Marzo-2017-prueba

Edmundo González-Santillán ^a, Laura L. Valdez-Velázquez ^b, *, Ofelia Delgado-Hernández ^c, Jimena I. Cid-Uribe ^d, María Teresa Romero-Gutiérrez ^e, Lourival D. Possani ^d 

^a Universidad Nacional Autónoma de México, Instituto de Biología, Departamento de Zoología, Colección Nacional de Arácnidos, Tercer Circuito Exterior s/n, Ciudad Universitaria, Coyoacán, 04510 Ciudad de México, Mexico

^b Universidad de Colima, Facultad de Ciencias Químicas y Facultad de Medicina, Km 9 Carretera Colima-Coquimatlán, 28400 Coquimatlán, Colima, Mexico 

^c Instituto Francisco Possenti, Av. Toluca 621, Olivar de los Padres, Álvaro Obregón, 01780 Mexico City, Mexico

^d Universidad Nacional Autónoma de México, Instituto de Biotecnología, Avenida Universidad 2001, Colonia Chamilpa, 62210 Cuernavaca, Morelos, Mexico 

^e Universidad de Guadalajara, Centro Universitario Tlajomulco, Departamento de Innovación Tecnológica, Carretera Tlajomulco – Santa Fé Km. 3.5 No.595 Lomas de Tejeda, 45641 Tlajomulco de Zúñiga, Jalisco, Mexico

*Corresponding author: lauravaldez@ucol.mx (L.L. Valdez-Velázquez)

Received: 9 October 2023; accepted: 19 March 2024

Abstract

Scorpion species diversity in Colima was investigated with a multigene approach. Fieldwork produced 34 lots of scorpions that were analyzed with 12S rDNA, 16S rDNA, COI, and 28S rDNA genetic markers. Our results confirmed prior phylogenetic results recovering the monophyly of the families Buthidae and Vaejovidae, some species groups, and genera. We recorded 11 described species of scorpions and found 3 putatively undescribed species of Centruroides, 1 of Mesomexovis, and 1 of Vaejovis. Furthermore, we obtained evidence that Centruroides elegans, C. infamatus,and C. limpidus do not occur in Colima, contrary to prior reports. Seven genetically different and medically relevant species of Centruroides for Colima are recorded for the first time. We used the InDRE database (Instituto de Diagnóstico y Referencia Epidemiológicos), which contains georeferenced points of scorpions, to estimate the distribution of the scorpion species found in our fieldwork. Finally, we discuss from a biogeographical, ecological, and medical point of view the presence and origin of the 14 scorpion species found in Colima.

Keywords: Barcoding; Holotype; Medical relevance; Microendemic; New species; Species group; Substrate-specialist

© 2024 Universidad Nacional Autónoma de México, Instituto de Biología. Este es un artículo Open Access bajo la licencia CC BY-NC-ND

(http://creativecommons.org/licenses/by-nc-nd/4.0/).

Una aproximación multigenes para identificar a las especies de alacranes (Arachnida: Scorpiones) de Colima, México, con cometarios sobre la diversidad de sus venenos

Resumen

La diversidad de especies de alacranes de Colima se investigó utilizando una aproximación multigenes. Del trabajo de campo se obtuvieron 34 lotes de alacranes que fueron analizados con los marcadores 12S rDNA, 16S rDNA, COI, y 28S rDNA. La comparación con trabajos de filogenia previos nos permitió confirmar la monofilia de las familias Buthidae y Vaejovidae, de algunos grupos de especies y géneros. Encontramos 11 especies de alacranes descritas, 3 putativamente nuevas de Centruroides, 1 de Mesomexovis y 1 de Vaejovis. También obtuvimos evidencia de que Centruroides elegans, C. infamatus y C. limpidus no están distribuidos en Colima, como se registró en trabajos anteriores. Reportamos 7 especies genéticamente distintas y de importancia médica para Colima. Usamos la base de datos del InDRE (Instituto de Diagnóstico y Referencia Epidemiológicos) que contiene puntos georreferenciados de alacranes para estimar la distribución de las especies que recolectamos en el campo. Finalmente, discutimos desde una perspectiva biogeográfica, ecológica y de importancia médica las 14 especies de alacranes que reportamos para Colima. 

Palabras clave: Código de barras; Holotipo; Importancia médica; Microendémico; Especie nueva; Grupo de especies; Sustrato-especialista

Introduction

The knowledge of scorpion diversity in North America has improved recently (González-Santillán & Prendini, 2013; Goodman, Prendini, Francke et al., 2021; Ponce-Saavedra & Francke, 2019; Santibáñez-López et al., 2014); however, much remains to be discovered. Local-scale inventories may be a solution to unveil species communities that, in turn, can help conform regional faunas. This approach has rarely been applied to study scorpion diversity. Furthermore, few local faunal studies have been conducted in Mexico, and only a handful of them have been published; other revisionary contributions included limited fieldwork effort (Baldazo-Monsivais et al., 2012, 2016, 2017).

The International Barcode of Life (iBOL) has grown as a powerful tool for discovering biodiversity, among other applications (https://ibol.org). Scorpion barcoding studies have permitted the identification and delimitation of species in several regions of the world (Fet et al., 2014, 2016; Goodman, Prendini, & Esposito, 2021; Podnar et al., 2021). Despite the high diversity of scorpions in Mexico —an update by Ponce-Saavedra et al. (2023) comprises 311 scorpion species— only 1 mini-barcoding study has been conducted (Goodman, Prendini, & Esposito, 2021). Herein, we present a second scorpion barcoding study for this country but aim at discovering the components of a local scorpion assembly. Colima exhibits a complex topology comprising littorals with a tropical climate and extreme topological variation from sea level to mountain ranges rising to over 4,000 m in approximately 5,600 km². Colima’s territory supports a rich local flora and fauna (Ramírez-Ruiz & Bretón-González, 2016). Colima lies between the limits of the Nearctic and Neotropical biogeographical Realms (Fig. 1B). Beyond its complexity, Colima represents an enclosed littoral surrounded by mountain ranges and 3 large rivers that divide the territory into 2 sections (Fig. 1), which makes it a well-defined and manageable geographical unit ideal for studying a unique community of scorpions. Thus far, 2 families, 3 subfamilies, 5 genera, and 12 species of scorpions have been identified in Colima (Table 1). The knowledge of scorpion diversity and evolutionary studies in Mexico has steadily been unveiling one of the vastest biodiversity hotspots in the world. For instance, 2 of the most diverse scorpion families and subfamilies, Vaejovidae (Syntropinae) and Buthidae (Centruroidinae), have been treated in recent phylogenetic and taxonomic analyses (Esposito & Prendini, 2019; González-Santillán & Prendini, 2013, 2015). 

This contribution aims to survey the scorpion richness in Colima, using not only the COI-barcoding genetic marker but 2 additional mitochondrial markers and 1 nuclear marker to establish a framework to build a stable and predictable taxonomy. Taking advantage of robust phylogenies produced for the 2 families distributed in Colima, we use these topologies as a baseline for comparison to test the presence of several previously reported species and to taxonomically circumscribe our fresh samples. Unlike other barcoding studies, our approach seeks to unveil the richness within the state instead of focusing on delimiting the species of a taxonomic group of scorpions.

Materials and methods 

We conducted field collections during May and September 2015-2018 in various ecosystems, including tropical deciduous forest, oak-pine, and tropical forest within the state of Colima, at elevations ranging from 47 to 2,200 m. (Table 2). Logistically, we leveraged our collection sites with the help of private landowners who gave us access to their property. Specimen collection methods included direct collection during the day by moving objects on the ground or by ultraviolet detection during the night. To preserve specimens, ethyl alcohol at 90% was used and stored at -80 °C. Each specimen lot carried a label with coordinates and locality information. We obtained scorpions from 14 localities and sequenced 18 samples of Centruroides from Colima (Table 2).

Table 1

List of families, subfamilies, genera, and species recorded in the state of Colima. *Species of Centruroides cited by Ponce-Saavedra et al. (2016). The species in bold font were not found in Colima in this study. Numbered species were reported by González-Santillán et al. (2019). 

Families	Subfamilies	Species
Buthidae	Centruroidinae	1. Centruroides elegans (Thorell, 1876)* 2. Centruroides hirsutipalpus Ponce-Saavedra & Francke, 2009* 3. Centruroides infamatus (C.L. Koch, 1844)* Centruroides limpidus (Karsch, 1879)* Centruroides ornatus Pocock, 1902 4. Centruroides tecomanus1 Hoffmann, 1932* 5. Centruroides possanii González-Santillán, Galán-Sánchez & Valdez-Velázquez Centruroides new sp 1 Centruroides new sp 2 Centruroides tecomanus 2
Vaejovidae	Syntropinae	6. Konetontli ilitchi González-Santillán & Prendini, 2015 7. Thorellius cristimanus (Pocock, 1898) 8. Thorellius intrepidus (Thorell, 1876) 9. Mesomexovis aff. occidentalis
		10. Vaejovis janssi Williams, 1980
	Vaejovinae	11. Vaejovis monticola Sissom, 1989  12. Vaejovis sp. mexicanus group

Figure 1. Map of the west coast of Mexico. A, Orographic and hydrographic elements of Colima (COL) and the surrounding states of Jalisco (JAL) and Michoacán (MIC). 1, Manantlán Sierra; 2, massive Cerro Grande; 3, Colima Volcano; 4, Marabasco or Cihuatlán River; 5, Armería River; 6, Coahuayana River. B, Biogeographical provinces (Morrone et al., 2017). Area within the green line corresponds to the Sierra Madre del Sur and north Colima Volcano Trans Mexican Volcanic Belt province (Morrone et al., 2017) —notice that both provinces are connected in Colima. Area outside the green line corresponds to the Pacific Lowlands province (Morrone et al., 2017). Orographic components are indicated in gray scale from light low elevation to dark high elevation.

Table 2

Collection sites of the scorpion species used in this study. The number within parenthesis after the species name is the number of samples processed from this locality and included in the phylogenetic analyses as terminals. Superscript numbers indicate sources of sequences as follows: ¹Bolaños et al. (2019), ²Esposito et al. (2018), ³Esposito and Prendini (2019), ⁴González-Santillán and Prendini (2015). Cells filled in grey color are samples obtained from GenBank.

Species	Municipality	Locality	Latitude	Longitude	Elevation
Thorellius cristimanus (2)	Comala	La Yerbabuena	19°27′59.55″	-103°41′46.64′′	1,358 m
Centruroides ornatus (2)	Comala	Agosto	19°23′51.74′′	-103°44′03.08′′	1,076 m
Thorellius cristimanus
*Centruroides tecomanus2	Colima	Comunidad La Capacha	19°04′58.40′′	-103°41′24.67′′	656 m
*Centruroides tecomanus2	Colima	Tepames	19°06′22.8′′	-103°59′11.07′′	450 m
Thorellius intrepidus (3)	Coquimatlán	El Palapo	19°11′54.6′′	-103°54′50′′	275 m
*Centruroides tecomanus2	Cuauhtémoc	Camino a Altozano	19°18′30.19′′	-103°40′23.83′′	789 m
Thorellius cristimanus
*Centruroides tecomanus1(2)	Cuauhtémoc	Ocotillo	19°20′00.00′′	-103°39′02.00′′	895 m
*Centruroides tecomanus2	Ixtlahuacán	San Gabriel	18°54′24.48′′	-103°44′05.61′′	462 m
Mesomexovis aff. occidentalis
Centruroides hirsutipalpus	Minatitlán	Minatitlán	19°23′01.73′′	-104°03′35.19′′	703 m
Centruroides possanii (2)	Minatitlán	Terrero	19°26′35.94′′	-103°57′05.67′′	2,200 m
Centruroides possanii (2)	Minatitlán	Mirador el Filete	19°26′40′′	-103°58′10′′	2,137 m
Vaejovis sp. (mexicanus group)
Centruroides sp. 2 (2)	Manzanillo	La central	19°08′38.14′′	-104°26′04.10′′	47 m
*Centruroides tecomanus1
*Centruroides tecomanus2
Centruroides sp. 1	Tecomán	Chanchopa	18°51′58.55′′	-103°44′10.10′′	41 m
Thorellius intrepidus (2)	Villa de Álvarez	Rancho Blanco	19°14′24.71′′	-103°45′49.45′′	455 m
Thorellius intrepidus4	La Huerta (Jal.)	Estación de Biología Chamela	19°30′14.15′′	-105°2′16.50′′	33 m
Centruroides elegans (2)
Centruroides suffusus	Durango (Dgo.)	El Salto, 50 km E Durango	23°45′51.41′′	-105°19′49.16′′	2,847 m
Centruroides limpidus	Iguala (Gro.)	Iguala	18°20′11.87′′	-99°29′29.65′′	823 m
Centruroides sculpturatus	Cumpas (Son.)	18 km NE de Nacozari	30°16.473′	-109°50.070′	930 m
Centruroides noxius	Pantanal (Nay.)	Pantanal	21°25′24.42′′	-104°50′47.89′′	921 m
Centruroides huichol	Nayarit	–	–	–	–
Centruroides infamatus115scrp	Guanajuato (Gto.)	Guanajuato	–	–	–
Centruroides ornatus2LP1822	Tandamangapio (Mich.)	Los Tabanos	19.9749°	– 102.84226°	223 m
Centruroides ornatus3 2003	Michoacán	–	–	–	–
*Centruroides tecomanus11 25scrp	Comala (Col.)	–	–	–	–
*Centruroides tecomanus12 2007	Michoacán	–	–	–	–
Mesomexovis occidentalis4 LP 7056	Acapulco (Gro.)	Cumbres de Llano Largo	16°49.505	-99°49.9990	317 m
Table 2. Continued
Species	Municipality	Locality	Latitude	Longitude	Elevation
Mesomexovis spadix4LP6373	León (Gto.)	San Antonio de Padua	20°34.5170	-100°57.217	–
Mesomexovis subcristatus4LP 2049	Tehuacán (Pue.)	Tehuacán, 2 km east	18°24.0020	-97°22.8670	1435 m
Thorellius cristimanus4LP 5325	Álvaro Obregón (Mich.)	Álvaro Obregón	19°02.3100	-102°58.405	462 m
Thorellius cristimanus4LP 6551	Coquimatlán (Col.)	Road to Coquimatlán, km 71	19°06.7750	-103°51.1850	336 m
Thorellius intrepidus4LP 6377	Comala (Col.)	Comala	19°19.000	-103°45.0000	–
Thorellius intrepidus4LP 6379	Colima (Col.)	Los Ortices	19°06.0468	-103°44.0226	343 m
Vaejovis carolinianus4LP 1576	South Carolina	–	–	–	–
Vaejovis pequeno4LP 6308	Soyopa (Son.)	Sierra El Encinal, 9 km from crossroad on Highway Mex 16 to El Encinal	28°35.4120	-109°27.1480	380 m
Vaejovis rossmani4LP 2027	Hidalgo (Tams.)	Conrado Castillo	23°56.01735	-99°28.04817	–

*Genetically differentiated species.

We also included 8 species from outside the state to test the presence of C. elegans, C. infamatus, and C. limpidus reported previously in the literature (Ponce-Saavedra et al., 2016); C. noxius and C. suffusus for comparative purposes and samples of C. tecomanus and C. ornatus from GenBank with a total of 31 specimens of the genus Centruroides within 4 species groups. Unlike buthids, we obtained 12 samples of vaejovids to include in this analysis. To evaluate the identity of vaejovids, we used the BLAST® suite (https://blast.ncbi.nlm.nih.gov/Blast.cgi) to search for similar sequences deposited in the nucleotide collection database at NCBI. Thorellius has been revised recently (González-Santillán & Prendini, 2018). Therefore, several DNA sequences are available, and fewer sequences of Mesomexovis sp. and Vaejovis sp. were available in GenBank, as they are still unrevised. Using the genetic markers as queries, we obtained 10 additional samples. The total number of taxonomic specimens used for these analyses was 53 (Tables 2, 4).

Genomic DNA was extracted from the legs or pedipalp of specimens using Qiagen Dneasy/trisol method Tissue Kits or a DNAzol Genomic DNA isolation Reagent kit (Molecular Research Center INC, Cincinnati, Oh). We amplified 3 mitochondrial markers, 12S rDNA, 16S rDNA, and the barcode COI, and the nuclear marker 28S rDNA. We performed the Polymerase Chain Reaction with the following thermal profile: an initial denaturation step (3 min at 94°C) followed by 35 cycles including denaturation at 94°C for 30 s, annealing (46-55°C) for 30 s, and extension at 72°C for 30 s, with a final extension step at 72°C for 7 min. The PCR reaction was conducted using PureTaq-Ready-To-Go PCR Beads (GE Healthcare), 2 µl of DNA template, 21 µl of DNA grade H₂O, and 1 µl of each direction primer listed in Table 3. We verified PCR products with a 1% agarose-TBE electrophoresis gel stained with CYBR Safe. For purification of the amplified products, we used Ampure Magnetic Beads (Beckman-Coulter) and re-suspended in 40 µl DNA grade water by using a Beckman Coulter Biomek NX 18 robot. Each 8 µl cycle-sequenced reaction mixture included 1 µl of Big Dye, 1 µl of Big Dye Terminating buffer, 1 µl of 3.2 pm primer, and 5 µl of gene amplification product. Cycle-sequenced products were purified with CleanSeq magnetic beads on a Biomex NX robot. Products were re-suspended in EDTA, and 33 µl were processed in an Applied Biosystems, Inc. Prism 3730xl automated DNA sequencer. These products were sequenced with the same primer pairs used for amplification at the Laboratorio de Secuenciación Genómica de la Biodiversidad, at Instituto de Biología and Unidad de Síntesis y Secuenciación de DNA, Instituto de Biotecnología, UNAM. The sequences were edited using Sequencher® version 5.4.6.

Table 3

List of primers used to amplify molecular markers.

Name	Sequence	Reference
12S rDNA
12SAI	AAACTAGGATTAGATACCCTATTAT	Kocher et al. (1989)
12SBI	AAGAGCGACGGGCGATGTGT	Kocher et al. (1989)
16S rDNA
16SA	CGCCTGTTTATCAAAAACAT	Simon et al. (1994)
16SB	CTCCGGTTTGAACTCAGATCA	Simon et al. (1994)
COI
HCO	TAAACTTCAGGGTGACCAAAAAATCA	Folmer et al. (1994)
LCO1	GGTCAACAAATCATAAAGATATTGG	Folmer et al. (1994)
28S rDNA
28SA	GACCCGTCTTGAAGCACG	Nunn et al. (1996)
28SBout	CCCACAGCGCCAGTTCTGCTTACC	Prendini et al. (2005)

Each genetic fragment was aligned separately for all terminals with MAFFT using the online server (https://mafft.cbrc.jp/alignment/server/). Since the number of nucleotides per gene was similar, we used the G-ins-i iterative refinement method, as recommended elsewhere (Katoh et al., 2019; Kuraku et al., 2013), and other parameters were kept default. To select the best fit of the substitution model per partition and conduct the phylogenetic analyses, we used IQ-TREE version 2 (Kalyaanamoorthy et al., 2017; Nguyen et al., 2015) and we estimated branch support with 1,000 replicates of the ultrafast bootstrap (UFBOOT) algorithm (Hoang et al., 2018). Furthermore, each genetic marker was analyzed individually to explore its phylogenetic signal and contribution to the final topology. We conducted concatenated and partitioned analyses, handling all matrices in Mesquite (Maddison & Maddison, 2023). For the COI partition we explored the best codon partition per site, but the results had no effect on the topology. Additionally, to evaluate each marker and nucleotide site within each marker, we calculated the gene (GCF) and site (SCF) concordance factors on the topology that we emphasized in the discussion (Mihn et al., 2020). 

Distributional records and maps. We obtained records with geographical coordinates of the scorpion species treated here via the Global Biodiversity Information Facility (GBIF) from the InDRE, responsible in Mexico for epidemiological vigilance (Huerta-Jiménez, 2018), and the records published by Ponce-Saavedra et al. (2015). These records were the basis for the species distribution maps depicted in figures 3 to 6. We used the program QGIS 3.16.6-Hannove (QGIS, 2021) to create the distributional maps. The topological model with the data was from Jarvis et al. (2008), and to draw the political boundaries we used shapefiles obtained from Conabio. The biogeographic regionalization of Mexico into provinces and districts follows Morrone et al. (2017) and Morrone (2019). 

Results

The gene fragments that we obtained are listed in Table 4 and the main statistics of the alignment and concatenated matrix are in Table 5. Our topology produced a clade representing members of the family Buthidae and another clade representing Vaejovidae (Fig. 2). Within buthids, the first clade included C. huichol and C. noxius, component species of the bertholdii species group (Ponce-Saavedra & Francke, 2019), supported by 95% UFBOOT, 100% GCF, and 40% SCF. The next clade included C. elegans, C. limpidus, and a putative undescribed species with lower support values of 68%, 100%, and 38%, respectively, including members of the elegans group. Although with low support, the bulk of species appeared in the third clade comprising species within the infamatus group, with C. tecomanus, C. infamatus, C. possanii, C. hirsuticauda, C. ornatus, and 2 putative new species. The last clade included C. suffusus and C. sculpturatus, whichPonce-Saavedra and Francke (2019) circumscribed within the infamatus and the elegans species group, respectively (Fig. 2). However, the overall topology retrieved herein is concordant with the North American clade of the genus Centruroides (Esposito & Prendini, 2019). 

Table 4

Mitochondrial genetic markers 16S, COI, and 12S and nuclear 28S information for samples analyzed in the study. Dash (-) symbols indicate unavailable sequences.

Species	NCBI:txid	16S	12S	COI	28S
Centruroides elegans	217897	Cele_30_16S (PP295377)	Cele_30_12S (PP295301)	Cele_30_COI (PP356615)	Cele_30_28S (PP295328)
		Cele_31_16S (PP295378)	Cele_31_12S (PP295302)	Cele_31_COI (PP355194)	Cele_31_28S (PP295329)
Table 4. Continued
Species	NCBI:txid	16S	12S	COI	28S
Centruroides hirsutipalpus	–	Chir_06_16S (PP295353)	Chir_06_12S (PP295277)	Chir_06_COI (PP356614)	Chir_06_28S (PP295310)
Centruroides huichol	2911785	Chui_38_16S (PP295385)	Chui_38_12S (PP295309)	Chui_38_COI (PP356613)	Chui_38_28S (PP295335)
Centruroides infamatus	42200	MF134694	–	MF134798	MF134763
Centruroides limpidus	29941	Clim_34_16S (PP295381)	Clim_34_12S (PP295305)	Clim_34_COI (PP356612)	Clim_34_28S (PP295332)
Centruroides noxius	6878	Cnox_36_16S (PP295383)	Cnox_36_12S (PP295307)	Cnox_36_COI (PP356611)	Cnox_36_28S (PP295333)
		Cnox_37_16S (PP295384)	Cnox_37_12S (PP295308)	Cnox_37_COI (PP356610)	Cnox_37_28S (PP295334)
Centruroides ornatus	2338500	Corn_03_16S (PP295350)	Corn_03_12S (PP295274)	Corn_03_COI (PP355195)	Corn_03_28S (PP295324)
		Corn_04_16S (PP295351)	Corn_04_12S (PP295275)	Corn_04_COI (PP356609)	Corn_04_28S (PP295325)
		KY981895	KY981799	–	KY982086
		MK479042	MK478991	MK479195	MK479144
Centruroides possanii	–	Cpos_10_16S (PP295357)	Cpos_10_12S (PP295281)	–	Cpos_10_28S (PP295314)
		Cpos_07_16S (PP295354)	Cpos_07_12S (PP295278)	Cpos_07_COI (PP355196)	Cpos_07_28S (PP295312)
		Cpos_08_16S (PP295355)	Cpos_08_12S (PP295279)	Cpos_08_COI (PP356608)	Cpos_08_28S PP295313
		Cpos_09_16S (PP295356)	Cpos_09_12S (PP295280)	Cpos_09_COI (PP356607)	Cpos_09_28S (PP295323)
Centruroides sculpturatus	218467	Cscu_35_16S (PP295382)	Cscu_35_12S (PP295306)	Cscu_35_COI (PP356606)	Cscu_35_28S (PP295331)
Centruroides sp. 1	3103037	Csp1_23_16S (PP295370)	Csp1_23_12S (PP295294)	Csp1_23_COI (PP356604)	Csp1_23_28S (PP295311)
Centruroides sp. 2		Csp2_11_16S (PP295358)	Csp2_11_12S (PP295282)	Csp2_11_COI (PP356603)	Csp2_11_28S (PP295327)
		Csp_14_16S (PP295361)	Csp_14_12S (PP295285)	Csp_14_COI (PP356605)	Csp_14_28S (PP295326)
Centruroides suffusus	6881	Csu_33_16S (PP295380)	Csu_33_12S (PP295304)	–	Csu_33_28S (PP295330)
Centruroides tecomanus1	1028682	Cte1_12_16S (PP295359)	Cte1_12_12S (PP295283)	Cte1_12_COI (PP356602)	Cte1_12_28S (PP295315)
		Cte1_17_16S (PP295364)	Cte1_17_12S (PP295288)	Cte1_17_COI (PP355197)	Cte1_17_28S (PP295320)
		Cte1_18_16S (PP295365)	Cte1_18_12S (PP295289)	Cte1_18_COI (PP356601)	Cte1_18_28S (PP295318)
Centruroides tecomanus2		Cte2_13_16S (PP295360)	Cte2_13_12S (PP295284)	Cte2_13_COI (PP356600)	Cte2_13_28S (PP295316)
		Cte2_15_16S (PP295362)	Cte2_15_12S (PP295286)	Cte2_15_COI (PP355198)	Cte2_15_28S (PP295317)
Table 4. Continued
Species	NCBI:txid	16S	12S	COI	28S
		Cte2_19_16S (PP295366)	Cte2_19_12S (PP295290)	Cte2_19_COI (PP356599)	Cte2_19_28S (PP295319)
		Cte2_20_16S (PP295367)	Cte2_20_12S (PP295291)	Cte2_20_COI (PP356598)	Cte2_20_28S (PP295321)
		Cte2_21_16S (PP295368)	Cte2_21_12S (PP295292)	Cte2_21_COI (PP356597)	Cte2_21_28S (PP295322)
Centruroides tecomanus		MF134695	–	MF134799	MF134757
		MK479053	MK479002	MK479206	MK479156
Mesomexovis sp.	–	Mesp_22_16S (PP295369)	Mesp_22_12S (PP295293)	Mesp_22_COI	Mesp_22_28S (PP295337)
Mesomexovis occidentalis	1532992	KM274362	KM274216	KM274800	–
Mesomexovis spadix	1532994	KM274221	KM274367	KM274805	KM274659
Mesomexovis subcristatus	1532995	KM274368	KM274222	KM274806	KM274660
Thorellius cristimanus	1533000	Tcri_01_16S (PP295348)	Tcri_01_12S (PP295272)	–	Tcri_01_28S (PP295338)
		Tcri_16_16S (PP295363)	Tcri_16_12S (PP295287)	–	Tcri_16_28S (PP295336)
		Tcri_02_16S (PP295349)	Tcri_02_12S (PP295273)	–	Tcri_02_28S (PP295339)
		Tcri_05_16S (PP295352)	Tcri_05_12S (PP295276)	–	Tcri_05_28S (PP295340)
		KM274420	KM274274	KM274858	KM274712
		KM274422	KM274276	KM274860	KM274714
Thorellius intrepidus	1533001	Tint_24__16S (PP295371)	Tint_24_12S (PP295295)	Tint_24_COI (PP355193)	Tint_24_28S (PP295341)
		Tint_25_16S (PP295372)	Tint_25_12S (PP295296)	Tint_25_COI (PP356616)	Tint_25_28S (PP295342)
		Tint_26_16S (PP295373)	Tint_26_12S (PP295297)	Tint_26_COI (PP356617)	Tint_26_28S (PP295343)
		Tint_27_16S (PP295374)	Tint_27_12S (PP295298)	Tint_27_COI (PP355192)	Tint_27_28S (PP295344)
		Tint_28_16S (PP295375)	Tint_28_12S (PP295299)	Tint_28_COI (PP356618)	Tint_28_28S (PP295345)
		Tint_29_16S (PP295376)	Tint_29_12S (PP295300)	Tint_29_COI (PP356619)	Tint_29_28S (PP295346)
		KM274424	KM274278	KM274862	–
		KM274425	KM274279	KM274863	KM274717
Vaejovis sp.	–	Vasp_32_16S (PP295379)	Vasp_32_12S (PP295303)	Vasp_32_COI (PP356620)	Vasp_32_28S (PP295347)
Vaejovis carolinianus	33322	KM274289	KM274143	KM274727	KM274581
Vaejovis pequeno	1532951	KM274293	KM274147	KM274731	KM274585
Vaejovis rossmani	1532952	KM274294	KM274148	KM274732	KM274586

Table 5

Main statistics of site information per alignment, including parsimony informative sites, (P info) and the concatenated (Conca) alignment of all partitions in a final matrix. The concatenated alignment had 6% missing data.

