acknowledgements
We thank Instituto Tecnológico de Ciudad Victoria, Universidad de Quintana Roo, Universidad Nacional Autónoma de México and Universidad Autónoma de Nuevo León for supporting this research. The DNA sequences produced at IB-UNAM were financed by project Conacyt 239266 assigned to RGO. AVO thanks Conahcyt for the postdoctoral funding 3129307. The last author wants to thank the Universidad Autónoma de Querétaro for the project FNB-2022-06.
References
Bessette, A., Roody, W. C., & Bessette, A. R. (2010). Boletes of Eastern North America: a color guide to the fleshy pored mushrooms. China: Syracuse University Press.
Biketova, A. Y., Kosakyan, A., Wasser S. P., & Nevo, E. (2016). New, noteworthy, and rare species of the genus Boletus in Israel. Plant Biosystems, 150, 876–886. https://doi.org/10.1080/11263504.2014.990537
Biketova, A. Y., Wasser, S. P., Simonini, G., & Gelardi, M. (2021). Nomenclatural novelties: Neoboletus flavosanguineus (Lavorato & Simonini) Biketova, Wasser, Simonini & Gelardi, comb.nov. Index Fungorum, 505, 1.
Biketova A. Y., Rinaldi A. C., & Simonini, G. (2022). Nomenclatural novelties: Cyanoboletus mediterraneensis Biketova, A. Rinaldi & Simonini, sp. nov. Index Fungorum, 516, 1.
Carbone, M., Puddu, D., & Alvarado, P. (2023). Nomenclatural novelties: Cyanoboletus poikilochromus (Pöder, Cetto & Zuccherelli) M. Carbone, D. Puddu & P. Alvarado, comb. nov. Index Fungorum, 534, 1.
Darriba, D., Taboada, G. L., Doallo, R., & Posada, R. (2012). jModelTest 2: more models, new heuristics and parallel computing. Nature Methods, 9, 772.
Farid, A., Bessette, A. E., Bessette, A. R., Bolin, J. A., Kudzma, L. V. Franck, A. R. et al. (2021). Investigations in the boletes (Boletaceae) of southeastern USA: four novel species and three novel combinations. Mycosphere, 12, 1038–1076. https://doi.org/10.5943/mycosphere/12/1/12
Frank, J. L., Siegel, N., Schwarz, C. F., Araki, B., & Vellinga, E. C. (2020). Xerocomellus (Boletaceae) in western North America. Fungal Systematics and Evolution, 5, 265–288. http://dx.doi.org/10.3114/fuse.2020.06.13
García, J., Pedraza, D., Silva, C. I., Andrade, R. L., & Castillo, J. (1998). Hongos del estado de Querétaro. Querétaro: Universidad Autónoma de Querétaro.
Garibay-Orijel, R., Martínez-Ramos, M., & Cifuentes, J. (2009). Disponibilidad de esporomas de hongos comestibles en los bosques de pino encino de Ixtlán de Juárez, Oaxaca. Revista Mexicana de Biodiversidad, 80, 521–534. https://doi.org/10.22201/ib.20078706e.2009.002.615
Gelardi, M. (2020). Diversity, biogeographic distribution, ecology, and ectomycorrhizal relationships of the edible porcini mushrooms (Boletus s. str., Boletaceae) worldwide: state of the art and an annotated checklist. In J. Pérez-Moreno, A. Guerin-Laguette, R. Flores Arzú, & F.Q. Yu (Eds.), Mushrooms, humans and nature in a changing World (pp. 223–271). Cham, Switzerland: Springer. https://doi.org/10.1007/978-3-030-37378-8_8
Kornerup, A., & Wanscher, J. H. (1978). Methuen handbook of colour. London: Methuen Publishing.
Largent, D., Johnson, D., & Watling, R. (1977). How identify mushrooms to genus III: microscopic features. Eureka, California: Mad River Press.
Leonardi, M., Marinho-Furtado, A. N., Comandini, O., Geml, J., & Rinaldi, A. C. (2020). Halimium as an ectomycorrhizal symbiont: new records and an appreciation of known fungal diversity. Mycological Progress, 19, 1495–1509. https://doi.org/10.1007/s11557-020-01641-0
Li, G. J., Hyde, K. D., Zhao, R. L., Hongsanan, S., Abdel-Aziz, F. A., Abdel-Wahab, M. A. et al. (2016). Fungal diversity notes 253-366: taxonomic and phylogenetic contributions to fungal taxa. Fungal Diversity, 78, 1–237. http://doi.org/10.1007/s13225-016-0366-9
Lodge, D. J., Ammirati, J. F., Dell, T. O., & Mueller, G. M. (2004). Terrestrial and lignicolous macrofungi: collecting and describing macrofungi. In G. Mueller, G. F. Bills, & M. S. Foster (Eds.), Biodiversity of Fungi. Inventary and monitoring methods (pp. 128–158). New York: Elsevier Academic Press.
Maddison, D. R., & Maddison, W. P. (2000). MacClade 4: analysis of phylogeny and character evolution. Sunderland, Massachussetts: Sinauer Associates.
Maddison, W. P., & Maddison, D. R. (2018). Mesquite: a modular system for evolutionary analysis. Version 3.40. http://www.mesquiteproject.org
Pierotti, A. (2015). Nomenclatural novelties: Cyanoboletus flavosanguineus (Lavorato & Simonini), in Pierotti, comb. nov. Index Fungorum, 263, 1.
Rambaut, A., Drummond, A. J., Xie, D., Baele, G., & Suchard, M. A. (2018). Posterior summarization in Bayesian phylogenetics using Tracer 1.7. Systematic Biology, 67, 901-904. http://doi.org/10.1093/sysbio/syy032
Ronquist, F., & Huelsenbeck, J. P. (2003). MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19, 1572–1574. https://doi.org/10.1093/bioinformatics/btg180
Sawar, S., Naaser, N., & Khalid, A. N. (2021). Cyanoboletus macroporus (Boletaceae), a new bolete species from Pakistani forests. Karstenia, 59, 78–87.
Stamatakis, A. (2006). RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics, 22, 2688–2690. https://doi.org/10.1093/bioinformatics/btl446
Vizzini, A. (2014). Nomenclatural novelties: Cyanoboletus Gelardi, Vizzini & Simonini, gen. nov. Index Fungorum, 176, 1.
Wu, G., Feng, B., Xu, J. P., Zhu, X. T., Li, Y. C., Zeng, N. K., Hosen, M. I., & Yang, Z. L. (2014). Molecular phylogenetic analyses redefine seven major clades and reveal 22 new generic clades in the fungal family Boletaceae. Fungal Diversity, 69, 93–115. https://doi.org/10.1007/s13225-014-0283-8
Wu, G., Li, Y. C., Zhu, X. T., Zhao, K., Han, L. H, Cui, Y. Y., Li, F., Xu, J. P., & Yang, Z. L. (2016). One hundred noteworthy boletes from China. Fungal Diversity, 81, 25–188. https://doi.org/10.1007/s13225-016-0375-8
Sergio I. Salazar-Vallejo a, * Víctor M. Conde-Vela b, Daniel A. López-Sánchez a
a El Colegio de la Frontera Sur, Departamento de Sistemática y Ecología Acuática, Ave. Centenario Km 5.5, Chetumal, Quintana Roo, México
b Department of Invertebrate Zoology, Smithsonian Institution, National Museum of Natural History, 10th St. & Constitution Ave. NW, Washington, DC, 20560, USA
Received: 17 January 2024; accepted: 29 April 2024
Abstract
Aaron Treadwell described Lagisca crassa from Punta Arenas, Chile 100 years ago, based on an incomplete specimen. The species was later regarded as belonging in Eunoe Malmgren, 1865, but the species has not been found after its original description. The rediscovery of specimens collected in Punta Arenas has allowed us to evaluate its morphology to clarify some incompletely known features. Further, a comparison of the holotype of L. crassa with specimens of Hermadion magalhaensi Kinberg, 1856, led us to conclude these 2 species-group names are synonyms. We provide additional information and illustrations, and make some remarks on Eunoe and Hermadion Kinberg, 1856.
Redescubrimiento de Eunoe crassa y aclaración de algunos atributos morfológicos (Annelida: Aphroditiformia: Polynoidae)
Resumen
Aarón Treadwell describió Lagisca crassa de Punta Arenas, Chile hace 100 años con un ejemplar incompleto. Luego la especie fue considerada como parte de Eunoe Malmgren, 1865, pero no fue recolectada de nuevo después de su descripción original. El redescubrimiento de ejemplares recolectados en Punta Arenas nos permitió evaluar su morfología y aclarar algunos atributos poco conocidos. Además, la comparación del material tipo de L. crassa con ejemplares de Hermadion magalhaensi Kinberg, 1856, nos hizo concluir que estas 2 especies nominales son sinónimas. En esta contribución proporcionamos información e ilustraciones adicionales y hacemos algunos comentarios sobre los géneros Eunoe y Hermadion Kinberg, 1856.
The family Polynoidae Kinberg, 1856 is one of the largest groups of marine annelids, and although there is some discrepancy about the generic definition for several taxa, and many synonyms were introduced without revisions, or after using a rather wide definition for genera, Polynoidae includes 12-13% of all polychaete genera, and about 8% or all polychaete species. Thus, Polynoidae would include almost 180 genera and about 900 species in some sources (Pamungkas et al., 2019), or 167 genera and 870 species (Read & Fauchald, 1924), but the most relevant feature is that the number of new taxa proposed per year is still growing (Pamungkas et al., 2019). One problem in identifying marine scaleworms is that they often break in parts, detach their elytra, or both, and this is widespread in specimens from the intertidal to abyssal depths. For this reason, many species have been described based on incomplete specimens. Further, as indicated by Barnich and Fiege (2009), as a result of a low number of taxonomic publications or revisions, for many polynoid genera “neither the respective generic nor specific identification characters have been critically evaluated.” This is further complicated because about 30% of all polynoid species are only known after the original description (Hourdez, 2024 pers. comm.).