Partitions	Terminals/ nucleotide	Site information per alignment	Substitution
		P info	Invariable	Unique	Constant	Model
16S	53/523	209	285	258	285	K3Pu+F+I+G4
28S	52/538	39	494	96	494	K2P+I
12S	51/393	153	210	212	210	TPM2+F+G4
COI	45/679	220	420	220	420	TIM2+F+G4
Conca	53/2133	621	1,409	786	1,409	simultaneous

Figure 2. Phylogenetic tree from an analysis of 4 concatenated genetic markers, 3 mitochondrial (12S, 16S, and COI) and 1 nuclear (28S). The topology shows families, subfamilies, and species groups. Numbers beside nodes indicate ultrafast bootstrap/genetic concordance factor/site concordance factor. Colored species represent the 11 species found in our collection within the study area and samples grouping with them distributed inside or outside Colima. Scorpion photos: upper right, Centruroides tecomanus from El Palapo, adult male; middle, Centruroides hirsutipalpus from Sierra de Minatitlán, adult female; lower left, Thorellius intrepidus from El Palapo, adult male.

The Vaejovid clade received full support, except SCF (60%), which included 3 genera: Vaejovis, Mesomexovis, and Thorellius (Fig. 2). The genera occurred in a topology that overall resembles that of González-Santillán and Prendini (2013, 2015); while Vaejovis is a genus within Vaejovinae, Mesomexovis and Thorellius are part of the Syntropinae subfamily. Within Syntropinae, only Thorellius was monophyletic, and T. intrepidus received full support. Additionally, we identified 2 putative new species belonging to the genera Vaejovis and Mesomexovis. 

Distributional maps and species geographical ranges. We mined 6,965 records of Mexican scorpions from the InDRE database but retained only 1,000 of the species treated herein. We filtered the records using previously published identified species by specialists and the distribution of the species cited for Colima (González-Santillán & Prendini, 2013, 2018; Lourenço & Sissom, 2000; Ponce-Saavedra et al., 2016; Sissom, 2000).

Figure 3. Map of the west coast of Mexico with georeferenced filtered records from the InDRE database. A, Distribution of Centruroides elegans (circles), records north of Sierra de Manantlán may be misidentifications; B, distribution of Centruroides tecomanus (circles), records in Guerrero (GRO), Guanajuato (GTO), Jalisco (JAL), and Nayarit (NAY) may be misidentifications; Centruroides tecomanus 1 green cross, and Centruroides tecomanus 2 pink crosses. State abbreviations: AUG, Aguascalientes; COL, Colima; MEX, Estado de México; QRO, Querétaro; SLP, San Luis Potosí; ZAC, Zacatecas.

Figure 4. Map of the west coast of Mexico with georeferenced filtered records from the InDRE database and for B additional records from Ponce-Saavedra et al. (2015). A, Distribution of Centruroides infamatus (circles); B, distribution of Centruroides ornatus (circles), our sample in Colima (cross).

Figure 5. Map of the west coast of Mexico with georeferenced filtered records from the InDRE database. A, Distribution of Centruroides hirsutipalpus (red cross), Centruroides sp. 1 (blue cross), Centruroides sp. 2 (pink cross), and Centruroides possanii (green crosses); B, distribution of Mesomexovis aff. occidentalis sequences in this work and a sample from Chamela Jalisco recorded by González-Santillán (2004), conspecific with our samples in green crosses, Vaejovis sp. (mexicanus group) (pink cross). 

The distribution of Centruroides species appears to be restricted by physiographical elements. Centruroides elegans and C. tecomanus are restricted to the coastal lands of Jalisco and Colima, respectively (Fig. 3). The Sierra Madre del Sur appears to be the main barrier to the north of their distribution. The records of these species overlap broadly with a visible gap created by the Sierra de Minatitlán (Fig. 3B) either by subsampling or by an effective geographic barrier. 

Centruroides ornatus and C. infamatus, on the other hand, are restricted to the Transmexican Volcanic Belt (TVB) (Fig. 4). While the former species has an entire distribution within this province (Fig. 4B), the latter seems to be distributed in patches, one to the north, along the border of the Chihuahuan desert and the TVB, and the second to the south, between the Balsas Depression and the TVB (Fig. 4A). 

Centruroides possanii appears to be a microendemic scorpion species component of the fauna restricted to a massive karstic lone mountain, Cerro Grande (González-Santillán et al., 2019). Two putative undescribed species of Centruroides occupy the extreme east and west of the coastal line of Colima, and C. hirsutipalpus appears restricted to the Sierra Minatitlán (Fig. 5A). 

Of the vaejovid species, thus far, the only records for Mesomexovis sp. are in Colima, albeit there is one conspecific record in Chamela, Jalisco (González-Santillán, 2004). The putatively undescribed species of Vaejovis appears restricted to Cerro Grande (Fig. 5B), like Centruroides possanii, potentially another microendemic species. Thorellius intrepidus and T. cristimanus are widely distributed within Colima and across the TVB, the Balsas Depression, and the Sierra Madre del Sur (Fig. 6). 

Discussion

Of the 2 families found in Colima, Buthidae comprise 7 species of Centruroides,becoming the most diverse (Table 1, Fig. 2). Our multigene analyses suggest that the previously recorded species C. elegans, C. infamatus, and C. limpidus reported by Ponce-Saavedra et al. (2016) might not be part of the scorpion fauna of Colima, as we demonstrate in the following sections. 

Figure 6. Map of the west coast of Mexico with georeferenced filtered records from the InDRE database. A, Distribution of Thorellius intrepidus greensquares, our samples in Colima pink crosses; B, distribution of Thorellius cristimanus greensquares, our samples in Colima pink crosses.

Centruroides elegans and C. limpidus were not found in Colima. Centruroides elegans has an obscure taxonomic history. Firstly, its original description is too general and never indicated a precise type locality, but “Mexico” (Fet & Lowe, 2000). Secondly, although some taxonomic works clarified its former subspecies, the nominal taxon identity of C. elegans remains ambiguous. While Lourenço and Sissom (2000) suggested that this species is distributed in Jalisco, later, González-Santillán (2004) concluded that its distributional limits have never been defined with precision. The 2 exemplars of C. elegans collected in Chamela, Jalisco, grouped with members of the elegans group, sisters to C. limpidus from Iguala, Guerrero, and these in turn, were sister to our 2 exemplars identified as Centruroides new sp. 2 11 and 14 from La Central, in the municipality of Manzanillo (Figs. 2). The distributional data from InDRE of C. elegans is limited right at the northern border of Colima, except for 9 records away from that geographic barrier (Fig. 3A), which we hypothesized as a misidentification due to their position outside the Pacific coastline. Our fieldwork produced no sample conspecific to C. elegans but did produce other genetically distant exemplars. Until denser sampling along the northern border of Colima is conducted, we conclude that C. elegans and by corollary C. limpidus might not be part of the scorpion fauna distributed in Colima as suggested by Ponce-Saavedra and Francke (2013) and Ponce-Saavedra et al. (2016).

Centruroides infamatus may not be part of the Colima scorpion fauna. Centruroides infamatus is another obscure taxon with an ambiguous distributional pattern from published data. Despite its inclusion in phylogenetic analyses (Quijano-Ravel et al., 2019; Towler et al., 2001), its taxonomic circumscription and distribution have never been clarified. Among other problems, the original description indicates “type locality unknown” (Fet & Lowe, 2000). Hoffmann (1932) studied the scorpions from Mexico and realized that the specimens from Michoacán agreed with the original description of the species and proposed that its distribution was expanded to Central Mexico from the Pacific Coast in Sinaloa and Colima to Guanajuato. We included 2 exemplars of C. infamatus, 1 from León, Guanajuato (C. infamatus 15 scrp), and 1 terminal from Tandamangapio municipality, Michoacán (C. infamatus LP1822; Esposito et al., 2018). However, the terminal LP1822 grouped with exemplars of C. ornatus (Fig. 2) and Tandamangapio is approximately 16 km from Sahuayo and Jiquilpan, 2 localities recorded in the redescription of C. ornatus (Ponce-Saavedra et al., 2015). 

We plotted 612 records from the InDRE database of C. infamatus to compare the distribution of C. ornatus (Fig. 4A). Although northern Michoacán is almost exclusively occupied by C. ornatus, Jalisco and Michoacán present an overlap with C. infamatus (Fig. 4). Additionally, the InDRE database contains records of C. infamatus from Oaxaca, Puebla, Nayarit, Durango, and Sinaloa (not shown), most likely occupied by other species, implying that most records are misidentifications. The species that morphologically could be confused with C. infamatus in the states of Oaxaca and Puebla are C. baergi, C. nigrovariatus, or C. rodolfoi because the overall base color, body size and carapace pigmentation are similar among the species. The same morphological features are present in specimens from Nayarit and Durango, however, the identity of the populations in these two states have never been studied with a molecular approach and may represent a geographically distinct species. 

Nevertheless, recently Ponce-Saavedra et al. (2022) described C. baldazoi for Sinaloa, related morphologically with C. infamatus, potentially a species with which it can be mistaken. Although Ponce-Saavedra and collaborators included C. infamatus in the distribution of Sinaloa and Colima, they failed to indicate precise localities. In summary, the distribution of C. infamatus remains unsolved, attested by the wide distribution reported in the InDRE database. Thus, the infamatus species complex requires comprehensive molecular analyses to delimit its taxonomic circumscription and geographical distribution. On the other hand, our samples of C. ornatus 3 and 4 grouped with C. ornatus LP1822 and with C. ornatus 2003 from Morelia, Michoacán (Esposito & Prendini, 2019), forming a monophyletic group (Fig. 2). Since the samples LP1822 and 2003 lie within the area of C. ornatus proposed by Ponce-Saavedra et al. (2015), we concluded that our exemplars are conspecific with C. ornatus and expanded the distribution southwards, drawing a distributional border in northern Colima (Fig. 4B). 

In conclusion, we propose that C. infamatus might not be present in Colima, but further sampling and analyses are needed. Despite the morphological similarity between C. infamatus and C. ornatus, our molecular analysis indicates genetic differences and may present a distinctive distributional pattern yet to be drawn with more samples. 

Centruroides tecomanus is a species complex. Due to their morphological similarity with C. limpidus, C. tecomanus was described as C. limpidus tecomanus (Hoffmann, 1932), and the author delimited C. tecomanus distribution to the lowlands of Colima and surmised that its distribution extended to the south along the coastline of Michoacán. But, most importantly, Hoffmann mentioned that on the northern coastline, C. elegans substitutes C. tecomanus. In contrast, the distribution recorded in the InDRE database for C. tecomanus implies that these 2 species present a wide area of sympatry on the coast of Jalisco (Fig. 3). 

Ponce-Saavedra et al. (2009) proposed C. tecomanus as a “bona fide species” and assumed its distribution includes the coastline of Michoacán, following Hoffmann (1932). In their molecular and morphological analyses, the authors never included exemplars from Tecomán, Colima, the type locality for the species, assuming that the specimens from Michoacán were conspecific with the populations of Tecomán. Furthermore, Quijano-Ravell et al. (2010) extended the distribution of C. tecomanus to 4 localities in Guerrero and a similar number in Jalisco in a montane area. 

The phylogenetic tree presented here substantiates 2 clades of C. tecomanus within the monophyletic infamatus species group (Fig. 2). We hypothesize that these clades may represent potentially distinct sympatric species, emphasizing that our topology obtained full support for these clades with multiple samples. Centruroides tecomanus2 appears to be more common and widely distributed in Colima, whereas C. tecomanus1 is less common, with only 2 localities grouped with Centruroides tecomanus 2007 from Michoacán and from the municipality of Comala, Colima, Centruroides tecomanus (Fig. 3B). Our results suggest that the populations distributed in Michoacán may represent a cryptic, undescribed species; consequently, the exemplars reported in Guerrero (Quijano-Ravell et al., 2010) are unlikely to be conspecific with C. tecomanus. The authors’ discovery of new populations in Jalisco and Guerrero were based entirely on their analyses of morphological characters, precisely the most common way of confusing cryptic species. 

Considering that the montane border between Colima and Michoacán is occupied by Centruroides romeroi Quijano-Ravell, de Armas, Francke, Ponce-Saavedra, 2019, it is fair to assume that C. tecomanus1 inhabits coastal ranges following the coastline of Michoacán to the Lázaro Cárdenas delta, where it may be substituted by Centruroides bonito Quijano-Ravell, Teruel, Ponce-Saavedra, 2016 or even other undescribed species. The Balsas River has been proposed to be a geographical barrier for several epigean arachnids, such as Amblypygi and Theraphosidae (Mendoza & Francke, 2017; Schramm et al., 2021) and for small mammals (Ruiz-Vega et al., 2018)

Noteworthy is the locality La Central, right on the border between Colima and Jalisco, a few kilometers southeast of the Marabasco River (Fig. 1A), where we collected 3 putatively different species of Centruroides, the 2 morphotypes of C. tecomanus and Centruroides sp. 2, retrieved within the elegans group (Fig. 2). These findings illustrate the complicated patterns of diversification within this buthid genus in Colima. From a taxonomic perspective, if the identity of C. tecomanus is to be clarified, it is now imperative to analyze molecularly exemplars from Tecomán, Colima, which is the type locality of this species.

Thorellius species exhibit a more restricted distribution in Colima. Thorellius intrepidus and T. cristimanus are widely distributed in several states of the Pacific Lowlands (Fig. 6). However, in a recent revision of the genus, 2 species were described, Thorellius wixarika González-Santillán and Prendini, 2018 and Thorellius tekuani González-Santillán and Prendini, 2018 (Fig. 3 of González-Santillán and Prendini, 2018), that are relevant to these analyses. The former occupies the northwestern territory in Nayarit and Jalisco,whereas the latter inhabits the Balsas Depression of Estado de México, Guerrero, and Michoacán. This observation suggests that the InDRE database contains several misidentifications of both T. intrepidus and T. cristimanus. In fact, the T. wixarika and T. tekuani description was in 2018, and the InDRE database is several years older, hence the complete absence of records. Thus, T. intrepidus inhabits Aguascalientes, Colima, Guanajuato, Jalisco, and Michoacán (Fig. 6A); and T. cristimanus, Colima and Jalisco (González-Santillán & Prendini, 2018) (Fig. 6B). From an ecological point of view, we noticed that the InDRE database only has records with elevations below 700 m, implying that these species prefer tropical to subtropical climates in Colima.

González-Santillán (2004) reported Mesomexovis aff. occidentalis as a putative new species for the Biological Station Chamela, Jalisco. Furthermore, González-Santillán and Prendini (2015) conducted a phylogenetic analysis using morphology and mitochondrial and nuclear DNA, resulting in a topology that suggested that this species was not conspecific to Mesomexovis occidentalis, as Williams (1986)identified it. López-Granados (2019) found further morphological evidence to separate this species, but the evidence was never published. The importance of that work is that, for the first time, exemplars of Mesomexovis from Colima that were conspecific with our samples were included in a phylogenetic analysis. Once more, we demonstrate that Mesomexovis sp. 22 is not conspecific with M. occidentalis using molecular evidence, and it requires a formal separation and description (Fig. 2). Unlike Thorellius species in Colima, Mesomexovis is a widespread species inhabiting tropical to montane habitats with a wider range of elevation (Fig. 5B).

The mexicanus group was recently revisited in a monograph with the delimitation of other species groups and the description of 5 new species (Contreras-Félix & Francke, 2019). The paucity of sequences for the mexicanus group in the NCBI database only permitted retrieval of loci for Vaejovis rossmani LP 2027, a species inhabiting the Sierra Madre Oriental in the states of Tamaulipas and Nuevo León and treated in the Contreras-Félix and Francke (2019) monograph. Our analysis retrieved Vaejovis sp. 32 and Vaejovis rossmani LP 2027 together, which suggests membership of the mexicanus group of Vaejovis. Furthermore, Vaejovis sp. 32also matches the morphological diagnosis presented in Contreras-Felix and Francke (2019). Contreras-Félix et al. (2023) recorded Vaejovis santibagnezi Contreras-Felix and Francke, 2019 in Cerro Grande, where we collected our samples (Fig. 5B). However, the authors failed to present morphological evidence to justify this conclusion. We compared our specimens with the geographically closest V. monticola deposited in the CNAN and with V. santibagnezi and found significant morphological differences. Currently, we are preparing a contribution where we propose the description of a new species. Following this idea, we are inclined to think that, like C. possanii, Vaejovis sp. 32 is also microendemic because of its limitation to disperse throughout tropical valleys from the Cerro Grande massif to other mountain ranges. Finally, we submit that such an evident geographical barrier may apply to several epigean, non-volant arthropods such as the scorpions. 

Finally, 2 species absent in our fieldwork are Konetontli ilitchi González-Santillán and Prendini 2015 and Vaejovis janssi Williams, 1980. The latter is endemic to the Socorro Island, part of the Revillagigedo Archipelago (Williams, 1980), and K. ilitchi has been found only inside a cave in the vicinity of Coquimatlán, Colima (González-Santillán & Prendini, 2015). These 2 features in the distribution and biology of the species hindered the possibility of collecting and studying them. Future fieldwork may illuminate the taxonomy and distribution of these elusive species. Finally, Vaejovis monticola, another high elevation dweller of the mexicanus species group (Contreras-Felix & Francke 2019) was absent in our collecting trips. Although its type locality cited by Contreras-Felix and Francke (2019) indicates: “Jalisco, northern side of Nevado de Colima” we submit that it may not be on the southern side in Colima, but extensive fieldwork is needed to confirm this hypothesis.

Biogeographical and ecological considerations

There is strong evidence that the ancestors of the North American Centruroides originated in Gondwana and have dispersed to and diversified in that territory via land bridges, vicariance, and rafting over the Atlantic Ocean, over 50 to 20 Mya (Esposito & Prendini, 2019). However, the movement of this genus towards boreal latitudes within North America is not well understood. Although one could suppose that the colonization of such territories appears to be in pulses at different periods due to the overlap in the distribution of the elegans and infamatus species groups, it is beyond the scope of our study to establish a coherent explanation; besides, our data are incomplete to that end. One startling discovery is that the Colima scorpiofauna comprises 7 distinctive, at least genetically, species of Centruroides (Fig. 2). What biotic, abiotic, or ecological factors produce such species diversity? Is it a combination of all these factors? Is it a case of sympatric speciation? Morphologically, it is sometimes difficult to distinguish some of these species. For instance, the 3 species found in La Central were identified initially as C. tecomanus because they exhibit no morphological variation, at least in traditional characters shown in identification keys (Ponce-Saavedra et al., 2016). It is fundamental to conduct morphological studies with this scorpion community to obtain independent information to precisely delimit these species. Unlike other scorpion groups, Centruroides exhibit conservative morphology. For instance, if we compared Centruroides species to species of the Syntropinae subfamily, we find that syntropines are diverse in ecomorphotypic adaptations that promoted morphological diversification (González-Santillán & Prendini, 2013), while in Centruroides, the persistent errant lifestyle maintains morphology without significant variation. It is astonishing to observe, for instance, C. tecomanus living at sea level in tropical deciduous forests and compare it to C. possanii inhabiting pine-oak forests above 2,000 m elevation; as though, the same “Centruroides bauplan” can survive diametrically different environments following a persistent lifestyle. This final assertion leads us to think that the adaptative changes are in the physiology rather than in the morphology of Centruroides.

Thorellius and Mesomexovis (Syntropinae) are substrate-specialists, since the body plan, more robust and armed with setae and spinules on the legs, allow these species to scrape and dig galleries on clayey, fine-grained substrates (González-Santillán & Prendini, 2013, 2018). Such adaptations come with a drawback because the kind of soil restricts the presence of these scorpions; for instance, rocky or shallow soils represent unhospitable habitats for these species. Like other species in the mexicanus group, Vaejovis sp. 32 and Vaejovis monticola Sissom, 1989 are inhabitants of montane habitats within the intricate topography of Colima. 

In summary, the scorpion assemblage distributed in Colima includes errant species such as Centruroides without exaggerated adaptations; pelophilous/lapidicolous species such as Thorellius and Mesomexovis, powerful diggers, commonly found underneath rocks or other debris; and scorpions that can be found inside the leaf litter or under nooks of rocks or trees, such as Vaejovis sp. However, it is enigmatic why the Diplocentridae family, well-represented in Mexico, has not been found in Colima. Only in Colima, out of the 3 relatively small states in Mexico, the other 2 being Morelos (Santibáñez-López et al., 2011) and Aguascalientes (Chávez-Samayoa et al., 2022), where similar scorpiofaunistic surveys have been conducted, the genus Diplocentrus is absent. From a biogeographical point of view, if this family is absent in Colima, it is not trivial and requires further investigation.

As a final remark, we hope we have accomplished our aim of urging arachnologists to examine the benefits of local inventories and the potential use of barcodes at the forefront of discovering and documenting local arachnid diversity. 

Medical and pharmacological relevance of some scorpions of Colima

From a medical point of view, it is of utmost importance to identify the species of scorpions in an area and to be able to distinguish hazardous from harmless species. Colima is one of the states with the highest incidence rates of mortality and morbidity caused by intoxication by scorpion sting (ISS) (Chowell et al., 2006; González-Santillán & Possani, 2018). By the 1940s, Colima was at the forefront of ISS and deaths in Mexico. However, with the introduction of a safe and effective antivenom in the 1970s, mortality has diminished, although morbidity is still high (González-Santillán & Possani, 2018).

Due to the medical relevance of scorpionism in Mexico, the venom of some buthid scorpions distributed in Colima has been studied extensively (Table 6). We know that mammalian sodium scorpion toxins (NaScTx) are the chief and sometimes most abundant compound responsible for the toxicity of scorpion venom, although potassium, chlorine, and calcium-gated channels, among others, are also affected by toxic peptides (Cid-Uribe et al., 2019; González-Santillán & Possani 2018). Until now, C. hirsutipalpus, C. ornatus, C. possanii, and C. tecomanus have been studied with a proteomic or transcriptomic approach, demonstrating that these venoms are powerful enough to decimate humans (García-Guerrero et al., 2020; García-Villalvazo et al., 2023, Valdez-Velázquez et al., 2016, 2018). Centruroides tecomanus venom contains at least 13 mammalian toxic compounds (Valdez-Velázquez et al., 2016), of which Ct1a is the main mammalian sodium scorpion toxin component, with a molecular weight of 7,591 Da (Martin et al., 1988). The proteomic analysis of C. ornatus toxic components identified 3 major mammalian NaScTx, CO1, CO2, and CO3, with molecular weights of 7,561.2, 7,614.3, and 7,774.9 Da, respectively (García-Guerrero et al., 2020). On the other hand, the published mass fingerprint of C. hirsutipalpus venom has 4 compounds with similar molecular weight to C. tecomanus peptides, suggesting that these species may have similar or identical NaScTx (Valdez-Velázquez et al., 2018). One of the shared compounds found in C. hirsutipalpus corresponds to the molecular weight of Ct1a (Valdez-Velázquez et al., 2013), which means that Ct1a could be responsible for, or at least contribute to, the high toxicity of this species. Although the molecular components with a weight corresponding to the toxic peptides CO1, CO2, and CO3 are not present in C. hirsutipalpus venom, the mass fingerprint of C. tecomanus reported a peptide with similar molecular weight to CO2 toxin present in C. ornatus (Valdez-Velázquez et al., 2013). Our phylogenetic results show that these species belong to the infamatus group, and it is notable that the molecular weight among some toxins is similar. This observation opens the possibility that the toxin diversity of the mammalian NaScTx may have been inherited from a common ancestor. We realize, however, the need for a more in-depth study to unveil the relationship among these toxic peptides to test such a hypothesis. In contrast, a C. possanii crude venom proteomic study resulted in the identification of 18 NaScTx, of which, CpoNatBet09 was identical to Cll2b and Cii1 from C. limpidus and C. infamatus, respectively (Valdez-Velázquez et al., 2013). This example allows us to present the counterpart of the previous one. Centruroides limpidus in our topology grouped with members of the elegans group and C. possanii within the infamatus group (Fig. 2). We can conclude that the exact sequence match between CpoNatBet09 and Cll2b is most likely due to a selective force that produced convergent evolution. Alternatively, this is a deeper inheritance within the ancestors of the infamatus and elegans group. 

The comparisons and hypotheses about venom similarities and species assume that all scorpions used to conduct the experiments to obtain the crude venom were correctly identified. However, the discovery of putative species of Centruroides might question some of these results, particularly those of C. tecomanus. The first author has been collaborating to identify most samples of species used in some of the recently published investigation on venom research (Cid-Uribe et al., 2019; García-Guerrero et al., 2020; Romero-Gutiérrez et al., 2017, Valdez-Velázquez et al., 2018, among others). And in some cases, voucher specimens have been deposited in the CNAN, therefore the taxonomic identity for C. hirsutipalpus, C. ornatus, C. possanii can be readily corroborated. 

Table 6

Scorpion species with reported LD₅₀ tested on mice at μg/20g mouse weight scale with the named, most abundant, and likely responsible for high toxicity sodium toxins found in the scorpion species of Colima.