The polynoin genera Lagisca Malmgren, 1865 and Eunoe Malmgren, 1865 are very similar by having 15 pairs of elytra but final segments without elytra, notochaetae as thick as, or thicker than neurochaetae, never with pilose or capillary tips, neurochaetae without semilunar pockets, with tips uni- or bidentate, ventral cirri digitate, venter smooth (Fauchald, 1977). The main difference separating them is the type of neurochaetae; in Lagisca there are at least some bidentate ones, whereas in Eunoe all are unidentate. Pettibone (1963) regarded both, Eunoe and Lagisca as subgenera of Harmothoe Kinberg, 1856. Malmgren (1865: key) separated Lagisca from Harmothoe because of the extent of dorsal cover by elytra. In Lagisca, the last segments are exposed, whereas in Harmothoe they are always covered. These 2 genera are regarded as synonyms because besides both having bidentate neurochaetae, larger specimens of Harmothoe usually have the last segments exposed (Barnich et al., 2006). However, as indicated by Fauvel (1916), the diagnostic relevance of this feature implies there are 12-19 chaetigers uncovered, as in Hermadion Kinberg, 1856, against a few (up to 5) in Harmothoe and other genera.
On the other hand, Eunoe also resembles Hermadion Kinberg, 1856, another subgenus in Harmothoe after Pettibone (1963), which is regarded as distinct by Wehe (2006). They are similar to each other by having the same number of elytra, final segments without elytra, and notochaetae as thick as, or thicker than neurochaetae. The main differences between them are that Eunoe species have less segments (40 vs. 50 or more), and neurochaetae are all unidentate in Eunoe, whereas they were regarded as uni- or bidentate in Hermadion. However, Bock et al. (2010) revised Hermadion, redefined the genus, and concluded it is monotypic, with H. magalhaensi Kinberg, 1856, as its type species. They did not provide an emended diagnosis but after their key, the diagnostic features would include body short, with up to 50 segments, prostomium without cephalic peaks, anterior eyes towards anterior margin (after figure), notochaetae with blunt tips, and neurochaetae denticulate, without semilunar pockets.
Hartman (1938) studied the holotype of Lagisca crassa and although she hesitated about its placement in Eunoe Malmgren, 1865, she completed the original description, corrected some details and included illustrations for the prostomium, 1 parapodium, and tips of 1 notochaeta and 2 neurochaetae. The prostomium has the anterior eyes ventral, under anterior prostomial margin, and chaetae were depicted with better definition of their fine details; she also indicated that palps, antennae and dorsal cirri were smooth, and that aciculae are exposed. Later, Hartman (1956, 1959) listed Treadwell’s species in Eunoe and hence confirmed the new combination.
Rozbaczylo (1985) noted that 3 species of Eunoe had been recorded for Chile: E. crassa (Treadwell, 1924), E. opalina M’Intosh, 1885, and E. rhizoicola Hartmann-Schröder, 1962. However, regarding E. crassa, after the original description, the species has been listed for Chile by Wesenberg-Lund (1962) but no additional specimens have been found.
On the other hand, Hermadion magalhaensi has more records for Chile, but only the original description (and the one for its junior synonym H. longicirratus Kinberg, 1856, plus 2 figures by Fauvel [1916]) has been illustrated, with all other records only listing the species in several Chilean localities from the intertidal to 200 m water depth (Rozbaczylo, 1985).
In this contribution, we document the discovery of some specimens of Eunoe crassa (Treadwell, 1924), collected in the type locality, and deposited in the University of Miami Voss Museum of Marine Invertebrates collection. Because the specimens are well-preserved, some remarks are introduced in the diagnosis of the involved genera, and the diagnostic features are clarified, explained, and accompanied by some illustrations. We also conclude, after the study of the holotype of E. crassa, that it is a junior synonym of H. magalhaensi.
Materials and methods
During part of the cruise 23 of the USNS Eltanin, some specimens were collected in Punta Arenas, Chile. They were deposited in the University of Miami Voss Museum of Marine Invertebrates (UMML). Additional specimens for comparison of H. magalhaensi (USNM 57798) and the holotype of L. crassa Treadwell, 1924 (USNM 19101) were examined at the National Museum of Natural History, Smithsonian Institution.
Specimens were observed with stereomicroscopes. Some detached elytra, parapodia and chaetae were observed in compound microscopes. Digital photos were stacked with HeliconFocus8, and plates were prepared with PaintShopPro and Photoshop CS.
Diagnosis (slightly modified after Barnich and Fiege [2010]). Body depressed, short, with up to 50 segments; dorsum more or less covered by elytra or short posterior region uncovered. Fifteen pairs of elytra on segments 2, 4, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 26, 29, and 32. Prostomium with or without distinct cephalic peaks and 3 antennae; lateral antennae inserted ventrally to median antenna. Anterior pair of eyes dorsolateral at widest part of prostomium, posterior pair dorsal near hind margin. Parapodia with elongate acicular lobes with both aciculae with tips exposed; neuropodia with a supra-acicular process. Notochaetae stout with distinct rows of spines, tips blunt. Neurochaetae more numerous and thinner, with distinct rows of spines distally and exclusively unidentate tips.
Remarks
Eunoe Malmgren, 1865 includes 46 species-group names distributed along all oceans from the intertidal to abyssal depths (Read & Fauchald, 2024). Malmgren (1865) included a key to genera and the diagnostic features for Eunoe were 15 pairs of elytra, covering dorsum, less than 45 segments; lateral antennae subventral; notochaetae with transverse rows of spines; neurochaetae unidentate with tips falcate, thinner than notochaetae. The same features were completed for the diagnosis (Malmgren, 1865).
There are no keys for identifying all Eunoe species. Species have been sorted out after the position of the anterior eyes (under anterior margin vs. median prostomial area), palp surface (papillose vs. spinulose), elytral features (pigmentation, fimbriae, macrotubercles), tips of notochaetae (tapered, mucronate, elongate), tips of neurochaetae (acute, swollen), and size or extent of subdistal denticulate region (short or long). Jimi et al. (2021) described a dimorphic species, and noted that after some molecular indicators, 2 groups of species can be recognized in Eunoe.
Malmgren (1865) included 2 species in Eunoe: E. oerstedi (Fig. 3A-D, in his plate 8), a replacement name for Lepidonote (sic) scabra Örsted, 1843, and the new combination of E. nodosa (Sars, 1861) for Polynoe nodosa Sars, 1861 (Fig. 4A-D in his plate 8). The main difference between these 2 species is the type of macrotubercles because in E. nodosa they have granulose tips, whereas they are spiny in E. oerstedi. On the other hand, the replacement name, E. oerstedi was unnecessary because there was no homonymy (ICZN, 1999, Art. 52.2) or matching combinations, but it has become accepted in recent publications and redescriptions (Barnich & Fiege, 2010; Pettibone, 1954, 1963).
The generic diagnosis included above indicates that prostomium has or lacks cephalic peaks. The type species, E. nodosa (Sars, 1861) has cephalic peaks “rather inconspicuous” (Barnich & Fiege, 2010).
On the other hand, the above diagnosis, slightly modified after Barnich and Fiege (2010), leaves out the species with eyes present towards the anterior prostomial region, as in E. crassa (Treadwell, 1924), not along the widest prostomial area. Other species having anterior eyes displaced anteriorly include E. alvinella Pettibone, 1989; E. barbata Moore, 1910; E. clarki Pettibone, 1951; E. hubrechti (McIntosh, 1900); E. papillosa Amaral & Nonato, 1982; E. rhizoicola Hartmann-Schröder, 1962; E. senta (Moore, 1902); E. spinosa Imajima, 1997 and E.subtruncata Annenkova, 1937. Further, the only species having anterior eyes displaced anteriorly and directed ventrally are E. barbata, E. clarki, E. rhizoicola, E. senta, and E. spinicirris. Another alternative, which should be based upon the study of type materials, would be to transfer these species to Hermadion, but this is beyond our current objectives.
The study of the type material of Lagisca crassa Treadwell, 1924 allowed us to conclude it belongs in Hermadion, and that it is a junior synonym of H. magalhaensi Kinberg, 1856, as redescribed elsewhere (Bock et al., 2010).
Type species. Hermadion magalhaensi Kinberg, 1856 by subsequent designation (Hartman, 1959: 79).
Diagnosis. Body depressed, short, with up to 50 segments, posterior region without elytra. Fifteen pairs of elytra on segments 2, 4, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 26, 29, and 32. Prostomium without cephalic peaks, and 3 antennae, lateral antennae inserted ventrally to median one. Anterior pair of eyes ventrolateral, posterior pair towards hind margin. Parapodia with elongate acicular lobes with acicular tips exposed; neuropodia without supracicular process. Notochaetae stout with distinct rows of spines, tips blunt. Neurochaetae thinner, with distinct rows of spines distally and only unidentate tips.
Remarks
Hermadion Kinberg, 1856 is currently regarded as a monotypic genus (Bock et al., 2010). If the species listed above become regarded as members of Hermadion, then the potential diagnostic features would be centered in papillation of dorsal cirri and elytral ornamentation (fimbriae, and macro- and microtubercles); however, as indicated above, revising these species is beyond our current objectives.
Diagnosis. Hermadion with elytra without fimbriae, surface covered by short microtubercles, round and elongate spine-like; dorsal cirri with small papillae, tips mucronate, smooth.
Additional material. Punta Arenas, Chile. Four specimens (UMML), USNS Eltanin, Cruise 23, Sta. P4-3 (53°11’ S, 70°50’ W), shore collection, by hand, 0.8-1.6 km south of commercial pier, 30 Mar. 1966, fixed in isopropyl alcohol, McSween, coll. 11 specimens (USNM 57798), Cobble Beach, Magellanes, 6 May 1965, J. Mohr, coll.
Holotype of Lagisca crassa. The holotype (USNM 19101) is posteriorly incomplete, 7.3 mm long, 2.4 mm wide, 32 segments (Fig. 1A, C). Most elytra, cephalic appendages and dorsal cirri detached, some parapodia previously dissected, pharynx everted.
Figure 1. Hermadion magalhaensi Kinberg, 1856. Holotype of Lagisca crassa Treadwell, 1924 (USNM 19101). A, Whole specimen, dorsal view; B, C, elytra from anterior segments, seen from above; D, right cirrigerous chaetiger from middle segment, posterior view; E, right elytrigerous segment from middle segment, anterior view; F, anterior end, dorsal view; G, same, ventral view; H, I, notochaetae from middle segment; J, K, tips of same; L, M, supra-acicular neurochaetae from middle segment; N, O, sub-acicular neurochaetae from middle segment; P, tip of supra-acicular neurochaeta; Q, tip of sub-acicular neurochaeta. Scale bars: A, 5 mm; B-E, 1 mm; F, G, 2 mm; H, I, L-O, 0.1 mm; J, K, P, Q, 50 μm.