Species	LD50	NaScTx	Autor
Centruroides hirsutipalpus  Ponce-Saavedra and Francke, 2009	11.7 ± 1.9	26 β-NaTx and 5 α-NaTx (proteome) 71 β-NaTx and 16 α-NaTx (transcriptome)	Valdez-Velázquez et al. (2021)
Centruroides ornatus Pocock, 1902	13.3 ± 1.7	Beta toxins: Co1, Co2, Co3, Co52	García-Guerrrero et al. (2020)
Centruroides possanii González-Santillán, Galán-Sánchez, Valdez-Velázquez, 2019	13.18 ± 0.7	CpoNatBet09, CpoNatBet14, CpoNatBet35 (Proteome and transcriptome)	García-Villalvazo et al. (2023)
Centruroides tecomanus Hoffmann, 1932	10.2 ± 0.3	Beta toxin Ct1a, Ct7, Ct16, Ct17, Ct28, Ct25, Ct6, Ct13, neutoroxin II.22.5	Valdez-Velázquez et al. (2013, 2016), Ramírez et al. (1988)
Thorellius cristimanus Pocock, 1902	N/A	10 β-NaTx and 3 α-NaTx (transcriptome)	Romero-Gutiérrez et al. (2017)

Because vaejovid scorpions exhibit lower toxin potency, proteomic studies are uncommon. However, the study of the crude venom of Thorellius cristimanus under a transcriptomic and proteomic approachidentified160 potential venom peptides (Romero-Gutiérrez et al., 2017). The authors found a great diversity of channel toxins targeting potassium and calcium ion-channels, numerous enzymes, and NDBP. Nevertheless, none of these toxins appear to affect mammals to endanger their life. Noteworthy are the NDBP compounds with antimicrobial activity (Almaaytah et al., 2014), which potentially may be a source for developing novel commercial antibiotics. More recently, Ibarra-Vega et al. (2023) reported finding the neurotransmitter serotonin and 2 derived or intermediate indoles of serotonin: N-methylserotonin, and bufotenidine. Although serotonin has been reported in other scorpions and the sea snail genus Conus, the other indoles represent the first report in scorpions. The authors proposed that the 3 components are involved in defense and probably prey submission because they produce extreme pain in the victim. Furthermore, N-methylserotonin and bufotenidine showed a similar affinity for serotonin cellular receptors, implying a role in the effect of this neurotransmitter, and thus, it showed promising medical applications.

Integrating taxonomic, distributional, and in our case venom diversity within local scorpion faunas is an interdisciplinary topic uncommon in the literature (Brito & Borges, 2015; Cao et al., 2014), although this exercise has been done in Mexico before (Santibáñez-López et al., 2015). This multidisciplinary work took advantage of a reciprocal illumination exercise. This short synthesis of the diversity of venoms of scorpion of Colima revealed the potential of toxins to be part of the evidence to identify and delimit species (Schaffrath et al., 2018). Moreover, the synthesis provided a glance of the evolution of venoms not only for the medically prominent species of Centruroides but also for vaejovid scorpion species. From the experimental discipline, we learned that it is paramount to maintain vouchers after biochemical or physiological experiments to track down the original material and keep up with the dynamics of taxonomy, a tool requiring empirical information to permit the identification of species to validate past, present, and future discoveries in other biological disciplines.

Acknowledgments

We thank the University of Colima students and Josué López Granados (Facultad de Ciencias, UNAM) for their assistance in collecting scorpions throughout the state of Colima. JICU thanks Conahcyt for granting a postdoctoral scholarship (512560). Collection permits granted by Semarnat included SGPA/DGVS/12063/15, SGPA/DGVS/02139/2022, and FAUT-0305. Finally, we are grateful to the Associate Editor and two reviewers for improving an early version of the manuscript, particularly to Andrés Ojanguren-Afilastro for his critical reading. 

References

Almaaytah, A., & Albalas, Q. (2014). Scorpion venom peptides with no disulfide bridges: a review. Peptides, 51, 35−45. https://doi.org/10.1016/j.peptides.2013.10.021 

Baldazo-Monsivaiz, J. G., Ponce-Saavedra, J., & Flores-Moreno, M. (2012). Los alacranes (Arachnida: Scorpionida) de importancia médica del estado de Guerrero, México. Dugesiana, 19, 143−150.

Baldazo-Monsivaiz, J. G., Teruel, R., Cortés-Guzmán, A. J., & Canché-Aguilar, I. (2017). Los escorpiones (Arachnida: Scorpiones) del municipio de Chilpancingo de los Bravo, estado de Guerrero, México Entomología Mexicana, 4, 21−27.

Baldazo-Monsivaiz, J. G., Teruel, R., Cortés-Guzmán, A. J., Sánchez-Arriaga, J., López-Flores, M., Reyes-Castelán, A. et al. (2016). Los escorpiones (Arachnida: Scorpiones) del municipio de Taxco de Alarcón, del estado de Guerrero, México. Entomología Mexicana, 3, 75−80.

Bolaños, L. M., Rosenblueth, M., de Lara, A. M., Migueles-Lozano, A., Gil-Aguillón, C., Mateo-Estrada, V. et al. (2019). Cophylogenetic analysis suggests cospeciation between the Scorpion Mycoplasma Clade symbionts and their hosts. Plos One, 14, e0209588 https://doi.org/10.1371/journal.pone.0209588 

Brito, G., & Borges, A. (2015). A checklist of the scorpions of Ecuador (Arachnida: Scorpiones), with notes on the distribution and medical significance of some species. Journal of Venomous Animals and Toxins Including Tropical Diseases, 21, 1–23. https://doi.org/10.1186%2Fs40409-015-0023-x

Cao, Z., Di, Z., Wu, Y., & Li, W. (2014). Overview of scorpion species from China and their toxins. Toxins, 6, 796–815. https://doi.org/10.3390/toxins6030796 

Cid-Uribe, J. I., Meneses E. P., Batista, C. V. F., Ortiz, E., & Possani, L. D. (2019). Dissecting toxicity: The venom gland transcriptome and the venom proteome of the highly venomous scorpion Centruroides limpidus (Karsch, 1879). Toxins, 247, 1−21. https://doi.org/10.3390/toxins11050247 

Contreras-Félix, G. A., & Francke, O. F. (2019). Taxonomic revision of the “mexicanus” group of the genus Vaejovis C. L. Koch, 1836 (Scorpiones: Vaejovidae). Zootaxa, 4596, 1−100. https://doi.org/10.11646/zootaxa.4596.1.1 

Contreras-Félix, G. A., del Pozo, O. G., & Navarrete-Heredia, J. L. (2023). A new species of Vaejovis from the mountains of west Mexico (Scorpiones: Vaejovidae). Dugesiana, 30, 229−245. https://doi.org/10.32870/dugesiana.v30i2.7306

Chávez-Samayoa, F., Díaz-Plascencia, J. E., & González-Santillán, E. (2022). Two new species of Vaejovis (Scorpiones: Vaejovidae) belonging to the mexicanus group from Aguascalientes, Mexico, with comments on the homology and function of the hemispermatophore. Zoologischer Anzeiger, 298, 148–169. https://doi.org/10.
1016/j.jcz.2022.04.005 

Chowell, G., Díaz-Dueñas, P., Bustos-Saldaña, R., Alemán-Mireles, A., & Fet, V. (2006). Epidemiological and clinical characteristics of scorpionism in Colima, Mexico (2000-2001). Toxicon, 47, 753–758. https://doi.org/10.1016/j.toxicon.2006.02.004 

Esposito, L. A., & Prendini, L. (2019). Island ancestors and New World biogeography: a case study from the scorpions (Buthidae: Centruroidinae). Scientific Reports, 9, 3500. https://doi.org/10.1038/s41598-018-33754-8 

Fet, V., Graham, M. R., Blagoev, G., Karataş, A., & Karataş, A. (2016). DNA barcoding indicates hidden diversity of Euscorpius (Scorpiones: Euscorpiidae) in Turkey. Euscorpius, 216, 1–13. 

Fet, V., Graham, M. R., Webber, M. M., & Blagoev, G. (2014). Two new species of Euscorpius (Scorpiones: Euscorpiidae) from Bulgaria, Serbia, and Greece. Zootaxa, 3894, 83–105. https://doi.org/10.11646/zootaxa.3894.1.7 

Fet, V., & Lowe G. (2000). Family Buthidae C. L: Koch, 1837. In V. Fet, W. D. Sissom, G. Lowe, & M. E. Braunwalder (Eds.), Catalog of the scorpions of the World (1758–1998) (pp. 54–286). New York: New York Entomological Society.

Folmer, O., Black, M., Hoeh, W., Lutz, R., & Vrijenhoek, R. (1994). DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3, 294–299. 

García-Guerrero, I. A., Cárcamo-Noriega, E., Gómez-Lagunas, F., González-Santillán, E., Zamudio, F. Z., Gurrola, G. B. et al. (2020). Biochemical characterization of the venom from the Mexican scorpion Centruroides ornatus, a dangerous species to humans. Toxicon, 15, 27–38. https://doi.org/10.1016/j.toxicon.2019.11.004 

García-Villalvazo, P. E., Jiménez-Vargas, J. M., Lino-López, G. J., Meneses, E. P., Bermúdez-Guzmán, M. J., Barajas-Saucedo, C. E. et al. (2023). Unveiling the protein components of the secretory-venom gland and venom of the scorpion Centruroides possanii (Buthidae) through omic technologies. Toxins, 15, 1–20. https://doi.org/10.3390/toxins15080498 

Goodman, A. M., Prendini, L., & Esposito, L. A. (2021). Systematics of the arboreal Neotropical ‘thorellii’ clade of Centruroides bark scorpions (Buthidae) and the efficacy of mini-barcodes for museum specimens. Diversity, 13, 441. https://doi.org/10.3390/d13090441 

Goodman, A. M., Prendini, L., Francke, O. F., & Esposito, L. A. (2021). Systematic revision of the arboreal neotropical “thorellii” clade of Centruroides Marx, 1890, bark scorpions (Buthidae C. L. Koch, 1837) with descriptions of six new species. Bulletin of the American Museum of Natural History, 452, 1–92. 

González-Santillán, E. (2004). Diversidad, taxonomía y hábitat de alacranes. In A. N. García, & R. Ayala (Eds.), Artrópodos de Chamela (pp. 25–35). México D.F.: Instituto de Biología, Universidad Nacional Autónoma de México.

González-Santillán, E., Galán-Sánchez, M. A., & Valdez-Velázquez, L. L. (2019). A new species of Centruroides (Scorpiones, Buthidae) from Colima, Mexico. Comptes Rendus Biologies, 342, 9–10. https://doi.org/10.1016/j.crvi.2019.10.002 

González-Santillán, E., & Possani, L. D. (2018). North American scorpion species of public health importance with a reappraisal of historical epidemiology. Acta Tropica, 187, 264–274. https://doi.org/10.1016/j.actatropica.2018.08.002 

González-Santillán, E., & Prendini, L. (2013). Redefinition and generic revision of the North American vaejovid scorpion subfamily Syntropinae Kraepelin, 1905, with descriptions of six new genera. Bulletin of the American Museum of Natural History, 382, 1–71.

González-Santillán, E., & Prendini, L. (2015). Phylogeny of the North American vaejovid scorpion subfamily Syntropinae Kraepelin, 1905, based on morphology, mitochondrial and nuclear DNA. Cladistics, 31, 341–405. https://doi.org/10.1111/cla.12091 

González-Santillán, E., & Prendini, L. (2018). Systematic revision of the North American Syntropine Vaejovid scorpion genera Balsateres, Kuarapu, and Thorellius, with descriptions of three new species. Bulletin of the American Museum of Natural History, 420, 1–81. https://doi.org/10.1206/0003-0090-420.1.1 

Hoang, D. T., Chernomor, O., Haeseler, A. von, Minh, B. Q., & Vinh, L. S. (2018) UFBoot2: Improving the ultrafast bootstrap approximation. Molecular Biology and Evolution, 35, 518–522. https://doi.org/10.1093/molbev/msx281 

Hoffmann, C. C. (1932). Monografías para la entomología médica de México. Monografía Núm. 2. Los scorpiones de Mexico. Segunda parte, Buthidae. Anales del Instituto de Biología, Universidad Nacional Autónoma de México, 3, 243–361.

Huerta-Jiménez, H. (2018). Actualización de la Colección de Artrópodos con importancia médica (CAIM), Laboratorio de Entomología, InDRE. Version 1.5. Comisión Nacional para el Conocimiento y uso de la Biodiversidad.

Ibarra-Vega, R., Jiménez-Vargas, J. M., Pineda-Contreras, A., Martínez-Martínez, F. J., Barajas-Saucedo, C. E., García-Ortega, H. et al. (2023). Indolealkylamines in the venom of the scorpion Thorellius intrepidus. Toxicon, 233, 107232. https://doi.org/10.1016/j.toxicon.2023.107232

Jarvis, A., Reuter, H. I., Nelson, A. & Guevara, E. (2008). Hole-filled seamless SRTM data V4, International Centre for Tropical Agriculture (CIAT), available from http://srtm.csi.cgiar.org

Kalyaanamoorthy, S., Minh, B. Q., Wong, T. K. F., Haeseler, A. von, & Jermiin, L. S. (2017). ModelFinder: fast model selection for accurate phylogenetic estimates. Nature Methods, 14, 587–589. https://doi.org/10.1038/nmeth.4285 

Katoh, K., Rozewicki, J., & Yamada, K. D. (2019). MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization, Briefings in Bioinformatics, 20, 1160–1166. https://doi.org/10.1093/bib/bbx108 

Kocher, T. D., Thomas, W. K., Meyer, A., Edwards, S. V., Paabo, S., Villablanca, F. X. et al. (1989). Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proceedings of the National Academy of Sciences, 86, 6196–6200. https://doi.org/10.1073%2Fpnas.86.16.6196 

Kuraku, S., Zmasek, C. M., Nishimura, O., & Katoh, K. (2013). aLeaves facilitates on-demand exploration of metazoan gene family trees on MAFFT sequence alignment server with enhanced interactivity, Nucleic Acids Research, 41, W22–W28. https://doi.org/10.1093/nar/gkt389 

López-Granados, J. (2019). Análisis filogenético del complejo de especies occidentalis del género Mesomexovis González-Santillán y Prendini, 2013 (Scorpiones: Vaejovidae) basado en evidencia morfológica (Tesis). Facultad de Ciencias, Universidad Nacional Autónoma de México. CDMX.

Lourenço, W. R., & Sissom, W. D. (2000). Scorpiones. In B. J. Llorente, E. González, & N. Papavero (Eds.), Biodiversidad, taxonomía y biogeografía de artrópodos de México: hacia una síntesis de su conocimiento (pp. 115–135). Ciudad de México: Universidad Nacional Autónoma de México.

Maddison, W. P., & Maddison, D. R. (2023). Mesquite: a modular system for evolutionary analysis. Version 3.81. http://www.mesquiteproject.org 

Martin, B. M., Carbone, E., Yatani, A., Brown, A. M., Ramírez, A. N., Gurrola, G. B. et al. (1998). Amino acid sequence and physiological characterization of toxins from the venom of the scorpion Centruroides limpidus tecomanus Hoffmann. Toxicon, 26, 785–94. https://doi.org/10.1016/0041-0101(88)90319-4 

Mendoza, J., & Francke, O. (2017). Systematic revision of Brachypelma red-kneed tarantulas (Araneae: Theraphosidae), and the use of DNA barcodes to assist in the identification and conservation of CITES-listed species. Invertebrate Systematics, 31, 157–179. https://doi.org/10.1071/IS16023 

Minh, B. Q., Hahn, M. W., & Lanfear, R. (2020). New methods to calculate concordance factors for phylogenomic datasets. Molecular Biology and Evolution, 37, 2727–2733. https://doi.org/10.1093/molbev/msaa106 

Morrone, J. (2019). Regionalización biogeográfica y evolución biótica de México: encrucijada de la biodiversidad del Nuevo Mundo. Revista Mexicana de Biodiversidad, 90, e902980. https://doi.org/10.22201/ib.20078706e.2019.90.2980 

Morrone, J., Escalante, T., & Rodríguez-Tapia, G. (2017). Mexican biogeographic provinces: map and shapefiles. Zootaxa, 4277, 277–279. https://doi.org/10.11646/zootaxa.4277.2.8 

Nguyen, L. T., Schmidt, H. A., Haeseler, A. von, & Minh, B. Q. (2015). IQ-TREE: a fast and effective stochastic algorithm for estimating maximum likelihood phylogenies. Molecular Biology and Evolution, 32, 268–274. https://doi.org/10.1093/molbev/msu300 

Nunn, G. B., Theisen, B. F., Chirstensen, B., & Arctander, P. (1996). Simplicity-correlated size growth of the nuclear 28S ribosomal RNA D3 expansion segment in the crustacean order Isopoda. Journal of Molecular Evolution, 42, 211–223. https://doi.org/10.1007/bf02198847 

Podnar, M., Grbac, I., Tvrtković, N., Hörweg, C., & Haring, E. (2021). Hidden diversity, ancient divergences, and tentative Pleistocene microrefugia of European scorpions (Euscorpiidae: Euscorpiinae) in the eastern Adriatic region. Journal of Zoological Systematics and Evolutionary Research, 59, 1824–1849. https://doi.org/10.1111/jzs.12562 

Ponce-Saavedra, J., & Francke, O. F. (2013). Clave para la identificación de especies de alacranes del género Centruroides Marx 1890 (Scorpiones: Buthidae) en el Centro Occidente de México. Biológicas, 15, 52–62.

Ponce-Saavedra, J. y Francke, O. F. (2019). Una especie nueva de alacrán del género Centruroides (Scorpiones: Buthidae) del noroeste de México. Revista Mexicana de Biodiversidad,
90, e902660. https://doi.org/10.22201/ib.20078706e.2019.
90.2660

Ponce-Saavedra, J., Francke, O. F., Cano-Camacho, H., & Hernández-Calderón, E. (2009). Evidencias morfológicas y moleculares que validan como especie a Centruroides tecomanus (Scorpiones, Buthidae). Revista Mexicana de Biodiversidad, 80, 71–84. https://doi.org/10.22201/ib.20078706e.2009.001.585 

Ponce-Saavedra, J., Francke, O. F., Quijano-Ravell, A. F., & Santillán, R. C. (2016). Alacranes (Arachnida: Scorpiones) de importancia para la salud pública de México. Folia Entomológica Mexicana, 2, 45–70.

Ponce-Saavedra, J., Jiménez, M. L., Quijano-Ravell, A. F., Vargas-Sandoval, M., Chamé-Vázquez, D., Palacios-Cardiel, C. et al. (2023). The Fauna of Arachnids in the Anthropocene of Mexico, Chapter 2(pp. 18–39) In R. W. Jones, C. P. Ornelas-García, R. Pineda-López, & F. Álvarez (Eds.), Mexican fauna in the Anthropocene. Cham, Switzerland: Springer. https://doi.org/10.1007/978-3-031-17277-9 

Ponce-Saavedra, J., Linares-Guillén, J. W., & Quijano-Ravell, A. F. (2022). Una nueva especie de alacrán del género Centruroides Marx (Scorpiones: Buthidae) de la costa Noroeste de México. Acta Zoológica Mexicana (nueva serie), 38, 1–24. https://doi.org/10.21829/azm.2022.3812517 

Ponce-Saavedra, J., Quijano-Ravell, A. F., Teruel, R., & Francke, O. F. (2015). Redescription of Centruroides ornatus Pocock, 1902 (Scorpiones: Buthidae), a montane scorpion from Central Mexico. Revista Ibérica de Aracnología, 27, 81–89.

Prendini, L., Weygoldt, P., & Wheeler, W. C. (2005). Systematics of the Damon variegatus group of African whip spiders (Chelicerata: Amblypygi): evidence from behaviour, morphology and DNA. Organisms Diversity & Evolution, 5, 203–236. https://doi.org/10.1016/j.ode.2004.12.004 

Quijano-Ravell, A. F., De Armas, L. F., Francke, O. F., & Ponce-Saavedra, J. (2019). A new species of the genus Centruroides Marx (Scorpiones, Buthidae) from western Michoacán state, México using molecular and morphological evidence. Zookeys, 859, 31–48. https://doi.org/10.3897/zookeys.859.33069 

Quijano-Ravell, A. F., Ponce-Saavedra, J., Francke, O. F., & Villaseñor-Ramos. M. A. (2010). Nuevos registros y distribución actualizada de Centruroides tecomanus Hoffmann, 1931 (Scorpiones: Buthidae). Ciencia Nicolaita, 52, 179–189.

QGIS.org. (2021). QGIS Geographic Information System. Open-Source Geospatial Foundation Project. http://qgis.org

Ramírez-Ruiz, J. J., & Bretón-González, M. (2016). Fisiografía y geología. In La Biodiversidad en Colima. Estudio de estado (Eds.) (pp. 25–31). México D.F.: Conabio.

Romero-Gutiérrez, T., Peguero-Sánchez, E., Cevallos, M. A., Batista, C. V. F., Ortiz, E., & Possani L. D. (2017). A deeper examination of Thorellius atrox scorpion venom components with omics technologies. Toxins, 9, 399. https://doi.org/10.3390/toxins9120399 

Ruiz-Vega, M. L., Hernández-Canchola, G., & León-Paniagua, L. (2018). Molecular systematics and phylogeography of the endemic Osgood’s deermouse Osgoodomys banderanus (Rodentia: Cricetidae) in the lowlands of western Mexico. Molecular Phylogenetics and Evolution, 127, 867–877. https://doi.org/10.1016/j.ympev.2018.06.034 

Santibáñez-López, C. E., Francke, O. F., & Córdova-Athanasiadis, M. (2011). The genus Diplocentrus Peters (Scorpiones: Diplocentridae) in Morelos, Mexico. Revista Ibérica de Aracnología, 19, 3–3.

Santibáñez-López, C. E., Francke, O. F., & Prendini, L. (2014). Phylogeny of the North American scorpion genus Diplocentrus Peters, 1861 (Scorpiones: Diplocentridae) based on morphology, nuclear and mitochondrial DNA. Arthropod Systematics & Phylogeny, 72, 257–279. https://doi.org/10.3897/asp.72.e31789 

Santibáñez-López, C., Francke, O., Ureta, C., & Possani, L. (2015). Scorpions from Mexico: from species diversity to venom complexity. Toxins, 8, 1–18. https://doi.org/10.3390/toxins8010002 

Schaffrath, S., & Predel, R. (2014). A simple protocol for venom peptide barcoding in scorpions. EuPA Open Proteomics, 3, 239–245. https://doi.org/10.1016/j.euprot.2014.02.017 

Schramm, F. D., Valdez-Mondragón, A., & Prendini, L. (2021). Volcanism and palaeoclimate change drive diversification of the world’s largest whip spider (Amblypygi). Molecular Ecology, 30, 2872–2890. https://doi.org/10.1111/mec.15924 

Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., & Flook, P. K. (1994). Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America, 87, 651–700. https://doi.org/10.1093/aesa/87.6.651 

Sissom, W. D. (2000). Family Vaejovidae Thorell, 1876. In V. Fet, W. D. Sissom, G. Lowe, & M. E. Braunwalder (Eds.), Catalog of the scorpions of the World (1758–1998) (pp. 503–553). New York: New York Entomological Society.

Towler, W. I. I., Ponce-Saavedra, J., Gantenbein, B., & Fet, V. (2001). Mitochondrial DNA reveals a divergent phylogeny in tropical Centruroides (Scorpiones: Buthidae) from Mexico. Biogeographica, 77, 157–172.

Valdez-Velázquez, L. L., Olamendi-Portugal, T., Restano-Cassulini, R., Zamudio, F. Z., & Possani, L. D. (2018). Mass fingerprinting and electrophysiological analysis of the venom from the scorpion Centruroides hirsutipalpus (Scorpiones: Buthidae). Journal of Venom Animal Toxins Including Tropical Diseases, 24, 17. https://doi.org/10.1186/s40409-018-0154-y 

Valdez-Velázquez, L. L., Quintero-Hernández, V., Romero-Gutiérrez, M. T., Coronas, F. I., & Possani, L. D. (2013). Mass fingerprinting of the venom and transcriptome of venom gland of scorpion Centruroides tecomanus. Plos One, 8, e66486. https://doi.org/10.1371/journal.pone.0066486 

Valdez-Velázquez L. L., Romero-Gutiérrez M. T., Delgado-Enciso, I., Dobrovinskaya, O., Melnikov, V., Quintero-Hernández, V. et al. (2016). Comprehensive analysis of venom from the scorpion Centruroides tecomanus reveals compounds with antimicrobial, cytotoxic, and insecticidal activities. Toxicon, 118, 95-103. https://doi.org/10.1016/j.toxicon.2016.04.046 

Williams, S. C. (1980). Scorpions of Baja California, Mexico and adjacent islands. Occasional Papers of the California Academy of Sciences, 135, 1–127.

Williams, S. C. (1986). A new species of Vaejovis from Jalisco, Mexico (Scorpiones: Vaejovidae). Pan-Pacific Entomologist, 62, 355–358.

José G. Palacios-Vargas ^a, Erika Rivero-Sánchez ^a, Yan Gao ^b, Margarita Ojeda ^a, *

^a Universidad Nacional Autónoma de México, Facultad de Ciencias, Departamento de Ecología y Recursos Naturales, Laboratorio de Ecología y Sistemática de Microartrópodos, Circuito Exterior s/n, Ciudad Universitaria, Coyoacán, 04510 Mexico City, Mexico

^b China Shanghai Natural History Museum, Shanghai Science & Technology Museum, Shanhaiguan Road, Jing’an district, Shanghai 200041, China 

*Corresponding author: margojeda@gmail.com (M. Ojeda)

Received: 21 November 2023; accepted: 12 April 2024

http://zoobank.org/urn:lsid:zoobank.org:pub:7688F4F2-2A36-42D5-83D8-657DDB3F3AE8 

Abstract

As a result of 40 years of work and many projects on soil fauna and especially springtails, a collection of edaphic microarthropods has been established at the Facultad de Ciencias, UNAM, and has the name of “Colección de ácaros y colémbolos del Laboratorio de Ecología y Sistemática de Microartrópodos”. During the revision of material belonging to the subfamily Pseudachorutinae kept in the Collembola collection, we obtained 581 records of 28 species of Pseudachorutes, from 20 states and 62 localities from Mexico. Three are new records: P. ca. algidensis, P. ca. crassus, and P. reductus, and 5 new species from soil, litter and epiphytic plants in Mexico are described and illustrated herein: P.tabasquensis sp. nov., P. mexicanus sp. nov., P. chichinautzin sp. nov., P. tillandsiodes sp. nov., and P.veracruzensis sp. nov. 

Keywords: Springtails; Records; Distribution; Taxonomy

© 2024 Universidad Nacional Autónoma de México, Instituto de Biología. Este es un artículo Open Access bajo la licencia CC BY-NC-ND

(http://creativecommons.org/licenses/by-nc-nd/4.0/).

Cinco especies nuevas de Pseudachorutes (Collembola: Neanuridae) de México

Resumen

Como resultado del trabajo de más de 40 años y diversos proyectos sobre la fauna del suelo, especialmente colémbolos, se estableció en la Facultad de Ciencias, UNAM, una colección de microartrópodos edáficos, registrada con el nombre de “Colección de ácaros y colémbolos del Laboratorio de Ecología y Sistemática de Microartrópodos”. Durante la revisión del material depositado en ella, especialmente de la subfamilia Pseudachorutinae, se obtuvo información de 581 registros de 28 especies de Pseudachorutes distribuidos en 20 estados y 62 localidades del país. De éstas, 3 son nuevos registros (P. ca. algidensis, P. ca. crasus y P. reductus) y 5 son especies nuevas provenientes de suelo, hojarasca y plantas epífitas en México, que se describen e ilustran aquí: P.tabasquensis sp. nov., P. mexicanus sp. nov., P. chichinautzin sp. nov., P. tillandsiodes sp. nov. y P.veracruzensis sp. nov. 