Prostomium longer than wide (Fig. 4F); eyes almost faded out, anterior eyes anteroventral (Fig. 1F). Ceratophore of median antenna with a V-shaped depression; ceratostyle missing. Lateral antenna ventral, ceratophores about half as wide as median one; ceratostyles 1.5x longer than ceratophores (Fig. 1F). Palps lost.
Tentacular cirri with chaetae; cirrostyles distally incomplete, slightly longer than cirrophores (Fig. 1F). Facial tubercle not visible dorsally.
Pharynx fully exposed (Fig. 1F, G); no pigments observed, slightly expanded distally; 9 pairs of marginal papillae. Jaws dark brown (Fig. 1G), blunt tips, without accessory denticles.
Elytra pale, non-fimbriate (Fig. 1B, C), with eccentric insertions. Surface almost fully covered with microtubercles; microtubercles rounded, rod-like, or distally truncate.
Parapodia biramous from segment 2. Few dorsal cirri remain attached, all without tips (Fig. 1D). Both notacicular and neuracicular lobes projected, tips of aciculae exposed (Fig. 1D, E). Ventral cirri tapered, reaching base of neuracicular lobe (Fig. 1D, E). Nephridial lobes blunt, present from segment 9 throughout body.
Notochaetae light brown, of different sizes (Fig. 1H, I), each blunt, with series of denticles, margin finely spinulose, tips delicately bent, entire (Fig. 1J, K). Neurochaetae light brown to transparent, subdistally expanded (Fig. 1L-O), with rows of denticles leaving tip smooth (Fig. 1P, Q); tip falcate, unidentate (Fig. 1P, Q).
Posterior end lost (Fig. 1A).
Additional material. The UMML and some USNM specimens were complete, body wall brittle, most elytra detached, some cephalic appendages and dorsal cirri lost, some with some portions removed likely after predatory attacks, especially along anterior region including right parapodia (Fig. 2), or right lateral antenna (Fig. 3B). Some specimens bent laterally, others bent ventrally, 2 with pharynx exposed. Body 35-47 mm long, 9-17 mm wide, 43-47 segments. Elytra overlapping laterally leaving middorsal area exposed in some specimens (Fig. 2A), fully covering it in others (Fig. 4A, B).
Figure 2. Hermadion magalhaensi Kinberg, 1856, topotype specimen (UMML). A, Anterior región, dorsal view; B, anterior end, dorsal view; C, right elytron 6, seen from above (1-4: sections enlarged in C1-C4); D, chaetiger 18, right parapodium, anterior view (NeA, neuracicular lobe); E, same, posterior view (inset: dorsal cirrus; NoA, notacicular lobe); F, tips of notochaetae; G, tips of neurochaetae. Scale bars: A, 2.1 mm; B, 0.6 mm; C, 1.1 mm; D, E, 1 mm; F, G, 180 µm.
Prostomium longer than wide. Eyes black, anterior eyes ventrolateral, not visible dorsally (Fig. 2B), better perceived in frontal view (Fig. 3A, B). Antennae and cirri cylindrical, tips mucronate, blunt. Median antenna with ceratophore forming a V-shaped depression, about 4 times wider than ceratostyle, ceratostyle about as long as prostomium. Lateral antennae ventral, ceratophores about half as wide as median one; ceratostyles lost. Palps thick, short, about as long as median antennae, finely papillate, but papillae not arranged in rows.
Tentacular cirri with cirrophores fused, with chaetae exposed; cirrostyles cylindrical mucronate. Facial tubercle pale, not visible dorsally, better defined after pharynx is exposed.
Elytra barely pigmented, non-fimbriate (Figs 2C, 4D), with variable amount of sediment particles. Surface covered by abundant microtubercles (Fig. 4D), small globular along anterior regions (Fig. 3C1, 2), progressively longer along posterior region, projected beyond elytral margin (Figs. 3C3, 4; 4E). Other specimens with a diffuse spot surrounding central area. Insertion area eccentric, displaced anteriorly and laterally, to the right in right elytra, to the left in left ones.
Figure 3. Hermadion magalhaensi Kinberg, 1856, topotype specimen (UMML). A, Anterior región and pharynx, dorsal view; B, anterior end, frontal view; C, pharynx opening, frontal view (Pa, papilla). Scale bars: A, 1 mm; B, 0.6 mm; C, 0.9 mm.
Parapodia biramous from segment 2. Dorsal cirri finely papillate, papillae not arranged in rows, tip smooth. Notopodia with dorsal cirri cylindrical, tip mucronate (Fig. 2D, E). Notacicular lobe projected, aciculae exposed (Fig. 4F, G). Neuropodia with neuropodial lobe projected, rarely with a long prechaetal subacicular lobe (Fig. 4G). Neuracicular lobe projected, aciculae exposed (Fig. 4F, G). Ventral cirri tapered, short, reaching base of neuracicular lobe. Nephridial lobes blunt, short, present from chaetiger 8-9, continued along body.
Notochaetae dark brown, abundant, roughly verticillate, each blunt, with series of denticles, margin finely spinulose, tips delicately bent, entire (Figs. 2F; 4H, I). Neurochaetae brownish, subdistally expanded, with rows of denticles leaving tip smooth; tip falcate, unidentate (Figs. 2G; 4J-M).
The pharynx is fully exposed; it is 9 mm long in a 46 mm long specimen (Fig. 3A). The outer surface looks maculate but the spots correspond with adsorbed crystals on the surface. The pharynx tube is slightly expanded distally, its margins are eroded and only the lateral papillae are left after erosion of most marginal integument (Fig. 3C); it was described with 9 pairs of marginal papillae. Jaws dark brown, tips blunt, without accessory denticles (Fig. 3C).
Posterior end tapered (Fig. 4C); pygidium with anus terminal; anal cirri short, resembling dorsal cirri.
Remarks
Hermadion magalhaensi Kinberg, 1856 and H. longicirratus Kinberg, 1856 were both described from the same locality and depth in Saint York Bay, Magellan Strait. The main differences between these species were that H. magalhaensi has smooth elytra, and smooth notochaetae, whereas H. longicirratus has elytra minutely tuberculate and spiny notochaetae; the former species was based on a 52 mm long specimen, whereas the latter on a 14 mm long specimen. The size difference might explain some features present in the smaller specimen and lost after abrasion in the larger specimen. However, the microtubercles in elytra might accumulate sediment and look smooth if they are not carefully cleaned. Fauvel (1916: 425) studied several specimens of different size and concluded H. magalhaensi and H. longicirratus were the same species.
Figure 4. Hermadion magalhaensi Kinberg, 1856, topotype specimen (USNM 57798). A, Whole specimen, dorsal view; B, anterior end, dorsal view; C, posterior end, dorsal view; D, right elytron from middle segment, seen from above; E, microtubercles from elytral margin; F, right cirrigerous chaetiger from middle segment, anterior view; G, right elytrigerous chaetiger from middle segment, anterior view; H, I, tips of notochaetae from middle segment; J, K, tips of supra-acicular neurochaetae from middle segment; L, M, tips of sub-acicular neurochaetae from middle segment. Scale bars: A, 3 mm; B, C, 1 mm; D, F, G, 0.5 mm; E, 0.1 mm; H-M, 50 μm.
Treadwell (1924) described Lagisca crassa from Punta Arenas, Chile based on an incomplete specimen, without most of its elytra, and included figures for the anterior end, 1 cirrigerous parapodium, and tips of 1 notochaetae (tapered), and 1 neurochaetae (unidentate), but no elytra were illustrated. Ceratostyles of antennae and dorsal cirrostyles were shown with a subdistal brown ring but were not subdistally expanded. The median antenna is longer than laterals, its base marks a deep V-shaped depression over prostomium, and the parapodium shows acicular lobes projected, but tips of aciculae were not emergent. The pharynx was indicated as having 9 pairs of marginal papillae, but no details of the jaws were provided.
On the other hand, what has been regarded as E. crassa and E. rhizoicola Hartmann-Schröder, 1962 are the 2 only species described and recorded from shallow water depths in Chile. The latter species was also described from Punta Arenas, with a 21 mm long specimen. These 2 species are very similar by having anterior eyes displaced anteriorly, similar types of noto- and neurochaetae, and dorsal cirri with black bands. They differ because in E. crassa the dorsal cirri have a single subdistal black band, against 2 in E. rhizoicola, and its tip is short, whereas it is longer in E. rhizoicola. The main difference is in the presence of fimbriae; there are no fimbriae in E. crassa, whereas E. rhizoicola has some short filaments along posterior margins. It is likely that E. rhizoicola is another junior synonym of H. magalhaensi because it resembles H. longicirratus in having longer dorsal cirri, but this might be a size dependent feature, becoming relatively shorter in larger specimens. Further, H. magalhaensi has been found living in Macrocystis rhizoids (Pratt, 1901), which was the habitat also for E. rhizoicola.
We think that the main reason for the confusion regarding the affinities between what was described as L. crassa and H. magalhaensi is because there were only 1 set of illustrations of the species (Kinberg, 1858), and since during many years, the proposals for new records or new species did not include the study of type or topotype specimens (Fauchald, 1989).
Distribution. Originally described from Puntarenas, Chile, in shallow depths (0-200 m), it ranges along subantarctic localities including the Falkland and Kerguelen Islands.
Acknowledgments
Geoff Read, Igor Jirkov and Oscar Díaz-Díaz kindly provided useful publications. William Moser found some additional field data for the Eltanin station where the specimens were found. Stéhane Hourdez and an anonymous referee carefully read this contribution and suggested several important modifications. The technical editorial issues were masterfully made by María Antonieta Arizmendi.
References
Amaral, A. C., & Nonato, E. F. (1982). Anelideos poliquetos da costa brasileira, 3. Aphroditidae e Polynoidae. Brazilia, Conselho Nacional de Desenvolvimento Científico e Tecnológico.
Annenkova, N. P. (1937). Fauna Polychaeta severnoii chasti Yaponskogo Morya. Issledovaniya Morei SSSR, 23, 139–216.