Palabras clave: Colémbolos; Registros; Distribución; Taxonomía

Introduction

The genus Pseudachorutes Tullberg, 1871 (Neanuridae: Pseudachorutinae) was based on the type species Pseudachorutes subcrassus Tullberg, 1871 characterized by: 1) ocelli 8+8; 2) postantennal organ in one circle or ellipse; 3) Ant. III and IV dorsally fused, Ant. IV generally with 6 sensilla and apical bulb, Ant. III organ with 2 microsensilla in a cuticular fold, 2 guard sensilla and one microsensillum; 4) bucal cone sharp, mandible with 2 or more teeth, maxilla styliform; 5) unguiculus absent; 6) furcula usually well developed, mucro present; 7) sixth abdominal segment always visible in dorsal view, anal spines absent (Christiansen & Bellinger, 1998; Fjellberg, 1998; Palacios-Vargas, 1990).

Currently there are 119 species of Pseudachorutes in the world (Bellinger et al., 2023), and for Mexico records of 20 species from 18 states are known (Arango-Galván et al., 2007; Cutz-Pool et al., 2003, 2007a, b, 2008; Palacios-Vargas, 1997, 2005; Palacios-Vargas & Castaño-Meneses, 2003; Palacios-Vargas et al., 2000, 2007; Vázquez, 1988; Vázquez & Palacios-Vargas, 1990, 2004). The genus is found in great abundance in many ecosystems and biotopes, including soil, litter, mosses, epiphytic plants and even the forest canopy. 

During a recent project to study a collection of the subfamily Pseudachorutinae housed in the Collembola collection of the Laboratorio de Ecología y Sistemática de Microartrópodos (LESM), we found 5 new species of Pseudachorutes and their descriptions and illustrations are given herein.

Materials and methods

Examination of the material deposited in the LESM scientific collection “Colección de ácaros y colémbolos” (register number D.F.-ENT-229-09-09, issued by Subsecretaría de Gestión para la Protección Ambiental, Dirección de Vida Silvestre) was made to separate all the specimens of the genus Pseudachorutes.The specimens are permanently mounted in Hoyer’s medium slides. Measurements are presented as the range with means in parentheses and expressed in micrometers (µm). Drawings were made with the aid of a phase contrast microscope Carl Zeiss Standard 3 K7, equipped with a drawing tube. The full body scales correspond to 500 µm, and the rest of the structures to 100 µm.

Type specimens are deposited in the LESM. The chaetotaxy system follows that of Jordana et al. (1997). Abbreviations used in this paper are: Ant. = antennal segment (s), Abd. = abdominal segment (s), PAO = postantennal organ, sgd = dorsal guard sensillum, sgv = ventral guard sensillum, Th. = thoracic segment (s). 

Descriptions

Class Collembola Lubbock, 1870 

Order Poduromorpha Börner, 1913

Family Neanuridae Börner, 1901

Subfamily Pseudachorutinae Börner, 1906

Genus Pseudachorutes Tullberg, 1871

New records

Pseudachorutes ca. algidensis Carpenter, 1925. Mexico: Hidalgo: Mineral El Chico, 2,900 m asl, 1 specimen, ex Tillandsia violacea, 10-IX-1998, J.A. Monterrubio, col. Pseudachorutes ca. crassus da Gama, 1964. Mexico: Popocatépetl, 3,800 m asl, 1 specimen, ex litter, 29-I-1983, J.G. Palacios, col. Pseudachorutes reductus Thibaud & Massoud, 1983. Mexico: Veracruz: Estación de Biología Tropical, Los Tuxtlas, 8 specimens, 20-X-1997, J. Álvarez, col. Tamaulipas: Rancho El Cielo, 975 m asl, 1 specimen, ex soil, XI-1987, F. J. Villalobos, col. 

Pseudachorutes tabasquensis sp. nov. 

(Fig. 1 A-L, Table 1a-c)

http://zoobank.org/urn:lsid:zoobank.org:act:C3BDFC0D-8F06-41F2-83317E7904656BB5 

Description. Body length (n = 7): 2,625 µm (range: 1,250-4,000 µm). Body color gray-violet, with dark eyes patches. Granulations are fine and homogenous. Body setae simple and smooth, but with 2 kinds of setae, long macrosetae (M 22-24 µm) and short microsetae (m 10-12 µm), the sensorial setae relatively long (54-56 µm) (Fig. 1 A, B). 

Figure 1. A-L. Pseudachorutes tabasquensis sp. nov. A) Dorsal chaetotaxy from head to Th. III; B) dorsal chaetotaxy from Abd. III. to Abd. VI; C) Ant. III-IV right antenna, dorsal view; D) Ant. III-IV right antenna, ventral view; E) PAO and nearby eyes; F) mandible; G) maxilla; H) labium; I) femur, tibiotarsus, and unguis III; J) dens and mucron; K) female genital plate; L) male genital plate.

Table 1

Pseudachorutes tabasquensis sp. nov. a) Head chaetotaxy, b) dorsal chaetotaxy, c) main characters between P. orghidani, P. conicus, and P. tabasquensis sp. nov.

1a.
	sd	d	oc	c	p
Number of setae	5	4+1	3	1	4
Setae absent					c1, c3, c4
1b.
	a	m	p	Setae absent
Th. I	–	3	–			m2
Th. II	4	2	5	a5		m5
Th. III	3	2	5	a2, a5		m5
Abd. I-III	4	–	5	a2
Abd. IV	4	–	6
Abd. V	4	–	4
Abd. VI	2	2	2+1
1c.
Characters	P. conicus	P. tabasquensis sp. nov.	P. orghidani
Labium setae L	–			+			?
Ant. IV sensilla	5			6			5
Ventral tube setae	3+3			4+4			?
Mandible teeth	3			2			3
Ventral file on Ant. IV	–			25-30 short setae	25-30 cuniform
Vesicles of PAO	13-15			13-17			17

Antennae as long as head. Ant. I with 7 setae, Ant. II with 11 setae. Ant. III and IV dorsally fused. Ant. segments ratio I: II: III+IV as 1: 1; 1.8. Ant. III-organ with 2 small straight internal sensilla under a cuticular fold, 2 guard sensilla (sgv about 1.4 times as long as sgd) and 1 microsensillum close to ventral guard sensillum. Ant. IV with trilobed apical bulb, 6 cylindrical sensilla, seta “i”, and one subapical organite (Fig. 1C), ventral file with 25-30 short and strongly spine-like setae (Fig. 1D). PAO elliptical composed of 13-17 simple vesicles, 0.9 times smaller than the nearest eyes (Fig. 1E). 8+8 eyes, F, G are 0.7 times smaller than others. Buccal cone elongated. Mandible with 2 slender teeth (Fig. 1F). Maxilla styliform, with 2 blades, one has an apical tooth, another has 2 apical teeth (Fig. 1G). Labium with normal chaetotaxy of the genus from setae A to G and 4 lateral setae. Setae L spine-shape (Fig. 1H). 

Dorsal chaetotaxy as in figure 1A-B, table 1a, b. Seta a0 on the head absent, unpaired seta d1 present, sometimes, one additional seta d3’ between the seta d3 present. Th. I with 3+3 setae, plus 1+1 lateral. Seta a2 present on Th. II, but absent from Th. III to Abd. V. Sensorial setae s on the body in position of p4 and m6 on the thoracic segments II and III, and p5 from Abd. I to IV and p2 on Abd. V. Sensorial formula of the body 022/11111. Sensorial setae 2 times as long as the macrosetae. The ratio of the largest Abd. V setae and inner unguis length is 1.0. Thoracic sterna without setae.

Legs setation from I to III is, tibiotarsi 19, 19, 18, without tenent hairs; Femora 10, 10, 11, one ventro-proximal seta is an acuminate tenent hair; trochanters with 5,5,5; coxae 3, 7, 7; subcoxae 2: 0, 2, 2; subcoxae 1: 1, 2, 2. Unguis wide with one inner tooth near 1/3 part from the basal, and a weakly subbasal lateral tooth. Ratio of tibiotarsus III and unguis about 1.6. Unguiculus absent (Fig. 1I). 

Furcula is well developed. Dens dorsally with 6 setae, ventral with a smooth area. Mucro straight, 1.8 times shorter than dens, with granulations and 2 small lamellae (Fig. 1J). Tenaculum with 3+3 teeth. Ventral tube with 4+4 setae. Female genital plate with 3+3 pregenital setae, 6-14 circumgenital setae and 1+1 eugenital setae (Fig. 1K). Male genital plate with 3+3 pregenital setae, 25 circumgenital setae and 4+4 eugenital setae (Fig. 1L).

Taxonomic summary

Type material. Holotype: male mounted on a slide (FC-UNAM: LESM-AC: 23013). 5 paratypes females and 1 juvenile mounted on slides (FC-UNAM: LESM-AC: 23014-23019), same data as holotype.

Type locality. Mexico, Tabasco, Tapijulapa, outside cave “Las Sardinas”, ex litter, 14-III-2002, D.A. Estrada col. 

Etymology. The name is locative for the state of Tabasco where the type locality is. 

Remarks

Pseudachorutes tabasquensis sp. nov. shares with P. orghidani Massoud & Gruia, 1973 the presence of 1 internal and 1 lateral tooth on unguis. The new species also resembles P. conicus Lee & Kim, 1994 from Korea due to the presence of 2 types of body setae. They all share a similar number of PAO vesicles (Table 1c), dens with 6 setae and tenaculum with 3+3 teeth. Main differences between them are shown in Table 1c. Additionally, P. conicus has a very long and thin unguis, but in P. tabasquensis it is short and thick.

Pseudachorutes mexicanus sp. nov. 

(Fig. 2A-K, Table 2a-b)

http://zoobank.org/urn:lsid:zoobank.org:act:96997B68-
7B09-4EC1-9563-2D3DF01AEA77 

Description. Body length (n = 17): 814 µm (range: 470-1,350 µm). Color of the body gray-violet, with a dark eyes patch. Granulations are fine and homogenous. Posterior setae of body long and capitated (Fig. 2A). 

Antennae as long as head. Ant. I with 7 setae, Ant. II with 11 setae. Ant. III and IV dorsally fused. Ant. segments ratio I: II; III+IV as 1: 1.4; 3.2. Ant. III-organ with 2 small straight internal sensilla under a cuticular fold, 2 guard sensilla (sgv about 1.2 times as long as sgd) and 1 microsensillum close to ventral guard sensillum. Ant. IV with simple apical bulb, 6 cylindrical sensilla, seta “i”, 1 microsensillum and 1 subapical organite (Fig. 2B), ventral file poorly developed, with 20-35 short setae (Fig. 2C). PAO elliptical composed of 5-6 simple vesicles, 1.1 times as long as the nearest ocelli (Fig. 2D). 8+8 small ocelli, F, G are 0.9 times smaller than others. Buccal cone short. Mandible with 2 slender teeth (Fig. 2E). Maxilla with 2 blades, each has 2 apical teeth (Fig. 2F). Labium with normal chaetotaxy of the genus from setae A to G and 4 lateral setae, setae L spine-shape (Fig. 2G). 

Dorsal chaetotaxy as in figure 2A, table 2b. Seta a0 on head absent, unpaired seta d1 present. Th. I with 3+3 setae. Setae a2 present on Th. II, but absent from Th. III to Abd. V. Sensory setae s on the body in position of p4 and m6 on Th. II and III, and p5 from Abd. I to IV and p2 on Abd. V. Sensorial formula of the body 022/11111. Sensory setae longer than 1.1-1.5 times as long as body setae. Ratio of largest Abd. V setae and inner unguis length is 1.4. Thoracic sterna without setae. Ventral tube with 4+4 setae. Female genital plate with 2+2 pregenital setae, 4-9 circumgenital setae and 1+1 eugenital setae (Fig. 2H). Male genital plate with 3+3 pregenital setae, 10 circumgenital setae and 4+4 eugenital setae (Fig. 2I). 

Tibiotarsi I, II, III with 18, 18, 17 setae respectively, with 1 tenent hair long and capitate (Fig. B8). Femora I, II, III with 9, 9, 10 setae respectively. Trochanters with 5 setae each. Coxae I, II, III with 3, 7, 7 setae respectively. Subcoxae 2 I, II, III with 0, 2, 2 setae respectively. Subcoxae 1. I, II, III with 1, 2-3, 2-3 setae respectively. Unguis wide with 1 weakly apical inner tooth. Ratio of tibiotarsus III and unguis about 1.0. Unguiculus absent (Fig. 2J). 

Furcula well developed. Dens dorsally with 5 setae. Mucro straight, 3 times shorter than dens, with two larger bladder-like swelling visible and a hook-like end (Fig. 2K). Tenaculum with 3+3 teeth.

Figure 2. A-K. Pseudachorutes mexicanus sp. nov. A) Dorsal chaetotaxy from head to abdomen VI; B) Ant. III-IV right antenna, dorsal view; C) Ant. III-IV right antenna, ventral view; D) PAO and nearby eye; E) mandible; F) maxilla; G) labium; H) female genital plate; I) male genital plate; J) femur, tibiotarsus, and unguis III; K) furcula and tenaculum.

Taxonomic summary

Type material. Holotype: female mounted on a slide (FC-UNAM: LESM-AC: 22996). 16 paratypes: 4 females, 1 male and 11 juveniles under slides (FC-UNAM: LESM-AC: 22997-23012), same data as holotype.

Type locality. Mexico, Hidalgo, Mineral El Chico, 10-IX-98, J.A. Monterrubio, col. Ex Tillandsia violacea.

Etymology. The name of the new species is after the country of the type locality: Mexico.

Remarks

This species resembles P. americanus Stach, 1949 with a similar number of vesicles in PAO (P. americanus with 5-8 vesicles), unguis with 1 minute tooth near apex, one large, clavate tenent hair, ventral tube with 4+4 setae, tenaculum with 3+3 teeth and posterior abdominal setae clearly capitate. However, dens of the new species with 5 setae, maxilla with 2 blades and each has 2 apical teeth, 6 cylindrical sensilla on Ant. IV and a poorly developed ventral file with 20-35 short setae is different from P. americanus. 

Pseudachorutes chichinautzin sp. nov. 

(Fig. 3A-J, Table 3a-c)

http://zoobank.org/urn:lsid:zoobank.org:act:1098FF48-F5CE-4D51-8F9E-0EB9E217AA40 

Description.Body length (n = 8): 1,904 µm (range: 850-2,010 µm). Color of the body gray-violet, with a dark eyes patch. Granulations homogenous. Lateral and posterior body setae are longer and truncate (Fig. 3A). 

Table 2

Pseudachorutes mexicanus sp. nov. a) Head chaetotaxy, b) dorsal chaetotaxy.

2a.
	sd	d	oc	c	p
Number of setae	5	4+1	3	4	4
2b.
	a	m	p	Setae absent
Th. I	–	3	–			m2
Th. II	4	3	5	a4
Th. III	3	3	5
Abd. I-III	3	2	5
Abd. IV	4	–	5
Abd. V	3	–	4
Abd. VI	2	2	2+1

Antennae as long as head. Ant. I with 7 setae, Ant. II with 12 setae. Ant. III and IV dorsally fused. Ant. segments ratio I: II; III+IV as 1: 1.2: 2.0. Ant. III-organ with 2 small internal sensilla under a cuticular fold, 2 guard sensilla (sgv about 1.1 times as long as sgd) and 1 microsensillum close to ventral guard sensillum. Ant. IV with trilobed apical bulb, 6 cylindrical sensilla, seta “i”, and one subapical organite (Fig. 3B), ventral file with about 10 strong, spine-like setae and several slender, normal setae (Fig. 3C). Some setae on Ant. IV are blunt. PAO elliptical composed of 10-12 vesicles, sometimes, 1 or 2 of them inside in the others, subequal to nearest eyes (Fig. 3D). 8+8 eyes, F, G are 0.7 times smaller than others. Buccal cone elongated. Mandible is not clearly detected, about 2 or 3 slender teeth. Maxilla with 2 blades and one has an apical tooth, and the other styliform (Fig. 3E). Labium with normal chaetotaxy of the genus from setae A to G and 5 lateral setae, setae L spine-shape (Fig. 3F). 

Dorsal chaetotaxy as in Fig. 3A, table 3a, b. Seta a0 on the head absent, unpaired seta d1 present. Th. I with 3+3 setae, plus 1+1 lateral. Setae a2 present on Th. II, but absent from Th. III to Abd. V. Sensorial setae s on the body in position of p4 and m6 on the thoracic segments II and III, and p5 from Abd. I to IV and p3 on Abd. V. Sensorial formula of the body 022/11111. Sensorial setae 1.2-1.7 times as long as the normal setae. The lateral setae of the body longer and blunt. Ratio of largest Abd. V setae and inner unguis length is 1.0. Thoracic sterna without setae. Ventral tube with 4+4 setae. Female genital plate with 3+3 pregenital setae, 9 circumgenital setae and 1+1 eugenital setae (Fig. 3G). Male genital plate with 3+3 pregenital setae, 8 circumgenital setae and 4+4 eugenital setae (Fig. 3H). 

Leg setation from I to III, is tibiotarsi 19, 19, 18, with 1 acuminate tenent hair a little longer than others; femora 9, 9,10, one ventro-proximal seta is an acuminate tenent hair; trochanters with 5,5,5; coxae 3, 7, 7; subcoxae 2: 0, 2, 2; subcoxae 1: 1, 2, 2. Unguis wide, with one inner tooth near 1/3 part from the basal. Sometimes, a pair of weakly subbasal lateral tooth is present. Ratio of tibiotarsus III and unguis about 1.6. Unguiculus absent (Fig. 3I). 

Figure 3. A-J. Pseudachorutes chichinautzin sp. nov. A) Dorsal chaetotaxy; B) Ant. III-IV right antenna, dorsal view; C) Ant. III-IV right antenna, ventral view; D) PAO, eye patch and ocular setae; E) maxilla; F) labium; G) female genital plate; H) male genital plate; I) femur, tibiotarsus, and unguis III; J) furcula and tenaculum.

Furcula well developed. Dens dorsally with 6 setae, ventral with fine granulate. Mucro straight, 1.7 times shorter than dens, with 2 big lamella and a clearly hook-like end. Tenaculum with 3+3 teeth (Fig. 3J).

Taxonomic summary

Material examined. Holotype: female under slide (FC-UNAM: LESM-AC: 22974). 7 paratypes: 4 females, 2 males and 1 juvenile under slides, same data as holotype (FC-UNAM: LESM-AC: 22975-22981).

Type locality. Mexico; Morelos, Derrame Chichinautzin. 12-IX-1976. J. Palacios, col. Ex. Tillandsia prodigiosa.

Etymology. The name is that of the Chichinautzin lava flow (state of Morelos), as a noun of type locality.

Remarks

Pseudachorutes chichinautzin sp. nov. shares with P. orghidani and P. subcrassus Tullberg, 1871 the presence of 1 internal and 1 pair of lateral teeth on unguis. The new species also resembles P. tabasquensis sp. nov. with 2 types of body setae, Ant. IV with 6 sensilla, trilobed apical bulb. Dens with 6 setae and tenaculum with 3+3 teeth. Main differences between them can be seen in table 3c.

Table 3

Pseudachorutes chichinautzin sp. nov. a) Head chaetotaxy, b) dorsal chaetotaxy, c) main characters between P. orghidani, P. subcrassus, P. chichinautzin sp. nov. and P. tabasquensis sp. nov.

3a.
	sd	d	oc	c	p
Number of setae	5	4+1	3	2	4
Setae absent				c1, c4
3b.
	a	m	p	Setae absent
Th. I	–	3	–		m2
Th. II	4	2	5	a5	m4
Th. III	3	2	5	a2, a5	m4
Abd. I-III	3	–	5	a2, a5
Abd. IV	3	–	5	a2, a3, a5
Abd. V	3	–	3	a2		P2
Abd. VI	2	2	2+1
3c.
Characters	P. subcrassus	P. chichinautzin sp. nov.	P. tabasquensis sp. nov.	P. orghidani
Ant. IV sensilla	5-6	6	6	5
Mandible teeth	4	2-3	2	3
Ventral file on Ant. IV	20	10 strong setae	25-30 short setae	25-30 cuniform
Vesicles of PAO	8-10	10-12	13-17	17
Lateral blunt setae	–	+	–	+

Pseudachorutes tillandsiodes sp. nov. 

(Fig. 4A-K, Table 4a-c)

http://zoobank.org/urn:lsid:zoobank.org:act:9FFB9169-78E7-4BA3-8C9A-8F3EBEA4DD10 

Description. Body length (n = 6): 2,260 µm (range: 1,750-2,860 µm). Color of the body violet, with a white strip from Th. I to Th. II and a dark eyes patch. Granulations fine and homogenous. Body with simple and spine-like setae, p row longer on last abdominal segments (24-40 µm), long sensorial setae (75-100 µm) (Fig. 4A, B). 

Antennae shorter than head, 155 µm and 180 µm respectively. Ant. I with 7 setae Ant. II with 12 setae. Ant. III and IV dorsally fused. Ant. segments ratio I: II; III+IV as 1: 1; 1.9. Ant. III-organ with 2 small curving sensilla under a cuticular fold, 2 guard sensilla (sgv is about 1.4 times as long as sgd) and 1 microsensillum close to ventral guard sensillum. Ant. IV with trilobed apical bulb, 6 thin and cylindrical sensilla, seta “i”, one microsensillum and one subapical organite (Fig. 4C), ventral side with about 20 setae with some thick and spine-like (Fig. 4D). PAO elliptical composed of 14 vesicles, 1.2 times as long as the nearest eyes. 8+8 eyes, F, G 0.9 times as big as others (Fig. 4E). Buccal cone elongated. Mandible has 2 big teeth, the apical with clearly 3 small teeth (Fig. 4F). Maxilla with 2 blades, one with 2 apical teeth (Fig. 4G). Labium with normal chaetotaxy of the genus from setae A to G and 4 lateral setae, setae L reduced to a minus spine, difficult to see (Fig. 4H).

Dorsal chaetotaxy as in figure 4A, B, table 4a, b. Seta a0 on head absent, unpaired seta d1 present. Th. I with 3+3 setae. Setae a2 present on Th. II, but absent from Th. III to Abd. V. m5 present on Th. II to Th. III. Sensorial setae on body in position of p4 and m6 on thoracic segments II and III, p5 from Abd. I to IV and p2 on Abd. V. Sensorial formula of the body 022/11111. Sensorial setae 2.5-4.0 times as long as the normal setae. Ratio of largest Abd. V setae and inner unguis length is 0.6. Thoracic sterna without setae. Ventral tube with 4+4 setae. Female genital plate with 3+3 pregenital setae, 9 circumgenital setae and 1+1 eugenital setae (Fig. 4I). No males were found.

Figure 4. A-K. Pseudachorutes tillandsiodes sp. nov. A) Dorsal chaetotaxy from head to Th. III; B) dorsal chaetotaxy from Abd. III. to Abd. VI; C) Ant. III-IV right antenna, dorsal view; D) Ant. III-IV right antenna, ventral view; E) PAO, eye patch and ocular setae; F) mandible; G) maxilla; H) labium; I) female genital plate; J) femur, tibiotarsus, and unguis III; K) dens and mucron.

Leg setation from I to III, is tibiotarsi 19, 19, 18, no tenent hair; femora 9, 10, 10, one ventro-proximal seta is an acuminate tenent hair; trochanters with 5,5,5; coxae 3, 7, 8; subcoxae 2: 0, 2, 2; subcoxae 1: 1, 2, 2. Unguis with one clearly inner tooth at the basal side. Ratio of tibiotarsus III and unguis about 1.5. Unguiculus absent (Fig. 4J). 

Furcula well developed. Dens dorsally with 6 setae, ventral with fine granulations. Mucro straight, 2.2 times shorter than dens, with 2 thin but long lamella, without hook-like end (Fig. 4K). Tenaculum with 3+3 teeth.

Table 4

Pseudachorutes tillandsiodes sp. nov. a) Head chaetotaxy, b) dorsal chaetotaxy, c) main characters between P. gilvusi, and P. tillandsiodes sp. nov. 

4a.
	sd	d	oc	c	p
Number of setae	5	4+1	3	4	4
4b.
	a	m	p	Setae absent
Th. I	–	3	–		m2
Th. II	5	2	5		m4
Th. III	4	2	5	a2	m4
Abd. I-III	4	–	5	a2
Abd. IV	4	–	5	a2
Abd. V	4	–	3			P4
Abd. VI	2	2	2+1
4c.
Characters	P. gilvus	P. tillandsiodes  sp. nov.
Setae d1 on head	1+1	1
Setae number on Th. I	2+2	3+3
Setae a2 on Th. II	–	+
Ant. IV sensilla	7	6
Ventral tuve setae	3+3	4+4

Taxonomic summary

Material examined. Holotype: female under slide (FC-UNAM: LESM-AC: 23172). 5 Paratypes: 4 female and 1 juvenile (FC-UNAM: LESM-AC: 23173-23177). 

Type locality. Mexico; Hidalgo, Mineral El Chico. 10-IX-98. J. A. Monterrubio, col. Ex Tillandsia violacea.

Etymology. The name is taken from the epiphytic genus Tillandsia (Bromeliacea) habitat where the species was found.

Remarks

Pseudachorutes tillandsiodes sp. nov. resembles P. gilvus Oliveira & Deharveng, 1995 with white strips and long sensilla on the body, similar number of postantennal organ vesicles (P. gilvus with 11-15 vesicles), unguis with 1 inner tooth, tibiotarsi I-III with 19, 19, 18 setae and dens with 6 setae. The main differences between them are shown in table 4c. However, P. gilvus has 3 white stripes on the body: the first on the posterior part of head and the middle of Th. I, the second on the mesothorax and the third on Abd. I-II; P. tillandsiodes sp. nov. only with 1 white stripe from Th. I to Th. II.

Pseudachorutes veracruzensis sp. nov. 

(Fig. 5A-L, Table 5a, b)

http://zoobank.org/urn:lsid:zoobank.org:act:2C15B37C-080B-4DF9-AD8E-9AE899AEA907 

Material examined. Holotype: female under slide (FC-UNAM: LESM-AC: 2133a). 10 paratypes: 7 females and 3 males under slides, same data as holotype (FC-UNAM: LESM-AC: 2131a-2132c, 2132a-2132e, 2133b, 2133c)

Type locality. Mexico; Veracruz, Xalapa, La Herradura. 26-IX-26-10/1998, ex Bosque Mesófilo de Montaña, J. Márquez, col.

Description. Body length (n = 11): 1,900 (range: 1,050-3,400 µm). Color body violet, with a dark eyes patch. Granulations fine and homogenous. Body with short and simple setae (10-12), some of them longer in abdomen segments, especially on 4^th segment (22-26 µm), long sensorial setae (67-75 µm) (Fig. 5A). 