Augener, H. (1932). Antarktische und Antiboreale Polychaeten nebst einer Hirudinee. Scientific Results of the Norwegian Antarctic Expeditions 1927-1928 et sqq., instituted and financed by Consul Lars Christensen, 9, 1–85.
Averintsev, V. G. (1972). Donnye mnogotchetinkovye chervi Errantia Antarktiki i Subantarktiki no materialam sovetskoi Antarktitcheskoi Exspeditsii. Issledovaniya Fauny Morei, 11(19). Resul’taty biologicheskikh issledovanii Sovetskikh Antarktitseskikh Exspeditsii, 5, 85–293.
Baird, W. (1865). Contributions towards a monograph of the species of Annelides belonging to the Aphroditacea, containg a list of the known species, and a description of some new species contained in the National Collection of the British Museum. Journal of the Linnean Society, Zoology, 8, 172–202. https://doi.org/10.1111/j.1096-3642.1865.tb02438.x
Barnich, R., & Fiege, D. (2003). The Aphroditoidea (Annelida: Polychaeta) of the Mediterranean Sea. Abhandlungen der Senckenbergischen Naturforschenden Gesellschaft Frankfurt am Main, 559, 1–167.
Barnich, R., & Fiege, D. (2009). Revision of the genus Harmothoe Kinberg, 1856 (Polychaeta: Polynoidae) in the Northeast Atlantic. Zootaxa, 2104, 1–76. https://doi.org/10.11646/zoo taxa.2104.1.1
Barnich, R., & Fiege, D. (2010). On the distinction of Harmothoe globifera (G.O. Sars, 1873) and some other easily confused polynoids in the NE Atlantic, with the description of a new species of Acanthicolepis Norman in McIntosh, 1900 (Polychaeta, Polynoidae). Zootaxa, 2525, 1–18. https://doi.org/10.11646/zootaxa.2525.1.1
Barnich, R., Fiege, D., Micaletto, G., & Gambi, M. C. (2006). Redescription of Harmothoe spinosa Kinberg, 1856 (Polychaeta: Polynoidae) and related species from Subantarctic and Antarctic Waters, with the erection of a new genus. Journal of Natural History, 40, 33–75. https://doi.org/10.1080/00222930500445044
Bock, G., Fiege, D., & Barnich, R. (2010). Revision of Hermadion Kinberg, 1856, with a redescription of Hermadion magalhaensi Kinberg, 1856, Adyte hialina (G.O. Sars, 1873) n. comb., and Neopolynoe acanellae (Verrill, 1881) n. comb. (Polychaeta: Polynoidae). Zootaxa, 2554, 45–61. https://doi.org/10.11646/zootaxa.2554.1.4
Dales, R. P. (1962). The polychaete stomodeum and the inter-relationships of the families of Polychaeta. Proceedings of the Zoological Society of London, 139, 389–428. https://doi.org/10.1111/j.1469-7998.1962.tb01837.x
Ehlers, E. (1897). Hamburger Magalhaensischen Sammelreise 1892/93 3(Bryozoen und Würmer). Polychaeten. Hamburg: Friederichsen & Co.
Fauchald, K. (1977). The polychaete worms: definitions and keys to the orders, families and genera. Natural History Museum of Los Angeles County, Science Series, 28, 1–188.
Fauchald, K. (1989). The second annual Riser lecture: eclecticism and the study of polychaetes. Proceedings of the Biological Society of Washington, 102, 742–752.
Fauvel, P. (1916). Annélides polychètes des Iles Falkland recueillies par M. Rupert Vallentin Esq (1902-1910). Archives de Zoologie Expérimentale et Générale, 55, 417–482. https://doi.org/10.5962/bhl.part.11511
Fauvel, P. (1923). Polychètes errantes. Faune de France, 5,1–488.
Gravier, C. (1911). Deuxième Expédition Antarctique Française (1908-1910), commandé par le Dr. Jean Charcot. Annélides polychètes. Paris: Masson et Cie.
Hartman, O. (1938). The types of the polychaete worms of the families Polynoidae and Polyodontidae in the United States National Museum and the description of a new genus. Proceedings of the United States National Museum, 86, 3046, 107–134. https://doi.org/10.5479/si.00963801.86-3046.107
Hartman, O. (1956). Polychaetous annelids erected by Treadwell, 1891 to 1948, together with a brief chronology. Bulletin of the American Museum of Natural History, 109, 239–310.
Hartman, O. (1959). Catalogue of the polychaetous annelids of the World. Allan Hancock Foundation Publications, Occasional Paper, 23, 1–628.
Hartman, O. (1964). Polychaeta Errantia of Antarctica. Antarctic Research Series, 3, 1–131. https://doi.org/10.1029/ar003
Hartmann-Schröder, G. (1962). Zur Kenntnis des Eulitorals der chilenischen Pazifikküste und der argentinischen Küste Südpatagoniens unter besonderer Berücksichtigung der Polychaeten und Ostracoden. Die Polychaeten des Eulitorals. Mitteilungen aus dem Hamburgischen Zoologischen Museum und Institut, 60, 57–270.
Imajima, M. (1997). Polychaetous annelids from Sagami Bay and Sagami Sea collected by the Emperor Showa of Japan and deposited at the Showa Memorial Institute, National Science Museum, Tokyo. Families Polynoidae and Acoetidae. National Science Museum Monographs, 13,1–131.
ICZN (International Commission of Zoological Nomenclature). (1999). International Code of Zoological Nomenclature. London, Natural History Museum. Available at: www.code.iczn.org
Jimi, N., Hookabe, N., Moritaki, T., Kimura, T., & Imura, S. (2021). First evidence of male dwarfism in scale worms: A new species of Polynoidae (Annelida) from hermit crab and molluscan shells. Journal of Zoological Systematics and Evolutionary Research, 59,801–818. https://doi.org/10.1111/jzs.12463
Jirkov, I. A. (2001). Polikhety Severnogo Ledovitogo Okeana. Tromsø, Akvaplan-Niva.
Kinberg, J. G. H. (1856). Nya slägten och arter af Annelider. Öfversigt af Kongliga Vetenskaps-Akademiens Förhhandlingar Stockholm, 12, 381–388.
Kinberg, J. G. H. (1858). Kongliga Svenska Fregatten Eugenies resa Omkring Jorden under befäl af C.A. Virgin, Ånen 1851-1853, Vetenskapliga Iakttagelser, Zoologi, 3. Annulater. Stockholm.
Levinsen, G. M. R. (1883). Systematisk-geografisk Oversigt over de nordiske Annulata, Gephyrea, Chaetognathi og Balanoglossi. Videnskabelige Meddelelser fra Dansk naturhistorisk Forening i Kjøbenhavn, 1882, 160–251. https://doi.org/10.5962/bhl.title.16117
Malmgren, A. J. (1865). Nordiska Hafs-Annulater. Öfversigt af Kongl. Vetenskaps-Akademiens Förhandlingar, 22,51–110,
M’Intosh, W. C. (1885). Report on the Annelida Polychaeta collected by H.M.S. Challenger during the years 1873-1876. Reports on the Scientific Results of the Voyage of H.M.S. Challenger during the years 1873–76, Zoology, 12,i-xxxvi.
McIntosh, W. C. (1900). A monograph of British Annelids, 1(2) Polychaeta Amphinomidae to Sigalionidae. London: Ray Society of London.
Moore, J. P. (1902). Descriptions of some new Polynoidae, with a list of other Polychaeta from North Greenland waters. Proceedings of the Academy of Natural Sciences of Philadelphia, 54, 258–278.
Moore, J. P. (1910). The polychaetous annelids dredged by the U.S.S. “Albatross” off the coast of Southern California in 1904: 2. Polynoidae, Aphroditidae and Segalionidae (sic). Proceedings of the Academy of Natural Sciences of Philadelphia, 62, 328–402.
Örsted, A. S. (1843). Grönlands Annulata dorsibranchiata. Det Kongelige Danske videnskabernes selskabs. Naturviden- skabelige og Mathematiske Afhandlinger, 10, 153–216.
Pamungkas, J., Glasby, C. J., Read, G. B., Wilson, S. P., & Costello, M. J. (2019). Progress and perspectives in the discovery of polychaete worms (Annelida) of the world. Helgolander Marine Research, 73, 4. https://doi.org/10.1186/s10152-019-0524-z
Pettibone, M. H. (1951). A new species of polychaete worm of the family Polynoidae from Point Barrow, Alaska. Journal of the Washington Academy of Sciences, 41,44–45.
Pettibone, M. H. (1954). Marine polychaete worms from Point Barrow, Alaska, with additional records from the North Atlantic and North Pacific. Proceedings of the United States National Museum, 103, 203–356. https://doi.org/10.5479/si.00963801.103-3324.203
Pettibone, M. H. (1963). Marine polychaete worms of the New England región, 1. Families Aphroditidae through Trochochaetidae. Bulletin, United States National Museum, 227, 1–356. https://doi.org/10.5479/si.03629236.227.1
Pettibone, M. H. (1989). Two new species of Harmothoinae (Polychaeta: Polynoidae) from the East Pacific Rise, collected by Alvin dives 2000 and 2003. Proceedings of the Biological Society of Washington, 102,305–310.
Pratt, E. M. (1901). A collection of Polychaeta from the Falkland Islands. Manchester Memoirs, Memoirs and Proceeding of the Manchester Literary & Philosophical Society, 45, 1–18.
Rozbaczylo, N. (1985). Los anélidos poliquetos de Chile: Índice sinonímico y distribución geográfica de especies. Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile, Monografías Biológicas, 3, 1–284.
Sars, M. (1861). Om de ved Norges Kyster forekommende Arter af Annelideslaegten Polynoë. Forhandlinger i Videnskabs-Selskabet i Christiania, 1860, 54–62.
Uschakov, P. V. (1965). Polychaeta of the Far Eastern Seas of the U.S.S.R. Zoological Institute of the Russian Academy of Sciences, Keys to the Fauna of the U.S.S.R., 56, 1–419.
Wehe, T. (2006). Revision of the scale worms (Polychaeta: Aphroditoidea) occurring in the seas surrounding the Arabian Peninsula, 1. Polynoidae. Fauna of Arabia, 22, 23–197.
Wesenberg-Lund, E. (1962). Reports of the Lund University Chile Expedition 1948-49, 43. Polychaeta Errantia. Lunds Universitets Årsskrift, neue folge, Series 2, 57, 1–139.