Antennae little shorter than head, 100 µm and 105 µm, respectively. Ant. I with 7 setae, Ant. II with 12 setae. Ant. III and IV dorsally fused. Ant. segments ratio I: II; III+IV as 1: 1; 2. Ant. III-organ with 2 small straight sensilla under a cuticular fold, 2 guard sensilla (the sgv is about 1.1 times as long as sgd) and 1 microsensillum close to ventral guard sensillum. Ant. IV dorsally with trilobed apical bulb, 6 thin and cylindrical sensilla, seta “i”, 1 microsensillum and 1 subapical organite (Fig. 5B), ventral side has a distinct ventral file with about 40 short setae (Fig. 5C). PAO elliptical composed of 17-20 vesicles, 1.5 times as long as the nearest eyes. 8+8 eyes, F, G 0.8 times as big as others (Fig. 5D). Buccal cone elongated. Mandible has 2-3 big teeth (Fig. 5E). Maxilla with 1 blade and 2 apical teeth (Fig. 5F). Labium with normal chaetotaxy of the genus from setae A to G and 3 lateral setae, one longer spine-like setae present at the place of setae L (Fig. 5G).

Dorsal chaetotaxy as in figure 5A and table 5a,b. Seta a0 on head absent, unpaired seta d1 present. Th. I with 3+3 setae. Setae a2 present on Th. II, but absent from Th. III to Abd. IV. m5 present on Th. II to Th. III. Sensorial setae s on the body in position of p4 and m6 on Th. II and III, p5 from Abd. I to IV and p2 on Abd. V. Sensorial formula of the body 022/11111. Sensorial setae 6.5-7.0 times as long as the shorter setae. The ratio of the largest Abd. V setae and inner unguis length is 0.5. Thoracic sterna without setae. Ventral tube with 4+4 setae. Female genital plate with 3+3 pregenital setae, 7 circumgenital setae and 1+1 eugenital setae (Fig. 5H). Male genital plate with 2+2 pregenital setae, 16 circumgenital setae and 4+4 eugenital setae (Fig. 5I). 

Leg setation from I to III, is tibiotarsi 19, 19, 18, no tenent hairs; femora 13, 11, 10, one ventro-proximal seta is an acuminate tenent hair; trochanters with 6,6,5; coxae 3, 7, 8; subcoxae 2: 0, 2, 2; subcoxae 1: 1, 2, 2. Unguis with 1 big and 1 small inner tooth together with 2 pairs of lateral teeth (Fig. 5J). Ratio of tibiotarsus III and unguis about 1.4. Unguiculus absent (Fig. 5K). 

Furcula well developed. Dens dorsally with 6 setae, ventral granulate. Mucron granulated with broad and long lamella, 1 slightly hook-like end, 2.0 times shorter than dens (Fig. 5L). Tenaculum with 3+3 teeth. 

Etymology. The name is a locative for the State of Veracruz where the type locality is found.

Remarks

Pseudachorutes veracruzensis sp. nov. resembles P. orghidani with granules on mucron and dens with 6 setae, mandible with 3 teeth, unguis with lateral teeth, similar number of PAO (P. orghidani with 17 vesicles) and ventral file on Ant. IV. The main difference between the species is the shape of short setae in the ventral file (P. orghidani has small setae with apex truncate) and number of sensilla on Ant. IV (P. orghidani with 5) and the teeth on unguis (P. orghidani only with 1+1 lateral teeth). 

Discussion

After revision and analysis of the material deposited in the LESM collection, we were able to update the knowledge of genus Pseudachorutes in Mexico, describing 5 new species: P. tabasquensis sp. nov., P. veracrucensis sp. nov., P. tillandsiodes sp. nov., P. chichinautzin sp. nov., and P. mexicanus sp. nov. Three new records for the country are added, for the following species: P. ca. algidensis from Hidalgo, P. ca. crassus from Estado de México, these must be confirmed with the collection of more specimens that will allow the species to be fully determined. For now, this information is presented as an element to show the richness of species of the genus in the country. Pseudachorutes reductus has a distribution in the Antilles and southern Florida, the new records in Mexico extend its distribution area and confirm the affinity of the species to the Atlantic area. Total records for Pseudachorutes is increased to 28 species, from 20 states and 62 localities within the country. Quintana Roo and Hidalgo were the states with the highest number of species present (11 and 10, respectively), followed by Morelos, Estado de México, Puebla, Veracruz, and Guerrero (8, 7, 6, 6, and 4 species recorded in each one), 6 states have 3 species, 5 have 2 and Querétaro and San Luis Potosí only have 1 species recorded. Three species are widely distributed in Mexico: P. corticolus, P. simplex, and P. subcrassoides. Diversity of the genus in Mexico is around 21% of the total known worldwide, and therefore the country becomes one with the greatest number of species present. 

Figure 5. A-L. Pseudachorutes veracruzensis sp. nov. A) Dorsal chaetotaxy; B) Ant. III-IV right antenna, dorsal view; C) Ant. III-IV right antenna, ventral view; D) PAO, eye patch and ocular setae; E) mandible; F) maxilla; G) labium; H) female genital plate; I) male genital plate; J) femur, tibiotarsus, and unguis III; K) unguis III, ventral view; L) dens and mucron.

Regarding biotopes where the species preferably live, we found that litter, epiphytic plants, soil, mosses and decaying wood are the most suitable habitats for this springtail. However, sand, canopy, wood, caves and anthills are also microhabitats used by some species.

Table 5

Pseudachorutes veracruzensis sp. nov. a) Head chaetotaxy, b) dorsal chaetotaxy.

5a.
	sd	d	oc	c	p
Number of setae	5	4+1	3	2	4
Setae absent				c1, c3 c4
5b.
	a	m	p	Setae absent
Th. I	–	3	–		m2
Th. II	4	2	5	a5	m4
Th. III	3	2	5	a2, a5	m4
Abd. I-III	3	–	5	a2, a5
Abd. IV	4	–	5	a2, a3
Abd. V	3	–	4	a4
Abd. VI	3	2	2+1

The analysis and revision of the morphology of the 5 species described, allowed us to come to the following conclusions about the morphology of the genus that needs to be taken in consideration. Size of body setae should be a characteristic to be taken into consideration for the description of the species, since we observed that it is a variable character. Antennae are a uniform structure and characters associated with the sensory organ of Ant. III have little relevance at a specific level. Sensory file of Ant. IV, present a varied shape and number, from 8 to 40 setae. Apical vesicle of Ant. lV is trilobed in most species and others have a simple shape. Number of ocelli is stable within the genus, presenting 8+8. The maxillae and mandibles vary in all species. Maxillae can be needle-shaped, crocheted or styliform, they may or may not be lamellar and the number of lamellae is variable, and in most cases, there are 1 to 2 apical teeth. The number of teeth in the mandibles in almost all species ranges from 1 to 5. The number of teeth in the retinaculum is a constant character among the species of the genus, with 3+3 teeth. The ventral tube in almost all species has 4+4 setae. The number of setae in the dens varies from three to seven, but most have six setae. The mucron has 2 lamellae in all species, except in P. reductus, where it is greatly reduced. The shape of the mucron is variable, from elliptical, triangular, elongated, short, curved, widened, or with a bladder-shaped base.

Acknowledgments

This study had the support from the International Relationships of Universidad Nacional Autónoma de México issued to the first author and partially by the National Natural Sciences Foundation of China (No. 3217047 and 32370491). Blanca E. Mejía Recamier helped remount specimens. Kenneth A. Christiansen gave criticism, suggestions, and literature. We thank Erick García and Eduardo Pacheco who assigned the catalogue numbers for the slides. Daniel A. Estrada, Jesús A. Monterrubio, Juan Márquez donated the specimens.

References

Arango-Galván, A., Cutz-Pool, L. Q., & Cano-Santana, Z. (2007). Estructura de la comunidad de colémbolos del mantillo de la Reserva Ecológica del Pedregal de San Ángel: Riqueza, composición y abundancia relativa. Entomología Mexicana, 6, 397–400.

Bellinger, P. F., Christiansen, K. A., & Janssens, F. (2023). Checklist of the Collembola of the World. Retrieved on November 11th, 2023 from: http://www.collembola.org

Christiansen, K. A., & Bellinger, P. F. (1998). The Collembola of North America, North of the Río Grande: a taxonomic analysis. Part I. Grinnell, Iowa Grinnell College.

Cutz-Pool, L. Q., Palacios-Vargas, J. G., & Vázquez, M. M. (2003). Comparación de algunos aspectos ecológicos de Collembola en cuatro asociaciones vegetales de Noh-Bec, Quintana Roo, México. Folia Entomológica Mexicana, 42, 91–101.

Cutz-Pool, L. Q., García-Gómez, A., & Palacios-Vargas, J. G. (2007a). Primer estudio de colémbolos (Hexapoda: Collembola) de la Hoya de las Guaguas en el estado de San Luis Potosí, México. Dugesiana, 14, 47–51.

Cutz-Pool, L. Q., Palacios-Vargas, J. G., Castaño-Meneses, G., & García-Calderón, N. E. (2007b). Edaphic Collembola from two agroecosystems with contrasting irrigation type in Hidalgo State, Mexico. Applied Soil Ecology, 36, 46–52. https://doi.org/10.1016/j.apsoil.2006.11.009 

Cutz-Pool, L. Q., Palacios-Vargas, J. G., & Castaño-Meneses, G. (2008). Estructura de la comunidad de colémbolos (Hexapoda: Collembola) en musgos corticícolas en un gradiente altitudinal de un bosque templado subhúmedo. Revista de Biología Tropical, 56, 1–10. https://doi.org/10.15517/rbt.v56i2.5620 

Fjellberg, A. (1998). Fauna entomologica scandinavica. The Collembola of Fennoscandia and Denmark. Part I: Poduromorpha. Vol. 35. Leiden: Brill Publishers. 

Jordana, R., Arbea, J. I., Simón, C., & Luciáñez, M. J. (1997). Fauna ibérica. Vol. 8. Collembola, Poduromorpha. Madrid: Museo Nacional de Ciencias Naturales.

Palacios-Vargas, J. G. (1990). Manuales y guías para el estudio de microartrópodos I. Diagnosis y clave para determinar las familias de los Collembola de la Región Neotropical. México D.F.: Facultad de Ciencias, Universidad Nacional Autónoma de México.

Palacios-Vargas, J. G. (1997). Catálogo de los Collembola de México. Las Prensas de Ciencias, UNAM, México D.F. 

Palacios-Vargas, J. G. (2005). Collembola. In G. Sánchez-Ramos, P. Reyes-Castillo y R. Dirzo (Eds.), Historia natural de la Reserva de la Biosfera El Cielo Tamaulipas, México (pp. 354–366). Ciudad Victoria, Tamaulipas: Universidad Autónoma de Tamaulipas.

Palacios-Vargas, J. G., & Castaño-Meneses, G. (2003). Seasonality and community composition of springtails in Mexican forests. In Y. Basset, V. Novotny, S. E. Millar, & R. L. Kitching (Eds.), Arthropods of tropical forests. Spatio-temporal dynamics and resource use in the canopy (pp. 159–169). Cambridge, UK: Cambridge University Press.

Palacios-Vargas, J. G., Castaño-Meneses, G., & Mejía-Recamier, B. E. (2000). Collembola. In J. Llorente-Bousquets, E. González-Soriano, & N. Papayero (Eds.), Biodiversidad, taxonomía y biogeografía de artrópodos de México. Hacia una síntesis de su conocimiento II (pp. 249–273).México D.F.: Las Prensas de Ciencias, UNAM. 

Palacios-Vargas, J. G., Cutz-Pool, L. Q., & Estrada-Barcenas, D. A. (2007). Collembola. In I. Luna, J. J. Morrone, & D. Espinosa (Eds.). Biodiversidad de la Faja Volcánica Transmexicana (pp. 331–344).México D.F.: Las Prensas de Ciencias, UNAM.

Tullberg, T. (1871). Förteckning öfver Svenska Podukrider. Öfversigt af Kongliga Vetenskaaps -Akademiens Förhandlingar, 28, 143–155.

Vázquez, M. M. (1988). Fauna colembológica de hojarasca y suelo. In L. Arriaga, & A. Ortega (Eds.), La sierra de la Laguna de Baja California Sur (pp. 133–148). La Paz, Baja California Sur: Centro de Investigaciones Biológicas de Baja California Sur, A.C.

Vázquez, M. M., & Palacios-Vargas, J. G. (1990). Nuevos registros y aspectos biogeográficos de los colémbolos de la sierra de la Laguna, B. C. S., México. Folia Entomológica Mexicana, 78, 5–22.

Vázquez, M. M., & Palacios-Vargas, J. G. (2004). Catálogo de colémbolos (Hexapoda: Collembola) de Sian Ka’an, Quintana Roo, México. México D.F.: Universidad de Quintana Roo/ Comisión Nacional para el Conocimiento y Uso de la Biodiversidad.

Ariel Ángel Céspedes-Llave *

Universidad San Francisco Xavier de Chuquisaca, Facultad Ciencias Químico Farmacéuticas y Bioquímicas, Experimental de Biología “Luis Adam Brianςon”, Calle Dalence Núm. 51, Ciudad de Sucre, Chuquisaca, Bolivia 

*Autor para correspondencia: cespedes.ariel@usfx.bo (A.A. Céspedes-Llave )

Recibido: 6 febrero 2024; aceptado: 11 abril 2024

Resumen

El objetivo principal de este trabajo fue generar una lista actualizada de las especies de abejas sin aguijón (Apidae: Apinae: Meliponini) en Bolivia, abordando aspectos geográficos, taxonómicos, históricos y ecorregionales. Se realizaron ajustes en la sistemática de abejas sin aguijón y correcciones geográficas mediante un minucioso análisis de la información recopilada. Los resultados obtenidos muestran la presencia de 121 especies en Bolivia, distribuidas en 19 géneros válidos, estos datos se basan en 616 registros recopilados desde 1932 hasta 2022, se destaca que la riqueza de especies de las abejas meliponinas es notablemente alta por debajo de 1,000 m (> 90% especies). Las ecorregiones más diversas resultaron ser los Yungas y el sudoeste de la Amazonia albergando 90% de las especies. Con este trabajo, se logró generar datos actualizados de la riqueza de especies de meliponinos con información de distribución geográfica para Bolivia. La relevancia de este estudio es impulsar la consolidación de conocimientos de diversidad de abejas, con el involucramiento de instituciones científicas y la comunidad investigadores. Además, que sirva como guía para las meliponiculturas locales, para identificar y manejar especies en función de la ecorregión en la que se ubiquen.

Palabras clave: Estado de conocimiento; Meliponinos; Registros geográficos; Registros taxonómicos

© 2024 Universidad Nacional Autónoma de México, Instituto de Biología. Este es un artículo Open Access bajo la licencia CC BY-NC-ND

(http://creativecommons.org/licenses/by-nc-nd/4.0/).

Stingless bees (Apidae: Apinae: Meliponini) from Bolivia: an approach to the richness and geographical distribution 

Abstract

The aim of this study was to compile an updated species inventory of stingless bees (Apidae: Apinae: Meliponini) in Bolivia, considering geographic, taxonomic, historical and ecoregional aspects. Adjustments in the systematics of stingless bees and geographic data corrections were made through exhaustive analysis of the available information. The results reveal the presence of 121 species in Bolivia, distributed in 19 valid genera, these findings are based on 616 records spanning from 1932 to 2022. Notably, the species richness of meliponinos bee’s is particularly high below 1,000 meters (> 90% species). The Yungas and southwestern Amazonia were identified as the most diverse ecoregion, with 90% of the species. This study´s significance lies in advancing the understanding of the bee diversity, and fostering collaboration among institutions and researcher community. Moreover, the gathered information aims to support meliponiculture initiatives by helping stakeholders identify and manage species within their respective ecoregion.

Keywords: Knowledge status; Meliponine bees; Geographic records; Taxonomic records

Introducción 

La familia Apidae (Hymenoptera) abarca una amplia diversidad de linajes de abejas antófilas, entre los que se encuentran las abejas sin aguijón, también conocidas como meliponinos (término acuñado por Moure (1963)). Desde el punto de vista taxonómico pertenecen a la tribu Meliponini, cuyo nombre deriva del griego meli (μέλι) = miel, ponos (πόνος) = trabajo y el sufijo ini = que indica o agrupa como tribu a los animales. Estas abejas juegan un papel ecológico muy importante en la polinización en ambientes naturales y agroecosistemas, lo que las hace cruciales para mantener la salud de los ecosistemas y la seguridad alimentaria (González et al., 2018; Layek et al., 2022; Slaa et al., 2006). A nivel global constituyen más de 500 especies con distribución pantropical o subtropical (Hrncir et al., 2016; Michener, 2013) y en la región neotropical se tienen registradas más de 400 especies (Camargo et al., 2013; Freitas et al., 2009; Michener, 2013), llegando a representar la mayor riqueza (~ 80%) de todas las especies de abejas sin aguijón. 

Los meliponinos se encuentran distribuidos en áreas tropicales y subtropicales en América, es decir, abarcando desde el norte de México hasta el norte de Argentina (Camargo et al., 2013). La mayor riqueza de especies en América del Sur se encuentra en Brasil con un impresionante registro de 259 especies (Nogueira, 2023; Pedro, 2014). Le sigue Perú, con 175 especies documentadas (Rasmussen y Castillo, 2003; Rasmussen y Delgado, 2019) y Ecuador con 132 especies (Vit et al., 2018). Colombia con una notable diversidad de 129 especies (Nates-Parra, 2001; Nates-Parra y Rosso-Londoño, 2013), mientras que Venezuela reporta 83 especies (Pedro y Camargo, 2013). La Guyana Francesa ha registrados 80 especies (Pauly et al., 2013) y Argentina está experimentado avances significativos en sus inventarios pasando de 33 a 37 especies catalogadas (Álvarez, 2015; Lucia y Álvarez, 2023). Este panorama subraya la importancia de la investigación continua para comprender y preservar la rica diversidad de las abejas sin aguijón en la región neotropical.

Los primeros registros de especies de abejas sin agujón para Bolivia, datan de los trabajos pioneros de Cockerell (1919), Schwarz (1932, 1948), Moure (1950), Wille (1960) y Kempf-Mercado (1962, 1968). Sin embargo, uno de los hitos más significativos en la recopilación del conocimiento de abejas sin aguijón en la región neotropical, es la publicación del catálogo de abejas de Moure et al. (2007). Este catálogo es un referente y revela que para Bolivia, la riqueza de especies de abejas sin aguijón está compuesta por 21 géneros y 88 especies (Camargo y Pedro 2007; Camargo et al., 2013). Asimismo, actualmente se disponen de otras plataformas de libre acceso, que ofrecen registros de abejas para Bolivia. Entre éstas, se destacan World Bee Diversity (Ascher y Pickering, 2020), la Asociación Brasileira de Estudios de las Abejas (A.B.E.L.H.A., 2016) y el Global Biodiversity Information Facility (GBIF, 2023). Estas plataformas son una fuente valiosa para complementar y actualizar la información sobre la diversidad de abejas sin aguijón en el contexto boliviano.

El conocimiento de la riqueza de especies también se benefició de iniciativas en el ámbito de la meliponicultura, con diversos proyectos que se gestaron a partir de la década de los 90 (Aguilera, 2019). Estos proyectos incluyen iniciativas como las llevadas a cabo en el departamento del Beni, específicamente dentro de comunidades indígenas Sirionó de Ibiato (Montaño, 1996). Asimismo, en Santa Cruz se implementaron proyectos a partir del 2000 en comunidades indígenas guaraní y quechuas, como se documenta en los trabajos de Martínez y Cuéllar (2004), Ferrufino y Aguilera (2006) y Aguilera (2019). Otras experiencias valiosas se dieron en las comunidades indígenas de Tacana en La Paz (Alipaz et al., 2006), durante el 2010 en Tarija, en regiones del Chaco (Clemente y Lahore, 2010), en Cochabamba las comunidades indígenas yuracares (GADC/ALD, 2014) y en Chuquisaca, a partir de 2015, con la formación de asociaciones de meliponicultoras(es) (Campos y Peducassé, 2017; Delgado y Martínez, 2021; PASOS, 2015). Actualmente, se observan esfuerzos recientes en el área protegida municipal Ibare-Mamoré de Trinidad, Beni (Paredes et al., 2022). Estos proyectos y experiencias en distintas regiones de Bolivia han sido fundamentales para avanzar en nuestro conocimiento de la diversidad y distribución de las abejas sin aguijón en el país. 

El presente estudio se centra en la recopilación y sistematización exhaustiva de todas las evidencias procedentes de diferentes fuentes (publicadas y bases de datos online), para las especies de abejas sin aguijón en Bolivia. Con el objetivo principal de generar una lista actualizada de las especies, abordando aspectos geográficos, taxonómicos, históricos y ecorregionales. La relevancia de este estudio no solo radica en la presentación de datos actualizados, sino también en la utilidad práctica de la información, como impulsar la consolidación de conocimientos de diversidad de abejas, con el involucramiento de instituciones científicas, el estado y la comunidad de investigadores. Además, que sirva como guía para las meliponiculturas locales, permitiendo identificar y manejar especies en función de la ecorregión en la que se ubiquen y fomentar prácticas sostenibles en el manejo de abejas sin aguijón.

Materiales y métodos 

El proceso de recopilación y sistematización de toda la información disponible consistió en generar una lista preliminar como base, información obtenida desde el catálogo de abejas en la región neotropical (Moure et al., 2007) y de la versión online del catálogo de abejas Moure (Melo et al., 2022). Esta información se comparó con bases de datos disponibles en la web, como el sistema de información científica sobre las abejas neotropicales del Brasil conocido como info A.B.E.L.H.A (A.B.E.L.H.A., 2016), Global Biodiversity Information Facility (GBIF, 2022) y la lista de diversidad de abejas del mundo (World Bee Diversity; Ascher y Pickering, 2020). Por otra parte, se ajustó la clasificación sistemática con base en la propuesta reciente realizada por Engel et al. (2023). 

Posteriormente, se recopilaron los datos de distribución y taxonomía de diferentes publicaciones especializadas (artículos y libros) desde 1832 hasta 2022, éstas fueron sistematizadas en el programa Mendeley (ver. 1.19.8), de ellas se extrajo información como localidad, fecha de colecta y en algunos casos datos geográficos (fig. 1). Se revisó el origen geográfico de los registros (datos geográficos y la descripción de la localidad), de los cuales se determinó la calidad de la información. A aquellos registros que no tenían datos geográficos, se les aplicó el método de georreferenciación (fig. 1), con la descripción de localidad y mediante el uso de capas vectoriales de Bolivia, como son: centros poblados del censo poblacional de 2001 y 2012 (INE, 2016), los límites municipales (MA, 2015), en algunos casos, la red drenaje (ríos) de Bolivia y mapas topográficos del Instituto Geográfico Militar a escala de 1:50000 (IGM, 2021). Este proceso se realizó mediante el programa QGIS (ver. 3.18) (QGIS, 2020), aplicando un complemento adicional como el plugin Lat Lon Tools (Hamilton, 2021), para obtener datos geográficos. Para verificar especialmente las localidades georreferenciadas y altura, se utilizó el programa Google Earth Pro (ver. 7.3.6.9345) (Google, 2022).

Figura 1. Proceso de trabajo en la generación de la lista de especies de abejas sin aguijón para Bolivia.

Para los datos disponibles de GBIF, se procedió a la descarga en formato Darwin Core y en formato vectorial usando el plugin GBIF Occurrences (GBIF, 2022) para el programa QGIS. Posteriormente, se revisaron la calidad de los datos geográficos y taxonómicos, de la misma manera según las ambigüedades o inconsistencia encontradas, se procedió a corregir como anteriormente se mencionó en el procedimiento de georreferenciación. Además, se incorporaron datos adicionales como las ecorregiones de Bolivia (Ibisch et al., 2003), a través de sobreposición de la capa vectorial de los registros geográficos con las ecorregiones.

Por otra parte, se adicionó información obtenida en recolectas de campo, a través de diferentes proyectos ejecutados en los departamentos de Cochabamba y Chuquisaca (fig. 1), como el material que está resguardado en la colección biológica científica del Instituto Experimental de Biología “Luis Adam Briançon” – USFX (CB-IEBUSFX). Estos proyectos fueron realizados en el ANMI El Palmar sobre la identificación, caracterización de abejas nativas con potencial melífero para 6 comunidades del área protegida (PPD/PNUD, 2013), y otros proyectos patrocinados en 2019 y 2021 por la Dirección de Investigación, Ciencia y Tecnología (DICyT-USFX) sobre abejas sin aguijón, en el pueblo indígena Yuracaré (Cochabamba) y en asociaciones meliponicultoras Chaco Chuquisaqueño (Chuquisaca).

La base de datos fue estructurada en 7 componentes: taxonomía (género y especie), localidad geográfica (departamento, municipio y localidad), fecha de recolecta, nombre del colector, datos geográficos (latitud, longitud y altitud), indicación de si se realizó el proceso de georreferenciación (si/no) y fuente o procedencia de la información (base de datos online, publicación o fuente propia). Esta información fue organizada para ser consultada y visualizada de manera interactiva (gráficos y mapas) en la aplicación de shiny (ver 1.8.0) desarrollado a través de script simple en el programa R (Chang et al., 2023), disponible en el siguiente enlace: https://scotigera.shinyapps.io/BolAbejas/.

A partir de los datos obtenidos, se realizó el análisis exploratorio elaborando tablas de contingencia y gráficos descriptivos con el programa R (ver 4.2.3) para mostrar la eventualidad de los registros de abejas sin aguijón y el número de registros en función de la altura sobre el nivel del mar. Se realizaron cuadros que muestran: 1) la lista de especies de la tribu Meliponini para Bolivia, consensuada con la información consultada de bases de datos e información publicada; 2) la lista de especies registradas para Bolivia, con información de presencia a nivel departamental y ecorregiones, con el intervalo de tiempo y los registros fuente.

Con los datos geográficos se elaboraron mapas para mostrar los diferentes tipos de registros obtenidos, tanto aquellos que usaron datos originales, como aquellos que fueron corregidos (georreferenciados) y de fuente propia usando el programa QGIS. Además, se realizaron análisis de densidad de muestreo (point to polygon) para mostrar la riqueza de especies a nivel municipal y/o departamental, y de la misma manera, para las ecorregiones de Bolivia, usando el programa de DIVA-GIS (ver. 7.5) (Hijmans et al., 2012).

Resultados 

Se revisaron 49 publicaciones, tanto artículos científicos como libros, y se obtuvieron 347 registros geográficos. Además, se incluyen 220 registros provenientes de bases de datos digitales como GBIF, WBD y A.B.E.L.H.A. Asimismo, se cuenta con 49 registros que proceden de CB-IEBUSFX, logrando así un consolidado de 616 registros. 

Con respecto de la revisión de las publicaciones, las contribuciones de Schwarz (1832, 1938, 1948) aportaron 68 registros, mientras que Cockerell (1919), contribuyó con 3 registros, Wille (1960, 1962) sumó 2 registros adicionales. Posteriormente, Camargo (1988) aportó 20 registros de especies y Camargo y Pedro, entre 2002 y 2009 generaron 35 registros (Camargo y Pedro, 2002, 2003, 2005, 2007, 2009). Además, las colaboraciones de Camargo con Moure (1994, 1997) obtuvieron 19 registros. Por otra parte, Moure (1950, 1960), añadió 19 registros y en colaboración con Kempff (1968), 30 registros. Estos son considerados como pioneros fundamentales en el establecimiento del conocimiento de las abejas sin aguijón en Bolivia. Posteriormente, las contribuciones de Smith-Pardo y Engel (2001), De Albuquerque y Camargo (2007), Nogueira (2016), Melo (2016), Rasmussen y González (2017), Ribeiro (2021) y Engel (2021, 2022), han realizado importantes aportes en sistemática y han contribuido con más de 30 registros. Los trabajos realizados en Bolivia por Tejada (2006), Clemente y Lahore (2010), Ferrufino y Vit (2013), Townsend et al. (2021) y Morón et al. (2023), también presentan contribuciones muy relevantes para nuestra comprensión actual. 

Figura 2. A), Eventualidad de los registros de abejas sin aguijón desde 1984 a 2021; B, número de registros de las abejas sin aguijón en función a la altura sobre el nivel del mar.

Estos registros muestran recolectas que se remontan a 1834 por el naturalista d’Orbigny, posteriormente se observan 2 periodos de particular interés, uno entre los años 1900 y 1970, y otro entre 1980 y 2022 (fig. 2A). Durante el primer periodo, varios naturalistas y recolectores contribuyeron significativamente al conocimiento de la tribu Meliponini en Bolivia. Entre ellos, se destacan Wolfgang Priewasser (1900), Mann (1921 a 1938), Peña (1942 a 1995), Kerr (1949), Kempff. (1962-1968), Bouseman y Lussenhop (1964-1965), Ballard (1967-1968), Walz (1940 – 1955), y Zischka (1950). Para el segundo periodo, sobresalen Brooks (1988), Montaño (1992), Irwin y Parker (1999) y Francois (1999). 

En cuanto a la procedencia geográfica de los 616 registros, 273 fueron obtenidos como datos originales, mientras que 272 registros se georreferenciaron con base en las descripciones de los sitios de recolecta en los manuscritos, y adicionalmente, 71 registros tuvieron correcciones en su ubicación geográfica (fig. 3A). De los registros provenientes del GBIF (n = 236), se corrigieron geográficamente 72 debido a discrepancias con la ubicación de las localidades descritas (fig. 3B).

Los datos altitudinales derivados de los registros geográficos muestran que estas abejas se encuentran desde 94 hasta 2,329 m snm (fig. 2B). En este contexto, 66.7% de las especies (n = 80) se localizan en un rango altitudinal desde 94 a 500 m, abarcando el piso ecológico basal que incluye las tierras bajas y parte del subandino. El 27.5% de las especies (n = 33) se encuentra en el piso ecológico basimontano o andino montano situado entre 500 y 1,000 m. Solo 15 especies de abejas sin aguijón han sido registradas por encima de 1,000 m, encontrándose en fondos de valles desde 1,100 hasta 2,400 m, incluyendo especies como Scaptotrigona turusiri en los Yungas, abejas del género Plebeia sp. y Tetragonisca angustula en los valles secos interandinos. Y un caso sorprendente fue el registro de una abeja del género Trigona sp., que se reportó por encima de 4,000 m (altiplano). 

La sistematización de los datos posibilita obtener una aproximación de la riqueza de abejas sin aguijón en Bolivia, lo cual se traduce en la identificación de 19 géneros y 121 especies (tablas 1, 2). Es importante señalar que este número podría aumentar hasta 132 especies, siempre y cuando se realice una confirmación taxonómica y biogeográfica de 11, debido a que existen registros próximos a las fronteras de Brasil y Argentina. 

En cuanto a la distribución de la riqueza de especies a nivel departamental en Bolivia, se observa que estas abejas están presentes en 7 de los 9 departamentos del país. Destacan los departamentos de La Paz (76 especies), Beni (69 especies), Cochabamba (66 especies) y Santa Cruz (64 especies) como aquellos con el mayor número de especies, seguidos de Chuquisaca (20 especies), Tarija (10 especies) y Pando (9 especies) (tabla 2, fig. 3C). Al considerar los límites de las ecorregiones de Bolivia, se ha determinado que la riqueza de especies está presente en 8 de las 13 ecorregiones, la ecorregión sudoeste de la Amazonía destaca con la mayor riqueza contabilizando 95 especies (tabla 2), seguida de los Yungas (58 especies) y el Cerrado (47 especies). Posteriormente, se encuentran las Sabanas Inundables (27 especies) y el Bosque Seco Chiquitano (25 especies), mientras que las ecorregiones con una menor riqueza incluyen el Gran Chaco (19 especies), el Bosque Tucumano – Boliviano (16 especies), los Bosques Secos Interandinos (16 especies) y el Chaco Serrano (6 especies). Estos hallazgos proporcionan una visión detallada de la diversidad y distribución de las abejas sin aguijón en diferentes regiones de Bolivia.

Discusión 

Con base en la revisión bibliográfica que se realizó al trabajo de Camargo y Pedro (2007), para Bolivia se había catalogado un total de 24 géneros. Sin embargo, los cambios introducidos por la reciente publicación de Engel et al. (2023), que presenta una revisión exhaustiva de la clasificación a nivel de género y subgénero de la tribu Meliponini, ha tenido un impacto en la adaptación de la lista, reduciendo el número a 19 géneros. Un ejemplo concreto de estos ajustes se observa en el género Plectoplebeia propuesto por Melo (2016) y con otras especies descritas por Engel (2022), ahora se integran al género Plebeia, debido a la sinonimia y a la presencia de características comunes que comparten, como indican Engel et al. (2023). Asimismo, el género Schwarzula ha sido incluido como subgénero dentro de Scaura, a pesar de que Camargo y Pedro (2002), con base en atributos morfológicos ya había notado fuerte parentesco al identificar sinapomorfias legítimas. No obstante, el análisis filogenético y morfológico realizado por Nogueira (2016) lo distingue como otro género válido (Nogueira, 2023), por lo que se mantiene la discusión sobre su identidad. 

Figura 3. Mapa de ubicación de registros geográficos y riqueza de especies de abejas sin aguijón en Bolivia. A), Mapa con datos corregidos, georreferenciados y originales; B) mapa con registros corregidos de GBIF; C), riqueza de especies de abejas sin aguijón obtenido según los municipios en cada departamento; D), a nivel de ecorregiones de Bolivia. Beni (BE), Chuquisaca (CH), Cochabamba (CB), La Paz (LP), Pando (PA), Santa Cruz (SC), Tarija (TA), Oruro (OR) y Potosí (PO).

Otro cambio significativo afecta a los géneros Dolichotrigona, Leurotrigona y Celetrigona, que han sido reclasificados como subgéneros de Trigonisca. Sin embargo, en el caso de Dolichotrigona, ya no se le reconoce como un género valido según Engel et al. (2023). Esto ha llevado a retomar su designación genérica como Trigona propuesto por Wille (1965) y Michener (2013), respaldada por similitudes morfológicas discutidas con Moure, quien dividió estos grupos (Wille, 1979). Plebia intermedia, nombre propuesto para Bolivia por Wille (1960) y citado en el catálogo de abejas de la región neotropical como Plectoplebeia nigrifacies (Camargo y Pedro, 2007), ha experimentado un cambio a Plebeia (Plebeia) nigrifacies. Este cambio se debe a que Melo (2016) la considera una sinonimia y Engel et al. (2023) no la reconoce como especie válida. Estos ajustes en la clasificación taxonómica reflejan la dinámica evolutiva del conocimiento y la importancia de las actualizaciones regulares en la nomenclatura de las abejas sin aguijón en Bolivia.

Tabla 1 

Lista de especies de abejas sin aguijón (Meliponini) consensuada a partir de los diferentes registros que se han revisado como el Catálogo de abejas de Moure – A.B.E.L.H.A. (A.B.E.L.H.A., 2016; Camargo, Pedro, et al., 2013; Camargo y Pedro, 2007), World Bee Diversity (Ascher y Pickering, 2020), GBIF, 2022, la lista de especies de abejas nativas de Lisperger (2015) (Townsend, 2016) y las publicaciones revisadas. Registros de especies que están en Bolivia por su proximidad (^P). Los valores en negrita corresponden a la sumatoria total del número de especies según el género y las fuentes consultadas.

Taxones	CAM – (2007-2013)	A.B.E.L.H.A. (2022)	WBA (2020)	GBIF (2022)	Revisión Pub.	Subtotal	Total
Subtribu Meliponina Lepeletier
Infratribu Meliponitae Lepeletier
Grupos de Género Paratrigona
Género Paratrigona Schwarz, 1938	7	7	7	4	7	8	8
Paratrigona (Paratrigona) glabella Camargo et Moure, 1994	1			1	1	1	1
Paratrigona (Paratrigona) guigliae Moure, 1960	1	1	1		1	1	1
Paratrigona (Paratrigona) lineata (Lepeletier, 1836)	1	1	1		1	1	1
Paratrigona (Paratrigona) nuda (Schwarz, 1943)	1	1	1	1	1	1	1
Paratrigona (Paratrigona) onorei Camargo et Moure, 1994	1	1	1		1	1	1
Paratrigona (Paratrigona) pacifica (Schwarz, 1943)	1	1	1	1	1	1	1
Paratrigona (Paratrigona) prosopiformis (Gribodo, 1893)	1	1	1	1	1	1	1
Paratrigona (Paratrigona) subnuda Moure, 1947		1	1			1	1
Género Nogueirapis Moure, 1953					1	1	1
Nogueirapis butteli (Friese, 1900)?					1	1	1
Género Partamona Schwarz, 1939	9	9	9	8	8	9	10
Partamona ailyae Camargo, 1980	1	1	1	1	1	1	1
Paratrigona (Paratrigona) batesi Pedro et Camargo, 2003p		1					1
Partamona combinata Pedro et Camargo, 2003	1	1	1	1	1	1	1
Partamona epiphytophila Pedro et Camargo, 2003	1	1	1	1	1	1	1
Partamona mulata Moure, in Camargo, 1980	1	1	1	1	1	1	1
Partamona nhambiquara Pedro et Camargo, 2003	1	1	1			1	1
Partamona subtilis Pedro et Camargo, 2003	1	1	1	1	1	1	1
Partamona testacea (Klug, 1807)	1	1	1	1	1	1	1
Partamona vicina Camargo, 1980	1	1	1	1	1	1	1
Partamona yungarum Pedro et Camargo, 2003	1	1	1	1	1	1	1
Grupos de Género Trigona
Género Oxytrigona Cockerell, 1917	2	2	2	4	4	4	4
Oxytrigona mulfordi (Schwarz, 1948)	1	1	1	1	1	1	1
Oxytrigona flaveola (Friese, 1900)				1	1	1	1
Oxytrigona obscura (Friese, 1900)	1	1	1	1	1	1	1
Oxytrigona tataira (Smith, 1863)				1	1	1	1
Genero Scaptotrigona Moure, 1942	6	5	5	2	13	13	14
Subgénero Baryorygma Engel
Scaptotrigona (Baryorygma) bipunctata (Lepeletier, 1836)	1	1	1		1	1	1
Scaptotrigona (Baryorygma) fimbriata Engel, 2022					1	1	1

Tabla 1. Continúa
Taxones	CAM – (2007-2013)	A.B.E.L.H.A. (2022)	WBA (2020)	GBIF (2022)	Revisión Pub.	Subtotal	Total
Scaptotrigona (Baryorygma) tricolorata Camargo, 1988	1	1	1		1	1	1
Subgénero Eoscaptotrigona Engel
Scaptotrigona (Eoscaptotrigona) polysticta Moure, 1950	1	1	1	1	1	1	1
Subgénero Gymnotrigona Engel
Scaptotrigona (Gymnotrigona) depilis (Moure, 1942)	1	1	1	1	1	1	1
Scaptotrigona (Gymnotrigona) jujuyensis (Schrottky, 1911)P							1
Scaptotrigona (Gymnotrigona) nuda Engel, 2022					1	1	1
Subgénero Scaptotrigona Moure
Scaptotrigona (Scaptotrigona) grueteri Engel, 2022					1	1	1
Scaptotrigona (Scaptotrigona) nigrohirta Nogueira et Santos-Silva 2022					1	1	1
Scaptotrigona (Scaptotrigona) postica (Latreille, 1807)	1	1	1		1	1	1
Scaptotrigona (Scaptotrigona) semiflava Engel, 2022					1	1	1
Scaptotrigona (Scaptotrigona) turusiri (Janvier, 1955)	1				1	1	1
Scaptotrigona (Scaptotrigona) xanthotricha Moure, 1950					1	1	1
Scaptotrigona (Scaptotrigona) yungasensis Engel, 2022					1	1	1
Género Geotrigona Moure, 1943	5	5	5	3	5	6	5
Subgenero Chthonotrigona Engel
Geotrigona (Chthonotrigona) fulvohirta (Friese, 1900)	1	1	1	1	1	1	1
Subgénero Geotrigona Engel
Geotrigona (Geotrigona) argentina Camargo et Moure, 1996	1	1	1		1	1	1
Geotrigona (Geotrigona) fulvatra Camargo et Moure, 1996	1	1	1	1	1	1	1
Geotrigona (Geotrigona) mattogrossensis (Ducke, 1925)	1	1	1		1	1	1
Geotrigona (Geotrigona) mombuca (Smith, 1863)					1	1	1
Geotrigona (Geotrigona) tellurica Camargo et Moure, 1996	1	1	1	1	1	1	1
Género Ptilotrigona Moure, 1951	1	1	1	1	1	1	1
Ptilotrigona (Ptilotrigona) lurida (Smith, 1854)	1	1	1	1	1	1	1
Género Tetragona Lepeletier et Serville, 1828	3	3	3	2	3	3	3
Tetragona clavipes (Fabricius, 1804)	1	1	1	1	1	1	1
Tetragona goettei (Friese, 1900)	1	1	1	1	1	1	1
Tetragona truncata Moure, 1971	1	1	1		1	1	1
Género Trigona Jurine, 1807	16	16	16	23	16	19	22
Subgénero Aphaneura Gray
Trigona (Aphaneura) chanchamayoensis Schwarz, 1948	1	1	1	1	1	1	1
Trigona (Aphaneura) pallens (Fabricius, 1798)				1		1	1
Trigona (Aphaneura) williana Friese, 1900	1	1	1	1	1	1	1
Subgénero Aphaneuropsis Engel
Trigona (Aphaneuropsis) cilipes (Fabricius, 1804)	1	1	1	1	1	1	1
Trigona (Aphaneuropsis) lacteipennis Friese, 1900	1	1	1	1		1	1
Subgénero Dichrotrigona Engel
Trigona (Dichrotrigona) dimidiata Smith, 1854	1	1	1	1	1	1	1
Subgénero Koilotrigona Engel
Trigona (Koilotrigona) fulviventris Guérin, 1844		1		1			1
Trigona (Koilotrigona) guianae Cockerell, 1910	1	1	1	1	1	1	1
Subgénero Ktinotrofia Engel
Trigona (Ktinotrofia) albipennis Almeida, 1995	1	1	1		1	1	1
Trigona (Ktinotrofia) fuscipennis Friese, 1900				1		1	1
Subgénero Necrotrigona Engel
Trigona (Necrotrigona) crassipes (Fabricius, 1793)	1	1	1	1	1	1	1
Trigona (Necrotrigona) hypogea Silvestri, 1902	1	1	1	1	1	1	1
Subgénero Nostotrigona Engel
Trigona (Nostotrigona) juvenili Ribeiro, 2023p					1		1
Trigona (Nostotrigona) recursa Smith, 1863	1	1	1	1	1	1	1
Subgénero Trigona Jurine
Trigona (Trigona) amalthea (Olivier, 1789)	1	1	1	1	1	1	1
Trigona (Trigona) amazonensis (Ducke, 1916)	1	1	1	1	1	1	1
Trigona (Trigona) branneri Cockerell, 1912	1	1	1	1	1	1	1
Trigona (Trigona) corvina Cockerell, 1913		1		1			1
Trigona (Trigona) dallatorreana Friese, 1900	1	1	1	1	1	1	1
Trigona (Trigona) hyalinata (Lepeletier, 1836)	1	1	1	1	1	1	1
Trigona (Trigona) silvestriana (Vachal, 1908)				1	1	1	1
Trigona (Trigona) truculenta Almeida, 1984	1	1	1	1		1	1
Género Cephalotrigona Schwarz, 1940	2	2	2	2B	2	2	2
Cephalotrigona capitata (Smith, 1854)	1	1	1	1	1	1	1
Cephalotrigona femorata (Smith, 1854)	1	1	1		1	1	1
Grupos de Género Plebeia
Género Tetragonisca Moure, 1946	3	2	2	3	3	3	3
Tetragonisca angustula (Latreille, 1811)	1			1	1	1	1
Tetragonisca fiebrigi (Schwarz, 1938)	1	1	1	1	1	1	1
Tetragonisca weyrauchi (Schwarz, 1943)	1	1	1	1	1	1	1
Género Frieseomelitta Ihering, 1912	2	3	2	4	2	3	3
Frieseomelitta silvestrii (Friese, 1902)	1	1	1	1	1	1	1
Frieseomelitta flavicornis (Fabricius, 1798)				1		1	1
Frieseomelitta trichocerata Moure, 1990		1		1			1
Frieseomelitta varia (Lepeletier, 1836)	1	1	1	1	1	1	1
Género Duckeola Moure, 1944	1	1	1	1	1	1	1
Duckeola ghilianii (Spinola, 1853)	1	1	1	1	1	1	1
Género Plebeia Schwarz, 1938	5	5	5	3	9	9	10
Subgénero Nanoplebeia Engel
Plebeia (Nanoplebeia) asthenes Engel, 2021					1	1	1
Plebeia (Nanoplebeia) minima (Gribodo, 1893)	1	1	1		1	1	1
Subgénero Plebeia Schwarz, s.str.
Plebeia (Plebeia) alvarengai Moure, 1994				1	1	1	1
Plebeia (Plebeia) droryana (Friese, 1900)	1	1	1	1	1	1	1
Plebeia (Plebeia) kerri Moure, 1950	1	1	1	1	1	1	1
Plebeia (Plebeia) mosquito (Smith, 1863)?					1	1	1
Plebeia (Plebeia) mansita Alvarez et Rasmussen, 2021P					1		1
Plebeia (Plebeia) nigrifacies (Friese, 1900)		1	1	1	1	1	1
Plebeia (Plebeia) peruvicola Moure, 1994					1	1	1
Plebeia (Plebeia) remota (Holmberg, 1903)	1	1	1		1	1	1
Género Lestrimelitta Friese, 1903	1	1	1	1	3	3	3
Subgénero Hyrolestris Engel
Lestrimelitta (Hyrolestris) rufipes (Friese, 1903)				1	1	1	1
Subgénero Lestrimelitta Friese, s.str.
Lestrimelitta (Lestrimelitta) rufa (Friese, 1903)	1	1	1		1	1	1
Género Nannotrigona Cockerell, 1922	2	2	2	3	2	2	3
Subgénero Lispotrigona González et Engel
Nannotrigona (Lispotrigona) schultzei (Friese, 1901)	1	1	1	1	1	1	1
Subgénero Nannotrigona Cockerell, s.str.
Nannotrigona (Nannotrigona) melanocera (Schwarz, 1938)	1	1	1	1	1	1	1
Nannotrigona (Nannotrigona) testaceicornis (Lepeletier, 1836)?				1			1
Género Scaura Schwarz, 1938	2	3	3		4	4	4
Subgénero Scaura Schwarz, s.str.
Scaura (Scaura) latitarsis (Friese, 1900)	1	1	1		1	1	1
Scaura (Scaura) longula (Lepeletier, 1836)	1	1	1		1	1	1
Subgénero Scauracea Engel
Scaura (Scauracea) amazonica Nogueira, Oliveira e Oliveira, 2016		1	1		1	1	1
Subgénero Schwarzula Moure
Scaura (Schwarzula) timida (Silvestri, 1902)	1	1	1	1	1	1	1
Grupos de Género Melipona
Género Melipona Illiger, 1806	15	15	15	17	17	18	21
Subgénero Eomelipona Moure
Melipona (Eomelipona) amazonica Schulz, 1905P				1			1
Melipona (Eomelipona) tumupasae Schwarz, 1932	1	1	1	1	1	1	1
Subgénero Melikerria Moure
Melipona (Melikerria) fasciculata Smith, 1854				1		1	1
Melipona (Melikerria) grandis Guérin, 1844	1	1	1	1	1	1	1
Melipona (Melikerria) quinquefasciata Lepeletier, 1836	1	1	1		1	1	1
Subgénero Melipona Illiger, s.str.
Melipona (Melipona) baeri Vachal, 1904	1	1	1	1	1	1	1
Melipona (Melipona) fuscata Lepeletier, 1836				1	1	1	1
Melipona (Melipona) lunulata Friese, 1900	1	1	1	1	1	1	1
Melipona (Melipona) orbignyi (Guérin, 1844)	1	1	1	1	1	1	1
Subgénero Michmelia Moure
Melipona (Michmelia) boliviana Schwarz, 1932	1	1	1	1	1	1	1
Melipona (Michmelia) brachychaeta Moure, 1950	1	1	1	1	1	1	1
Melipona (Michmelia) crinita Moure et Kerr, 1950	1	1	1		1	1	1
Melipona (Michmelia) eburnea Friese, 1900	1	1	1	1	1	1	1
Melipona (Michmelia) flavolineata Friese, 1900p					1		1
Melipona (Michmelia) illota Cockerell, 1919	1	1	1	1		1	1
Melipona (Michmelia) nebulosa Camargo, 1988	1	1	1		1	1	1
Melipona (Michmelia) rufescens Friese, 1900	1	1	1	1	1	1	1
Melipona (Michmelia) rufiventris Lepeletier, 1836				1	1	1	1
Melipona (Michmelia) rufiventris xantina	1						?
Melipona (Michmelia) seminigra abunensis Cockerell, 1912	1	1	1	1	1	1	1
Subgénero Mouremelia Engel
Melipona (Mouremelia) fuliginosa Lepeletier, 1836	1	1	1	1	1	1	1
Melipona (Mouremelia) titania (Gribodo, 1893)P				1			1
Infratribu Trigoniscitae Engel Grupos de Género Trigonisca
Género Trigonisca Moure, 1950	5	4	4	3	8	9	13
Subgénero Celetrigona Moure, 1950
Trigonisca (Celetrigona) longicornis (Friese, 1903)	1	1	1		1	1	1
Trigonisca (Celetrigona) hirsuticornis Camargo et Pedro, 2009p	1					1	1
Subgénero Leurotrigona Moure, 1950
Trigonisca (Leurotrigona) gracilis Pedro et Camargo, 2009p							1
Trigonisca (Leurotrigona) muelleri (Friese, 1900)		1	1	1	1	1	1
Subgénero Trigonisca Moure, 1950
Trigonisca (Trigonisca) browni Camargo et Pedro, 2005	1	1	1	1	1	1	1
Trigonisca (Trigonisca) duckei (Friese, 1900)	1	1	1		1	1	1
Trigonisca (Trigonisca) intermedia Moure, 1990					1	1	1
Trigonisca (Trigonisca) longitarsis (Ducke, 1916)				1	1	1	1
Trigonisca (Trigonisca) mendersoni Camargo et Pedro, 2005P					1		1
Trigonisca (Trigonisca) pediculana (Fabricius, 1804)	1				1	1	1
Trigonisca (Trigonisca) rondoni Camargo et Pedro, 2005P					1		1
Trigonisca (Trigonisca) sachamiski Alvarez et Lucia, 2018P							1
Trigonisca (Trigonisca) vitrifrons Albuquerque et Camargo, 2007					1	1	1
Géneros	21	23	23	20	24	19	19
Especies	88	86	86	88	113	118	133

Tabla 2

Lista de especies registradas par Bolivia, con información de presencia a nivel de los límites departamentales y ecorregiones, y el intervalo de tiempo de los registros. Departamentos de Bolivia: Beni (BE), Chuquisaca (CH), Cochabamba (CB), La Paz (LP), Pando (PA), Santa Cruz (SC) y Tarija (TA). Ecorregiones: Bosque Seco Chiquitano (BSChi), Bosque Tucumano – Boliviano (BTBo), Bosques Secos Interandinos (BSIn), Cerrado (Cer), Chaco Serrano (ChaSe), Gran Chaco (GCha), Sabanas Inundables (SaIn), Sudoeste de la Amazonía (SAmz), Yungas (Yun).

Lista de taxones	Dep	Eco	Años	Referencias
Género Paratrigona Schwarz, 1938
Paratrigona glabella Camargo y Moure, 1994	CH, CB, LP SC, TA	BSChi, BTBo, BSIn, ChaSe GCha, SAmz, Yun	1952-2020	Camargo y Moure, 1994; GBIF.org, 2022; Oliveira et al., 2020
Paratrigona guigliae Moure, 1960	LP	Yun	~1950	Camargo y Moure, 1994
Paratrigona lineata (Lepeletier, 1836)	CH, CB, SC	BSChi, Cer, BTBo, BSIn, Cer, Yun	1951-2015	Camargo y Moure, 1994; GBIF.org, 2022; Oliveira et al., 2020
Paratrigona nuda (Schwarz, 1943)	LP	SAmz, Yun	1950-1956	Camargo y Moure, 1994; GBIF.org, 2022; Oliveira et al., 2020
Paratrigona onorei Camargo y Moure, 1994	CB	Yun	1950	Camargo y  Moure, 1994
Paratrigona pacifica (Schwarz, 1943)	CB, LP	SAmz, Yun	1949-2001	Camargo y Moure, 1994; GBIF.org, 2022
Paratrigona prosopiformis (Gribodo, 1893)	CB, LP, SC	SAmz, Yun	1948-2001	Camargo y Moure, 1994; GBIF.org, 2022
Paratrigona subnuda Moure, 1947	CB	SAmz		WBD, 2020
Género Nogueirapis Moure, 1953
Nogueirapis butteli (Friese, 1900)	CB	SAmz	1900	GBIF.org, 2022; Wille, 1962
Género Partamona Schwarz, 1939
Paratrigona ailyae Camargo, 1980	BE, CB	SAmz, SaIn, Yun	1948-2018	GBIF.org, 2022; Stearman et al., 2008; Townsend et al., 2021
Partamona combinata Pedro y Camargo, 2003	BE, CB, LP, SC	SAmz, SaIn, Yun	1922-1990	GBIF.org, 2022; Pedro y Camargo, 2003
Partamona epiphytophila Pedro y Camargo, 2003	BE, CB, LP, PA, SC	BSIn, Cer, SAmz, Yun	1921-2000	GBIF.org, 2022; Pedro y Camargo, 2003
Partamona mulata Moure, in Camargo, 1980	BE, SC	GCha, SILM	1952-1992	GBIF.org, 2022; Pedro y Camargo, 2003
Partamona nhambiquara Pedro y Camargo, 2003	BE	SAmz	1922	GBIF.org, 2022
Partamona subtilis Pedro y Camargo, 2003	BE	SAmz	1956	GBIF.org, 2022; Pedro y Camargo, 2003
Partamona testacea (Klug, 1807)	BE, LP	SAmz	1921-1956	GBIF.org, 2022; Pedro y Camargo, 2003
Partamona vicina Camargo, 1980	LP, SC	Cer, SAmz	1959-2018	GBIF.org, 2022; Pedro y Camargo, 2003; Townsend et al., 2021
Partamona yungarum Pedro y Camargo, 2003	LP, CB	BSIn	1948-1955	GBIF.org, 2022; Pedro y Camargo, 2003

Tabla 2. Continúa
Lista de taxones	Dep	Eco	Años	Referencias
Género Oxytrigona Cockerell, 1917
Oxytrigona flaveola (Friese, 1900)	BE, LP, SC	Cer, GCha, SAmz, Yun	1921-2020	GBIF.org, 2022; Schwarz, 1948
Oxytrigona mulfordi (Schwarz, 1948)	BE, LP, SC	SAmz	1921-1956	GBIF.org, 2022; Schwarz, 1948
Oxytrigona obscura (Friese, 1900)	BE, CB, LP PA, SC	GCha, SAmz, Yun	1921-2020	GBIF.org, 2022; Schwarz, 1948
Oxytrigona tataira (Smith, 1863)	BE, LP SC, TA	GCha, SAmz, Yun	1921-2018	Camargo, 1988; Clemente y Lahore, 2010; GBIF.org, 2022; Schwarz, 1948; Townsend et al., 2021
Género Scaptotrigona Moure, 1942
Scaptotrigona bipunctata (Lepeletier, 1836)	CH, LP	SaIn, SAmz, Yun	1964 – 2020	Camargo, 1988; Tejada, 2006; este trabajo
Scaptotrigona fimbriata Engel, 2022	BE, SC	BSChi, SAmz	1988 – 2002	Engel, 2022
Scaptotrigona tricolorata Camargo, 1988	CB	SAmz	1949	Engel, 2022; GBIF.org, 2022
Scaptotrigona polysticta Moure, 1950	BE, CH, CB, LP, SC	BSChi, Cer, SaIn, SAmz, Yun	1949 – 2020	FCBC, 2021; Ferrufino, 2013; GBIF.org, 2022; Montaño, 1996; Moure, 1950; Tejada, 2006; Townsend et al., 2021; este trabajo
Scaptotrigona depilis (Moure, 1942)	BE, CB, LP, SC, TA	BSChi, Cer, GCha, SaIn, SAmz, Yun	1949 – 2020	Clemente y Lahore, 2010; Ferrufino, 2013; GBIF.org, 2022; Moure, 1950; Tejada, 2006; Townsend et al., 2021; este trabajo
Scaptotrigona nuda Engel, 2022	BE	SAmz	1988	Engel, 2022
Scaptotrigona grueteri Engel, 2022	LP	Yun	1955-1992	Engel, 2022
Scaptotrigona nigrohirta Nogueira y Santos-Silva, 2022	CB	SAmz	2007	Stearman et al., 2008
Scaptotrigona postica (Latreille, 1807)	BE, SC	GCha, SaIn	1992-2002	Martínez y Cuéllar, 2004; Montaño, 1996
Scaptotrigona semiflava Engel, 2022	SC	BSChi	1951	Engel, 2022
Scaptotrigona turusiri (Janvier, 1955)	CB			Engel, 2022
Scaptotrigona xanthotricha Moure, 1950	CB, LP, SC	BSChi, SAmz, Yun	2020	Camargo, 1988; Ferrufino, 2013; este trabajo
Scaptotrigona yungasensis Engel, 2022	BE, CB, LP	SaIn, SAmz, Yun	1955-1966	Engel, 2022
Género Geotrigona Moure, 1943
Geotrigona fulvohirta (Friese, 1900)	BE, LP	Cer, SAmz	1922 -2005	Camargo y Moure, 1996; GBIF.org, 2022; Tejada, 2006
Geotrigona argentina Camargo y Moure, 1996	CH, SC, TA	Cer, BTBo, GCha	1949-2015	Camargo y Moure, 1996; Clemente y Lahore, 2010
Geotrigona fulvatra Camargo y Moure, 1996	BE, LP	Cer, SAmz	1922 -1956	Camargo y Moure, 1996; GBIF.org, 2022
Geotrigona mattogrossensis (Ducke, 1925)	SC	Cer	1951	Camargo y Moure, 1996; GBIF.org, 2022
Geotrigona tellurica Camargo y Moure, 1996	CB, LP	Cer	1921-1956	Camargo y Moure, 1996; GBIF.org, 2022
Geotrigona mombuca (Smith, 1863)	CH, SC	Cer	1949 -2015	Moure, 1950
Género Ptilotrigona Moure, 1951
Ptilotrigona lurida (Smith, 1854)	BE, LP	SaIn, Yun	1964 – 2020	GBIF.org, 2022; Montaño, 1996
Género Tetragona Lepeletier y Serville, 1828
Tetragona clavipes (Fabricius, 1804)	CB, CH, LP SC	BSChi, BTBo, Cer, SAmz	2020-2018	FCBC, 2021; Nogueira et al., 2022; Stearman et al., 2008; Townsend et al., 2021; este trabajo
Tetragona gottei (Friese, 1900)	BE, CB, LP, SC	BSChi, SaIn, SAmz, Yun	2020-2018	Camargo, 1988; FCBC, 2021; Stearman et al., 2008; Townsend et al., 2021
Tetragona truncata Moure, 1971	LP, PA	SAmz, Yun	?	A.B.E.L.H.A., 2016; Camargo, 1988
Género Trigona Jurine, 1807
Trigona chanchamayoensis Schwarz, 1948	BE, CB, LP, SC	BSChi, Cer, SaIn, SAmz, Yun	1956-2021	Camargo, 1988; FCBC, 2021; GBIF.org, 2022; Montaño, 1996; Moure, 1950; Schwarz, 1948; Townsend et al., 2021; este trabajo
Trigona pallens (Fabricius, 1798)	BE, CB, SC	Cer, SaIn, SAmz	1956-1999	GBIF.org, 2022
Trigona williana Friese, 1900	BE, CB	SAmz	1900-1964	GBIF.org, 2022; Schwarz, 1948
Trigona cilipes (Fabricius, 1804)	BE, CB, LP, SC	BSChi, Cer, SaIn, SAmz, Yun	1951-1962	Almeida, 1992; Camargo, 1988; Kempf-Mercado, 1968; Stearman et al., 2008
Trigona lacteipennis Friese, 1900	BE, LP	SAmz	1922-1976	A.B.E.L.H.A., 2016; GBIF.org, 2022
Trigona dimidiata Smith, 1854	BE, CB, LP	SAmz, Yun	1900-2020	GBIF.org, 2022; Schwarz, 1948; este trabajo
Trigona fulviventris Guérin, 1844	BE, CB	SAmz, Yun	1956-1999	GBIF.org, 2022
Trigona guianae Cockerell, 1910	BE, CB, LP, SC	BSChi, SaIn, SAmz	1921-1999	GBIF.org, 2022; Schwarz, 1948
Trigona albipennis Almeida, 1995	CB, PA	SAmz	1949-1999	A.B.E.L.H.A., 2016; GBIF.org, 2022; Ribeiro, 2021
Trigona fuscipennis Friese, 1900	BE, CB, SC	BSChi, SaIn, SAmz	1992-2020	FCBC, 2021; Montaño, 1996; Stearman et al., 2008; Townsend et al., 2021
Trigona crassipes (Fabricius, 1793)	LP	SAmz, Yun	1921-1956	A.B.E.L.H.A., 2016; Camargo, 1988; GBIF.org, 2022; Schwarz, 1948
Trigona hypogea Silvestri, 1902	BE, CB, PA, SC	SAmz	1921-2018	GBIF.org, 2022; Schwarz, 1948; Stearman et al., 2008; Townsend et al., 2021
Trigona recursa Smith, 1863	BE, LP, SC	Cer, SAmz, Yun	1921-2018	GBIF.org, 2022; Moure, 1950; Schwarz, 1948; Townsend et al., 2021
Trigona amalthea (Olivier, 1789)	BE, CB, LP, PA, SC	BTBo, SAmz	1900-1956	GBIF.org, 2022; Schwarz, 1948
Trigona amazonensis (Ducke, 1916)	BE, CB, LP, PA	Cer, SAmz, Yun	1900-1956	Camargo, 1988; GBIF.org, 2022; Tejada, 2006
Trigona branneri Cockerell, 1912	BE, CB, LP, SC	BSChi, Cer, SaIn, SAmz, Yun	1956-2020	Camargo, 1988; FCBC, 2021; GBIF.org, 2022; Montaño, 1996; Townsend et al., 2021
Trigona corvina Cockerell, 1913	BE, SC	Cer, SAmz	1956-1959	GBIF.org, 2022
Trigona dallatorreana Friese, 1900	BE, CB, LP	SAmz, Yun	1900-2020	Camargo, 1988; GBIF.org, 2022; Schwarz, 1948; este trabajo
Trigona hyalinata (Lepeletier, 1836)	BE, LP	SAmz	1922-1964	GBIF.org, 2022; Schwarz, 1948
Trigona silvestriana (Vachal, 1908)	CB, LP, SC	BSChi, Cer, SAmz, Yun	1900-2018	FCBC, 2021; GBIF.org, 2022; Stearman et al., 2008; Townsend et al., 2021
Trigona truculenta Almeida, 1984	BE, CB, LP	SAmz	1956-1991	A.B.E.L.H.A., 2016; GBIF.org, 2022
Género Cephalotrigona Schwarz, 1940
Cephalotrigona capitata (Smith, 1854)	BE, CB, LP, SC, TA	SAmz, Yun, Cer, SaIn, BSChi, GCha	1900-2021	FCBC, 2021; GBIF.org, 2022; Kempf-Mercado, 1968; Schwarz, 1948; Tejada, 2006; Townsend et al., 2021
Cephalotrigona femorata (Smith, 1854)	BE, LP	SAmz	1922	Schwarz, 1948
Género Tetragonisca Moure, 1946
Tetragonisca angustula (Latreille, 1811)	CB, CH, LP SC, TA	BSChi, BTBo, ChaSe, GCha, SAmz, Yun	1956-2020	Clemente y Lahore, 2010; Copa-Alvaro, 2004; Flores, 2016; GBIF.org, 2022; Martínez y Cuéllar, 2004; Stearman et al., 2008; Tejada, 2006; este trabajo
Tetragonisca fiebrigi (Schwarz, 1938)	SC, CH	BSChi, BTBo, Cer	1949-2020	Ferrufino, 2013; Moure, 1950; Townsend et al., 2021; este trabajo
Tetragonisca weyrauchi (Schwarz, 1943)	SC, CH	BSChi, BTBo, Cer	1921-2020	GBIF.org, 2022; Tejada, 2006; este trabajo
Género Frieseomelitta Ihering, 1912
Frieseomelitta flavicornis (Fabricius, 1798)	LP	SAmz	1990	GBIF.org, 2022
Frieseomelitta silvestrii (Friese, 1902)	SC	Cer	1949-1959	GBIF.org, 2022; Moure, 1950
Frieseomelitta trichocerata Moure, 1990	BE, CB, LP	SAmz, BSIn	~1950 -2020	GBIF.org, 2022; Moure, 1950
Frieseomelitta varia (Lepeletier, 1836)	SC	Cer	1949-2018	GBIF.org, 2022; Moure, 1950; Townsend et al., 2021
Género Duckeola Moure, 1944
Duckeola ghilianii (Spinola, 1853)	BE	SAmz	1964	Smith-Pardo y Engel, 2001
Género Plebeia Schwarz, 1938
Plebeia asthenes Engel, 2021	CB	SAmz	1999	Engel, 2021
Plebeia minima (Gribodo, 1893)	LP, CB	SAmz	1921 – 2021	Schwarz, 1838; este trabajo.
Plebeia alvarengai Moure, 1994	CH, CB, SC	BSChi, BTBo, Cer, SAmz	1999-2000	FCBC, 2021; GBIF.org, 2022; Townsend et al., 2021
Plebeia droryana (Friese, 1900)	BE, SC	BSIn	1992-2018	GBIF.org, 2022; Townsend et al., 2021
Plebeia kerri Moure, 1950	CB, SC	SAmz	1949 – 2016	Ferrufino y Vit, 2013; Moure, 1950; este trabajo
Plebeia mosquito (Smith, 1863)	SC	SAmz	1949	Moure, 1950
Plebeia nigrifacies (Friese, 1900)	CB, LP	Yun	1950 – 1972	GBIF.org, 2022; Melo, 2016, Wille, 1960
Plebeia peruvicola Moure, 1994	SC	BSChi	2022	Morón et al., 2023
Plebeia remota (Holmberg, 1903)	CB, LP	SAmz, Yun	2020	Camargo, 1988; Camargo, et al., 2013; este trabajo.
Género Lestrimelitta Friese, 1903
Lestrimelitta rufa (Friese, 1903)	BE, CH, SC	BTBo, CeChi, SILM	2018-2020	Townsend et al., 2021
Lestrimelitta rufipes (Friese, 1903)	BE, CH, SC	CeChi, ChaS, SILM	2018-2020	Townsend et al., 2021
Género Nannotrigona Cockerell, 1922
Nannotrigona schultzei (Friese, 1901)	BE, CB, LP	BSChi, BTBo, SaIn, Yun, SAmz	1921 – 1988	GBIF.org, 2022; Gonzalez et al., 2021; Rasmussen y Gonzalez, 2017
Nannotrigona melanocera (Schwarz, 1938)	BE, CH, CB, LP, SC	BSChi, BTBo, SaIn, Yun, SAmz	1921 – 2020	Camargo, 1988; FCBC, 2021; GBIF.org, 2022; Montaño, 1996; Rasmussen y Gonzalez, 2017; Townsend et al., 2021
Nannotrigona testaceicornis (Lepeletier, 1836)	LP, SC	Cer, SAmz	1956 – 1959	GBIF.org, 2022
Género Scaura Schwarz, 1938
Scaura amazonica Nogueira, Oliveira e Oliveira, 2016	BE, CB, LP, SC	SaIn, SAmz	1921-1976	Nogueira, 2016; Nogueira et al., 2019
Scaura latitarsis (Friese, 1900)	BE, CB, LP, SC	BSChi, Cer, SaIn, SAmz	1921-2018	Camargo, 1988; GBIF.org, 2022; Nogueira, 2016; Nogueira et al., 2019; Stearman et al., 2008; Townsend et al., 2021
Scaura longula (Lepeletier, 1836)	BE	SaIn, SAmz	1922	Nogueira, 2016; Nogueira et al., 2019
Scaura timida (Silvestri, 1902)	CB, SC	BSChi, Cer, SAmz	1949-2021	Camargo y Pedro, 2002; Kempf-Mercado, 1968; Moure, 1950; este trabajo
Género Melipona Illiger, 1806
Melipona amazonica Schulz, 1905	LP	BSIn	?	GBIF.org, 2022
Melipona tumupasae Schwarz, 1932	LP	Cer, SAmz	1921-2005	Schwarz, 1932; Tejada, 2006
Melipona fasciculata Smith, 1854	BE, LP	SAmz, Yun	1996-2001	GBIF.org, 2022
Melipona grandis Guérin, 1844	BE, CB, LP, SC	BSChi, Cer, SAmz	1922-2005	Ferrufino, 2013; Schwarz, 1932; Stearman et al., 2008; Tejada, 2006
Melipona quinquefasciata Lepeletier, 1836	CB, CH, TA	BTBo, GCha, SAmz	1900 – 2009	Clemente y Lahore, 2010; Schwarz, 1932
Melipona baeri Vachal, 1904	BE, CB, CH, LP, TA	BTBo, BSIn, Cer, GCha, SaIn, SAmz	1900 – 2021	Clemente y Lahore, 2010; Cockerell, 1919; GBIF.org, 2022; Moure, 1950; Schwarz, 1932
Melipona fuscata Lepeletier, 1836	LP, CB	Yun, SAmz	1900 – 1949	Cockerell, 1919; GBIF.org, 2022
Melipona lunulata Friese, 1900	LP, SC	Yun, GCha, BSChi	1921 – 1949	GBIF.org, 2022; Moure, 1950
Melipona orbignyi (Guérin, 1844)	BE, SC, TA	Cer, GCha, SaIn	1834 – 2009	Clemente y Lahore, 2010; GBIF.org, 2022; Moure, 1950; Schwarz, 1932
Melipona boliviana Schwarz, 1932	BE, CB, LP	Yun, SAmz	1921 – 1992	GBIF.org, 2022; Schwarz, 1932
Melipona brachychaeta Moure, 1950	BE, CB, CH LP, SC, TA	Yun, SAmz	1921 – 2020	Camargo, 1988; Clemente y Lahore, 2010; Ferrufino, 2013; GBIF.org, 2022
Melipona crinita Moure y Kerr, 1950	BE, CB, PA, SC	Yun, SAmz	1949 – 2020	Camargo, Pedro, et al., 2013; Ferrufino, 2013; GBIF.org, 2022
Melipona eburnea Friese, 1900	CB, LP, PA	Yun, SAmz	1900 -2021	Cockerell, 1919; GBIF.org, 2022; Gonzalez et al., 2021
Melipona flavolineata Friese, 1900	CB, LP	Cer, SAmz	2005 -2007	Stearman et al., 2008; Tejada, 2006
Melipona fuliginosa Lepeletier, 1836	BE, CB, LP, SC	BSIn, GCha, SaIn, Yun, SAmz	1952 – 2020	Camargo y Pedro, 2008; Cockerell, 1919; GBIF.org, 2022; Townsend et al., 2021
Melipona illota Cockerell, 1919	LP	Yun	1950?	GBIF.org, 2022
Melipona nebulosa Camargo, 1988	LP	Cer, Yun	2005	Camargo, 1988; GBIF.org, 2022; Tejada, 2006
Melipona rufescens Friese, 1900	BE, CB, LP	Yun, SAmz, SaIn	1900-1984	GBIF.org, 2022; Ramos et al., 2015
Melipona rufiventris Lepeletier, 1836	BE, CB, LP, SC, TA	Yun, SAmz, SaIn	1949-2020	Clemente y Lahore, 2010; Copa – Alvaro, 2016; FCBC, 2021; GBIF.org, 2022; Montaño, 1996; Stearman et al., 2008; Townsend et al., 2021
Melipona seminigra abunensis Cockerell, 1912	BE	SAmz	1922-1956	GBIF.org, 2022; Schwarz, 1932
Melipona titania (Gribodo, 1893)	LP	Yun	1900	A.B.E.L.H.A., 2016; GBIF.org, 2022
Género Trigonisca Moure, 1950
Trigonisca longicornis (Friese, 1903)	BE	SAmz	1921-1922	Pedro y Camargo, 2009
Trigonisca muelleri (Friese, 1900)	BE, LP	SAmz, Yun	1996-2001	GBIF.org, 2022; Kempf-Mercado, 1968
Trigonisca browni Camargo y Pedro, 2005	BE, LP	SAmz, Yun,	1964-2004	Camargo y Pedro, 2005
Trigonisca duckei (Friese, 1900)	BE	SAmz	1922	Schwarz, 1948
Trigonisca intermedia Moure, 1990	CH, SC	BSIn, Cer	2018 -2021	Townsend et al., 2021; este trabajo
Trigonisca longitarsis (Ducke, 1916)	LP	Yun	1964-2004	Camargo, 1988
Trigonisca pediculana (Fabricius, 1804)	LP, BE	Yun, SAmz	1922	Albuquerque y Camargo, 2007; Camargo, 1988
Trigonisca vitrifrons Albuquerque y Camargo, 2007	CB, SC	Cer, SAmz	2018 -2021	Townsend et al., 2021; este trabajo

Riqueza y distribución

El primer intento de catalogación de las abejas pertenecientes a la tribu Meliponini en Bolivia fue realizado por Moure (1950), identificando 16 especies procedentes del Chaco y de comunidades próximas a la frontera con Brasil. Posiblemente, ése fue el inicio de contacto con Kempf-Mercado (1968), quien informa sobre 30 especies para el departamento de Santa Cruz, con la colaboración directa del Prof. J.S. Moure. Posteriormente, en 2007, el catálogo de abejas en la región neotropical proporcionó una lista para Bolivia que consiste en 88 especies (Camargo y Pedro, 2007). Un esfuerzo adicional para sistematizar la diversidad de estas abejas fue realizado por Townsend (2016), quien recopilando información de la consultoría de Lisperguer (2015), presenta una lista de 56 especies y 14 géneros. Los resultados obtenidos revelan que la diversidad de abejas sin aguijón en Bolivia podría ser considerablemente mucho mayor, alcanzando hasta 133 especies. Este incremento se atribuye a los avances actuales en sistemática y a los recientes proyectos de manejo de abejas sin aguijón en el país. 

Esta gran diversidad de abejas meliponinas ha sido registrada en 7 de los 9 departamentos de Bolivia, lo que representa un alcance de 77% del territorio. Sin embargo, un hallazgo reciente de un posible nido de Melipona baeri en comunidades de valles secos interandinos del departamento de Potosí (Marcelino Pinto, com. pers.), indica que existen áreas con vacíos de información que requieren ser evaluados en cuanto a su diversidad, especialmente en bosques secos tropicales (Bosques Interandinos). Esta situación también sucede en las ecorregiones que presentan, aproximadamente, 5% de las especies como el Gran Chaco y el Bosque Tucumano-Boliviano. En la ecorregión Bosque Tucumano-Boliviano se están logrando avances importantes a través de proyectos de fortalecimiento en meliponicultura (Delgado y Martínez, 2021) y estudios ecológicos recientes (Adler et al., 2023; Urquizo et al., 2022), los cuales están aportando nuevos datos taxonómicos y geográficos. Por otro lado, las ecorregiones Sudoeste de la Amazonía y los Yungas son las que poseen mayor riqueza de especies (90%, 108 especies) y se ubican en pisos ecológicos de pie de monte y montano (fig. 3C), coincidiendo con la localización del “hot-spot” de los Andes Tropicales de Myers et al. (2000), lo que resulta muy importante para la conservación de estas ecorregiones.

Los registros altitudinales de abejas sin aguijón muestran que la mayor diversidad está por debajo de 1,000 m (94% de las especies), mientras que son escasas las especies que existen por encima de 2,000 m. Sin embargo, se ha reportado un caso poco común de Geotrigona tellurica registrada por encima de 4,000 m en Viacha (La Paz) (Camargo y Moure, 1996; Camargo, et al., 2013), el cual debe ser validado. A pesar de ello, en Bolivia y otros países de Sudamérica existen pocas evaluaciones específicas de como varía la diversidad de abejas sin aguijón en un gradiente altitudinal. Sin embrago, es posible que esta variación responda al relieve altitudinal, microclima y la estructura de la vegetación, aspectos evaluados por Cómbita et al. (2022) en mariposas. En Costa Rica se ha llevado a cabo un estudio sobre cómo varía la diversidad de especies en un gradiente altitudinal, demostrando que la elevación puede ser un factor importante que influye en la composición, especialmente en abejas de la tribu Meliponini (Conrad et al., 2021)

Registros y sesgos taxonómicos

Es importante destacar que los datos recopilados de catálogos como el de Abejas Moure, A.B.E.L.H.A., WBD y GBIF, subestiman la riqueza de especies. Esta subestimación posiblemente se deba a la necesidad de una actualización tanto en la base de datos de registros geográficos como de su sistemática. Ademas, se evidenciaron sesgos geográficos, especialmente en GBIF donde 29.6% de los registros tuvieron que corregirse y georreferenciarse. Este aspecto ha sido observado por Rocha-Ortega et al. (2021) y García-Rosello et al. (2023), quienes coinciden en que GBIF puede presentar sesgos de tipo taxonómico, geográfico y temporal. Por tanto, se recomienda evaluar la calidad de la información antes de utilizar estos registros para mejorar la idoneidad de los mismos. Un caso especial de sesgos geográfico se observa en los registros del franciscano P. Wolfgang Priewasser, asignados geográficamente a Tarata como el lugar de recolecta en diferentes trabajos (Cockerell, 1919; GBIF, 2022; Schwarz, 1932, 1948; Wille, 1962). Sin embargo, se pudo evidenciar que en 1900 visitó la localidad de Chimoré por las misiones del Colegio Apostólico de San José de Tarata (Barrado-Manzano, 1946; Hollaus, 2010), lo que sugiere que los datos geográficos registrados en Tarata posiblemente no correspondan. 

Por otro lado, hubo registros de especies que estaban citados erróneamente en Bolivia, como son: 1) Camargoia nordestina reportado por Tejada (2006) en los pueblos indígenas Tacana, ha sido descartada como presente en Bolivia, según registros publicados por Camargo (1996) y A.B.E.L.H.A. (2016), ya que su distribución está restringida al este y noreste del Brasil; 2) Melipona (Melipona) favosa (Fabricius, 1798) citado por Lisperguer (2015), que no se encuentra presente en Bolivia, ya que su distribución más frecuente es hacia al norte de Sudamérica (Colombia, Venezuela, Guyana y Surinam), según los mapas de distribución que se muestran en Pedro y Camargo (2013) y A.B.E.L.H.A. (2016). 

Otras especies, que generan dudas sobre su presencia en Bolivia son Cephalotrigona zexmeniae (Cockerell, 1912), probablemente un registro erróneo de GBIF y A.B.E.L.H.A., dado que su distribución se encuentra principalmente en Centroamérica (México, Panamá, entre otros) (Ayala, 1999). Aunque este registro podría corresponder a Trigona fulviventris debido a su parecido (Engel et al., 2023). También se plantea la duda sobre el registro de Partamona cupira (Smith, 1863) reportado por GBIF, ya que esta especie se distribuye al sureste de Brasil en la catinga brasileña (Camargo y Pedro, 2003). Lo mismo ocurre con Nannotrigona testaceicornis registrado en Argentina, Brasil y Paraguay (Rasmussen y González, 2017), se tiene reportes en La Paz (San Buenaventura) y Santa cruz (Robore), en las plataformas de GBIF y A.B.E.L.H.A., lo cual debe ser validado. Igualmente, se debe evaluar la presencia de Melipona fasciculata, cuya distribución es más hacia al noreste de Brasil, pero se ha reportado en los territorios indígenas Tacana (La Paz) por Tejada (2006) y Yuqui (Cochabamba), según Stearman et al. (2008). 

Otros registros con dudas biogeográficas y taxonómicas provienen de Santa Cruz, como Plebeia mosquito (Smith, 1863), identificado por Moure (1950) en Porongo y Melipona rufiventris xantina reportado por Kempf-Mercado (1968), designado como “incertae sedis”(Melo et al., 2022). Igualmente ocurre para Lestrimelitta limao (Smith, 1863), con una distribución más restringida al centro del Brasil (Cerrado y Catinga) (Marchi y Melo, 2004) y que ha sido registrado por Montaño (1996) en pueblos indígenas Sirionó (Beni), lo que posiblemente corresponda a L. rufa o L. rufipes, según registros obtenidos del mismo lugar por Townsend et al. (2021).

La inclusión de 11 especies de abejas sin aguijón para Bolivia puede deberse a su proximidad geográfica, lo cual incrementa la diversidad de especies. Por ejemplo, Scaptotrigona jujuyensis, Plebeia mansita y Trigonisca sachamiski se encuentran próximos a la frontera con Argentina (Álvarez y Lucia, 2018; Álvarez et al., 2021; Lucia y Alvarez, 2023), por lo que pueden estar presentes en el departamento de Tarija. Otras 9 especies están registradas próximas al departamento de Pando y el noreste del Beni, como: Partamona batesi, Trigona juvenili, Melipona amazonica, M. titania, M. flavolineata, Trigonisca gracilis, T. hirsuticorni, T. mendersoni y T. rondoni, Lestrimelitta glabrata (A.B.E.L.H.A., 2016; Camargo y Pedro, 2005, 2009; Pedro y Camargo, 2003, 2009; Marchi y Melo, 2006; Ribeiro, 2021). Para el departamento de Santa Cruz, cerca del puerto Quijarro, se ha registrado la especie Nannotrigona chapada en la ciudad fronteriza de Corumba (Brasil) (A.B.E.L.H.A., 2016).

Tras una exhaustiva revisión de artículos científicos, libros y bases de datos digitales como el Catálogo de Abejas Moure, GBIF, WBD y A.B.E.L.H.A., junto con los registros obtenidos de CB-IEBUSFX en los diversos proyectos desarrollados en Cochabamba y Chuquisaca, se han recopilado un total de 616 registros. A partir de esta compilación de información, se tienen identificadas 118 especies de abejas sin aguijón en Bolivia, distribuidas en 19 géneros. Sin embargo, es importante destacar que esta cifra podría ser aún mayor con la posible adición de 15 especies descritas cerca de las fronteras con Brasil y Argentina.

 La temporalidad de los registros abarca desde 1832 hasta 2022 y es digno de mención el trabajo de destacados colectores como W. M. Mann y Peña Luis, cuyos datos de campo han sido fundamentales. Asimismo, las contribuciones significativas en términos de sistemática, biología y biogeografía realizadas por autores como Schwarz, Moure, Kempff, Camargo, Pedro y Engel, han enriquecido considerablemente nuestro entendimiento sobre las abejas sin aguijón en Bolivia.

En cuanto a la distribución altitudinal, se ha observado que la mayor riqueza de especies se encuentra por debajo de 1,000 m, aunque también se han registrado algunas especies por encima de 2,000 m. Las ecorregiones de tierras bajas más diversas son los Yungas y el sudoeste de la Amazonia, que concentran 90% de las especies y abarcan los departamentos de La Paz, Beni, Cochabamba y Santa Cruz, sin embargo, del departamento de Pando se tiene muy poca información. De manera similar, se ha observado una carencia de inventarios publicados en los departamentos de Chuquisaca y Tarija, los cuales corresponden a ecorregiones de los bosques secos tropicales (Bosques Secos Interandinos, Gran Chaco y Bosque Tucumano Boliviano), donde se sugiere una subestimación de la riqueza de especies en estas áreas.

Agradecimientos

A Alexandria Saravia por la revisión y las valiosas sugerencias para mejorar el manuscrito, así como a Daniela Morón por sus valiosos aportes y comentarios sobre las especies de abejas sin aguijón del Bosque Seco Chiquitano. Este trabajo se ha beneficiado de las becas de investigación otorgadas por la Dirección de Investigación, Ciencia y Tecnología – USFX durante las gestiones 2019, 2021 y 2022, cuyo apoyo se agradece sinceramente. Además, se reconoce el respaldo brindado por la Facultad de Ciencias Químico Farmacéuticas y Bioquímicas de la Universidad San Francisco Xavier de Chuquisaca. 

Referencias 

 A.B.E.L.H.A. (Asociación Brasileña de Estudios de las Abejas) (2016). Sistema de informação científica sobre abelhas Neotropicais, Abelhas No Brasil. Recuperado el 14 enero, 2023 de: http://abelha.cria.org.br/

Adler, M., Escóbar-Márquez, L., Solis-Soto, M. T. y Pinto, C. F. (2023). Stingless bees: uses and management by meliponiculturist women in the Chaco region of Bolivia. Journal of Ethnobiology and Ethnomedicine, BioMed Central Ltd, 19, 1–15. https://doi.org/10.1186/s13002-022-00574-0

Aguilera, F. J. (2019). Meliponicultura en Bolivia, Sociedad Boliviana Entomología, Santa Cruz de la Sierra, Bolivia. Recuperado el 13 noviembre, 2022 de: https://youtu.be/WPFi_Alf57s 

Álvarez, L. J. (2015). Diversidad de las abejas nativas de la tribu Meliponini (Hymenoptera, Apidae) (Tesis doctoral). Universidad Nacional de La Plata, Buenos Aires, Argentina. https://doi.org/10.35537/10915/52025

Álvarez, L. J., Flores, F. F. y Rasmussen, C. (2021). A new species of Plebeia Schwarz (Hymenoptera: Apidae) from the Argentine yungas. Revista de La Sociedad Entomologica Argentina, 80, 35–41. http://dx.doi.org/10.25085/rsea.800206

Álvarez, L. J. y Lucia, M. (2018). Una especie nueva de Trigonisca y nuevos registros de abejas sin aguijón para la Argentina (Hymenoptera: Apidae). Caldasia, 40, 232–245. http://dx.doi.org/10.15446/caldasia.v40n2.70870

Ascher, J. y Pickering, J. (2020). World bee diversity by country. Discover life bee species guide and World checklist (Hymenoptera: Apoidea: Anthophila). Recuperado el 20 julio, 2023 de: https://www.discoverlife.org/nh/cl/counts/Apoidea_species.html 

Ayala, R. (1999). Revisión de las abejas sin aguijón de México (Hymenoptera: Apidae: Meliponini). Folia Entomológica Mexicana, 106, 1–123.

Barrado-Manzano, A. (1946). Las misiones Franciscanas en Bolivia, Real Monasterio de Guadalupe. Sevilla, España: Imprenta San Antonio. Recuperado el 22 enero, 2022 de: https://www.pueblos-originarios.ucb.edu.bo/digital/10600
1558.pdf

Camargo, J. M. F. (1988). Meliponinae (Hymenoptera, Apidae) da coleção do ‘Istituto di Entomologia Agraria’, Portici, Itália. Revista Brasileira de Entomologia, 32, 351–373.

Camargo, J. M. F. (1996). Meliponini neotropicais: o gênero Camargoia moure, 1989 (Apinae, Apidae, Hymenoptera). Arquivos de Zoologia, 33, 71–92. https://doi.org/10.11606/issn.2176-7793.v33i2-3p71-92 

Camargo, J. M. F. y Moure, J. S. (1994). Meliponinae neotropicais: os gêneros Paratrigona Schwarz, 1938 e Aparatrigona Moure, 1951 (Hymenoptera, Apidae), Arquivos de Zoologia, 32, 33–109. https://doi.org/10.11606/issn.2176-7793.v32i2p33-109

Camargo, J. M. F. y Moure, J. S. (1996). Meliponini Neotropicais: o gênero Geotrigona Moure, 1943 (Apinae, Apidae, Hymenoptera), com especial referência à filogenia e biogeografia. Arquivos de Zoologia, 33, 95–161. https://doi.org/10.11606/issn.2176-7793.v33i2-3p95-161

Camargo, J. M. F. y Pedro, S. R. M. (2002). Uma espécie nova de Schwarzula da Amazônia (Hymenoptera, Apidae, Meliponini). Iheringia – Serie Zoologia, 92, 101–112.

Camargo, J. M. F. y Pedro, S. R. M. (2003). Meliponini Neotropicais: o gênero Partamona Schwarz, 1939 (Hymenoptera, Apidae, Apinae) – bionomia e biogeografia. Revista Brasileira de Entomologia, 47, 311–372.

Camargo, J. M. F. y Pedro, S. R. M. (2005). Meliponini Neotropicais: o gênero Dolichotrigona Moure (Hymenoptera, Apidae, Apinae). Revista Brasileira de Entomologia, 49, 69–92.

Camargo, J. M. F. y Pedro, S. R. M. (2007). Meliponini. En J. S.Moure, D. Urban y G. A. R. Melo (Eds.), Catalogue of bees (Hymenoptera, Apoidea) in the Neotropical Region (pp. 1058). Curitiba, Brasil: Sociedade Brasileira de Entomologia. 

Camargo, J. M. F. y Pedro, S. R. M. (2009). Neotropical Meliponini: the genus Celetrigona Moure (Hymenoptera: Apidae, Apinae). Zootaxa, 2155, 37–54. https://doi.org/10.11646/zootaxa.2155.1.4

Camargo, J. M. F., Pedro, S. R. M. y Melo, A. R. (2013). Meliponini Lepeletier, 1836. Catalogue of bees (Hymenoptera, Apoidea) in the Neotropical Region – online version., Recuperado el 27 diciembre, 2022 de: http://moure.cria.org.br/catalogue?id=83018 

Camargo, J. M. F., Roubik, D. W. y Pedro, S. R. M. (2013). Historical biogeography of the Meliponini (Hymenoptera, Apidae, Apinae) of the Neotropical region. EnP. Vit, S. R. M. Pedro, & D. W. Roubik (Eds.), Pot-honey: a legacy of stingless bees (pp. 19–34). New York: Springer. https://doi.org/10.1007/978-1-4614-4960-7_2

Campos, E. y Peducassé, E. (2017). Las abejas nativas del Chaco en riesgo de desaparecer, ECOS, Sucre, Bolivia. Recuperado el 17 octubre, 2022 de: https://correodelsur.com/ecos/20170205_las-abejas-nativas-del-chaco-en-riesgo-de-desaparecer.html 

Chang, W., Cheng, J., Allaire, J., Sievert, C., Schloerke, B., Xie, Y. et al. (2023). Shiny: web application framework for R. Recuperado el 3 enero, 2024 de: https://shiny.posit.co/

Clemente, K. J. y Lahore, J. L. (2010). Manual de meliponicultura. Asociación de apicultores del Gran Chaco (ADACHACO) – Fundación PUMA, Villa Montes. Tarija.

Cockerell, T. D. A. (1919). Bees in the collection of the United States National Museum —3. Proceedings of the United States National Museum, 55, 167–221.

Cómbita, J. L., Giraldo, C. E. y Escobar, F. (2022). Environmental variation associated with topography explains butterfly diversity along a tropical elevation gradient. Biotropica, 54, 146–156. https://doi.org/10.1111/btp.13040

Conrad, K. M., Peters, V. E. y Rehan, S. M. (2021). Tropical bee species abundance differs within a narrow elevational gradient. Nature Publishing Group UK, 11, 1–12. https://doi.org/10.1038/s41598-021-02727-9

Copa-Álvaro, M. (2016). Patrones de nidificación de Trigona (Tetragonisca) angustula y Melipona rufiventris (Hymenoptera: Meliponini) en el norte de La Paz, Bolivia. Ecología Aplicada, 3, 82. https://doi.org/10.21704/rea.v3i1-2.274

Delgado, A. y Martínez, E. (2021). Guía práctica para el manejo de abejas nativas sin aguijón, Fundación PASOS -Cooperación Alemana, Sucre, Bolivia.

De Albuquerque, P. M. C. y Camargo, J. M. F. (2007). New species of Trigonisca Moure (Hymenoptera, Apidae, Apinae). Revista Brasileira de Entomologia, 51, 160–175. https://doi.org/10.1590/s0085-56262007000200005

Engel, M. S. (2021). A key to the species of Nanoplebeia, with descriptions of four new species (Hymenoptera: Apidae). Journal of Melittology, 106, 1–14. https://doi.org/10.17161/jom.i106.15735

Engel, M. S. (2022). A second species of the stingless bee genus Plectoplebeia (Hymenoptera: Apidae). Entomologist’s Monthly Magazine, 158, 79–86. https://doi.org/10.31184/M00138908.1582.4103

Engel, M. S., Rasmussen, C., Ayala, R. y de Oliveira, F. F. (2023). Stingless bee classification and biology (Hymenoptera, Apidae): a review, with an updated key to genera and subgenera. Zookeys, 1172, 239–312. https://doi.org/10.3897/zookeys.1172.104944

Ferrufino, U. y Vit, P. (2013). Pot-honey of six meliponines from Amboró National Park, Bolivia. EnP. Vit, S. R. M. Pedro y D. W. Roubik (Eds.), Pot-honey: a legacy of stingless bees (pp. 3–17). New York: Springer. https://doi.org/10.1007/978-1-4614-4960-7_29

Ferrufino, U. y Aguilera, F. J. (2006). Producción rural sostenible con abejas melíferas sin aguijón. Asociación Ecologica del Oriente – A.S.E.O., Santa Cruz de la Sierra, Bolivia.

Freitas, B. M., Imperatriz-Fonseca, V. L., Medina, L. M., Kleinert, A. M. P., Galetto, L., Nates-Parra, G. et al. (2009). Diversity, threats and conservation of native bees in the Neotropics. Apidologie, 40, 332–346. https://doi.org/10.1051/apido/2009012

GADC/ALD. (2014). Transferencia de recursos públicos-privados en especie para el proyecto: “Implementación de capacidades productivas de miel en mujeres Yuracares- Trópico”. Gobierno Autónomo Departamental de Cochabamba – Asamblea Legislativa Departamental, Cochabamba, Bolivia.

Garcia-Rosello, E., González-Dacosta, J., Guisande, C. y Lobo, J. M. (2023). GBIF falls short of providing a representative picture of the global distribution of insects. Systematic Entomology, 48, 489–497. https://doi.org/10.1111/syen.12589

GBIF.org. (2022). GBIF Occurrence download, Global Biodiversity Information Facility, Museum National D’Histoire Naturelle. Recuperado el 03 enero, 2022 de: https://doi.org/10.5852/EJT.2014.71

González, V. H., Amith, J. D. y Stein, T. J. (2018). Nesting ecology and the cultural importance of stingless bees to speakers of Yoloxóchitl Mixtec, an endangered language in Guerrero, Mexico. Apidologie, 49, 625–636. https://doi.org/10.1007/s13592-018-0590-2

Google. (2022). Google Earth Pro, Google LLC. Recuperado el 03 enero, 2022 de: https://maps.google.com/intl/es/earth/download/gep/agree.html

Hamilton, C. (2021). Lat Lon tools, QGIS Python Plugins Repository. Recuperado el 10 diciembre, 2022 de: https://github.com/NationalSecurityAgency/qgis-latlontools-plugin 

Hijmans, R. J., Guarino, L. y Mathur, P. (2012). DIVA-GIS | free, simple & effective, LizardTech, Inc. – University of California, California, USA. Recuperado el 5 agosto, 2023 de: https://www.diva-gis.org/ 

Hollaus, P. M. (2010). Die Schriftsteller der Tiroler Franziskanerprovinz vom hl . Leopold gesammelt von P. Gerold Fußenegger OFM (1901-1965). Archiv der Tiroler Franziskanerprovinz. Recuperado el 24 septiembre, 2023 de: http://franziskaner.members.cablelink.at/provinzarchiv/publikationen/pa_schriftsteller_tiroler_provinz.pdf

Hrncir, M., Jarau, S. y Barth, F. G. (2016). Stingless bees (Meliponini): senses and behavior. Journal of Comparative Physiology A: Neuroethology, Sensory, Neural, and Behavioral Physiology, 202, 597–601. https://doi.org/10.1007/s00359-016-1117-9

Ibisch, P. L., Beck, S. G., Gerkmann, B. y Carretero, A. (2003). Ecoregiones y ecosistemas.En P. L.Ibisch y G. Mérida (Eds.), Biodiversidad: la riqueza de Bolivia, estado de conocimiento y conservación (pp. 47–88). Santa Cruz, Bolivia: Editorial FAN. 

I.G.M. (Instituto Geográfico Militar). (2021). Bolivia topographic maps 1:50,000, Perry-Castañeda Library (PCL) Map Collection. Recuperado el 10 diciembre, 2022 de: https://maps.lib.utexas.edu/maps/topo/bolivia/index-50k.html 

INE (Instituto Nacional de Estadística). (2016). Localización de poblaciones del Estado Plurinacional de Bolivia, GeoBolivia, La Paz, Bolivia. Recuperado el 10 diciembre, 2022 de: http://geo.gob.bo/download/?w=igm&l=POBLACIONES 

Kempf-Mercado, N. (1962). Mutualism between Trigona compressa Latr. and Crematogaster stolli Forel (Hyment-
opera: Apidae). Journal of the New York Entomological Society, 70, 215–217.

Kempf-Mercado, N. (1968). Contribución al conocimiento de las abejas indígenas (Meloponidae) del departamento de Santa Cruz. La Paz, Bolivia: Editorial Don Bosco.

Layek, U., Das, A. y Karmakar, P. (2022). Supplemental stingless bee pollination in Fennel (Foeniculum vulgare Mill.): an assessment of impacts on native pollinators and crop yield. Frontiers in Sustainable Food Systems, 6, 1–13. https://doi.org/10.3389/fsufs.2022.820264

Lisperguer, A. (2015). Las abejas sin aguijón en Bolivia: conocimientos, usos y su vulnerabilidad ante efectos antropicos y el cambio climático. Informe inédito de una consultoria para la Cancilleria Boliviana. La Paz. Bolivia. 

Lucia, M. y Álvarez, L. J. (2023). Tribu Meliponini, Apidae (Hymenoptera: Anthophila) species from Argentina and Uruguay. Recuperado el 20 julio, 2023 de: https://biodar.unlp.edu.ar/apidae/index-es.html 

MA (Ministerio de Autonomías). (2015). Límites municipales de Bolivia (339 Municipios), La Paz, Bolivia. Recuperado el 5 agosto, 2022 de: http://geo.gob.bo/geoserver/fondos/wms/ 

Marchi, P. y Melo, G. A. R. (2004). Notas sobre o tipo de Trigona limao Smith (Hymenoptera, Apidae, Lestrimelitta). Revista Brasileira de Entomologia, 48, 379–382. https://doi.org/10.1590/S0085-56262004000300013

Marchi, P. y Melo, G. A. R. (2006). Revisão taxonômica das espécies brasileiras de abelhas do gênero Lestrimelitta Friese (Hymenoptera, Apidae, Meliponina). Revista Brasileira de Entomologia, 50, 6–30. https://doi.org/10.1590/S0085-56262006000100002

Martínez, T. y Cuéllar, R. L. (2004). Manejo de abejas nativas señorita (Trigona tetragonisca angustula) y abeja corta pelo (Escaptutrigona posica) en tres comunidades de Isoso. Memorias VII Congreso Internacional sobre manejo de fauna silvestre en la Amazonía y América Latina. Wildlife Conservation Society, Ilheus, Brasil.

Melo, G. A. R. (2016). Plectoplebeia, a new Neotropical genus of stingless bees (Hymenoptera: Apidae). Zoologia (Curitiba), 33, 1–8. https://doi.org/10.1590/S1984-4689zool-20150153

Melo, G. A. R., Moure, J. S., Urban, D., Maia, E, Molin, A. D. y Gonçalves, R. B. (2022). “Catálogo de abelhas Moure”. Recuperado el 15 octubre, 2022 de: http://moure.cria.org.br/catalogue.

Michener, C. D. (2013). The Meliponini. EnP. Vit, S. R. M. Pedro y D. W. Roubik (Eds.), Pot-honey: a legacy of stingless bees (pp. 3–17). New York: Springer. https://doi.org/10.1007/978-1-4614-4960-7_1

Morón, D., Adler, M., & Justiniano, H. (2023). Abejas nativas de un paisaje productivo representativo de la Chiquitania: guía ilustrada. Santa Cruz de la Sierra, Bolivia: Museo de Historia Natural Noel Kempff Mercado/ Fundación para la Conservación del bosque Chiquitano. 

Montaño, M. E. (1996). La explotación de miel silvestre y su imporatancia en la comunidad indígena Sirionó de Ibiato en el Beni, Bolivia (Tesis). Universidad Autónoma Grabriel René Moreno. Santa Cruz de la Sierra. Bolivia.

Moure, J. S. (1950). Notas sobre algunos Meliponine bolivianos (Hymenoptera, Apoidea). Dusenia, 1, 70–80.

Moure, J. S. (1963). Sobre a identidade dos meliponinos descritos por Spinola em 1853 (Hymenoptera, Apoidea). Anais da Academia Brasileira de Ciencias, 35, 257–269.

Moure, J. S., Urban, D. y Melo, G. A. R. (2007). Catalogue of bees (Hymenoptera, Apoidea) in the Neotropical Region. Sociedade Brasileira de Entomologia, Curitiba, Brasil.

Myers, N., Mittermeier, R. A., Mittermeier, C. G., da Fonseca, G. A. y Kent, J. (2000). Biodiversity hotspots for conservation priorities. Nature, 403, 853–858. https://doi.org/10.1038/35002501

Nates-Parra, G. (2001). Las abejas sin aguijón (Hymenoptera: Apidae: Meliponini) de Colombia. Biota Colombiana, 2, 233–248.

Nates-Parra, G. y Rosso-Londoño, J. M. (2013). Diversity of stingless bees (Hymenoptera:Meliponini) used in Meliponiculture in Colombia. Acta Biológica Colombiana, 18, 415–426.

Nogueira, D. S. (2016). Sistemática de Scaura Schwarz, 1938 (Hymenoptera: Apidae, Meliponini), com notas biológicas (Tesis de maestría). Instituto Nacional de Pesquisas da Amazônia. Manaus, Brasil.

Nogueira, D. S. (2023). Overview of stingless bees in Brazil (Hymenoptera: Apidae: Meliponini). EntomoBrasilis, 16, 1–13. https://doi.org/10.12741/ebrasilis.v16.e1041

Paredes, E., Callisaya, C., Rodriguez, J. y Tem, S. (2022). Guía básica de meliponicultura: Área Protegida Municipal Ibare Mamoré, WWF-UABJB, Trinidad, Bolivia.

PASOS. (2015). Antecedentes. Fundación Participación y Sostenibilidad. Recuperado el 12 julio, 2022 de: http://pasosbolivia.org/index.php?option=com_content&view=section&layout=blog&id=4&Itemid=53 

Pauly, A., Pedro, S. R. M., Rasmussen, C. y Roubik, D. W. (2013). Stingless bees (Hymenoptera: Apoidea: Meliponini) of French Guiana. EnP. Vit, S. R. M. Pedro y D. W. Roubik (Eds.), Pot-honey: a legacy of stingless bees (pp. 87–97). New York: Springer. https://doi.org/10.1007/978-1-4614-4960-7_5

Pedro, S. R. M. (2014). The stingless bee fauna in Brazil (Hymenoptera: Apidae). Sociobiology, 61, 348–354. https://doi.org/10.13102/sociobiology.v61i4.348-354

Pedro, S. R. M. y Camargo, J. M. F. (2003). Meliponini neotropicais: o gênero Partamona Schwarz, 1939 (Hymenoptera, Apidae). Revista Brasileira de Entomologia, 47, 1–117. https://doi.org/10.1590/S0085-56262003000500001

Pedro, S. R. M. y Camargo, J. M. F. (2009). Neotropical Meliponini: the genus Leurotrigona Moure — two new species (Hymenoptera: Apidae, Apinae). Zootaxa, 44, 37–54. https://doi.org/10.11646/zootaxa.1983.1.2

Pedro, S. R. M. y Camargo, J. M. F. (2013). Stingless bees from Venezuela. EnP. Vit, S. R. M. Pedro y D. W. Roubik (Eds.), Pot-honey: a legacy of stingless bees (pp. 73–86). New York: Springer. https://doi.org/10.1007/978-1-4614-4960-7_4

PPD/PNUD (Programa de Pequeñas Donaciones / Programa de las Naciones Unidas para el Desarrollo). (2013). Evaluando la biodiversidad en el ANMI El Palmar: identificación, caracterización y opciones de manejo recursos de flora y abejas nativas con potencial melífero para seis comunidades del área protegida. GEF Small Grants Programme, Global Environment Facility (GEF) – United Nations Development Programme (UNDP). Recuperado el 29 noviembre, 2022 de: https://sgp.undp.org/spacial-itemid-projects-landing-page/spacial-itemid-project-search-results/spacial-itemid-project-detailpage.html?view=projectdetail&id=20488 

QGIS (Geographic Information System). (2020). Geospatial Foundation. QGIS Association. Recuperado el 07 octubre, 2020 de: http://www.qgis.org 

Rasmussen, C. y Delgado, C. (2019). Abejas sin sguijón (Apidae: Meliponini) en Loreto. Instituto de Investigaciones de la Amazonia Peruana, Iquitos, Perú.

Rasmussen, C. y Castillo, P. S. (2003). Estudio preliminar de la meliponicultura o apicultura silvestre en el Perú (Hymenoptera: Apidae, Meliponini). Revista Peruana de Entomologia, 43, 159–164.

Rasmussen, C. y González. V. H. (2017). The neotropical stingless bee genus Nannotrigona Cockerell (Hymenoptera: Apidae: Meliponini): an illustrated key, notes on the types, and designation of lectotypes. Zootaxa, 4299, 191–220. https://doi.org/10.11646/zootaxa.4299.2.2

Ribeiro, C. F. (2021). Estudo taxonômico de Trigona Jurine, 1807 (Hymenoptera: Apidae: Meliponini) na Amazônia Brasileira (Tesis de maestría). Instituto Nacional de Pesquisas da Amazônia. Manaus, Brasil.

Rocha-Ortega, M., Rodriguez, P. y Córdoba-Aguilar, A. (2021). Geographical, temporal and taxonomic biases in insect GBIF data on biodiversity and extinction. Ecological Entomology, 46, 718–728. https://doi.org/10.1111/een.13027

Schwarz, H. F. (1932). The genus Melipona the type genus of the Meliponidae or stingless bees. Bulletin of the American Museum of Natural History, 63, 231–460.

Schwarz, H. F. (1948). Stingless bees (Meliponidae) of the Western Hemisphere: Lestrimelitta and the following subgenera of Trigona : Trigona, Paratrigona, Schwarziana, Parapartamona, Cephalotrigona, Oxytrigona, Scaura, and Mourella. Biogeography and Taxonomy of Honeybees, 90, 1–546. https://doi.org/10.1086/396840 

Slaa, E. J., Sánchez Chaves, L. A., Malagodi-Braga, K. S. y Hofstede F. E. (2006). Stingless bees in applied pollination: Practice and perspectives. Apidologie, 37, 293–315. https://doi.org/10.1051/apido:2006022

Stearman, A. M. L., Stierlin, E., Sigman, M. E., Roubik, D. W. y Dorrien, D. (2008). Stradivarius in the jungle: traditional knowledge and the use of ‘black beeswax’ among the Yuquí of the Bolivian Amazon. Human Ecology, 36, 149–159. https://doi.org/10.1007/s10745-007-9153-2

Tejada, R. B. (2006). Experiencias en la crianza de abejas nativas en dos comunidades Tacanas. Wildlife Conservatión Society, Murillo, Bolivia.

Townsend, W. R. (2016). Densidad y patrón de distribución de las colmenas de abejas nativas (Meliponini) en Potrerillo del Guendá, Porongo, Santa Cruz. Boletín Tesape Arandu, 6, 2–17.

Townsend, W. R., Adler, M., Martínez, M., Cuellar, W., Rodriguez, F., Cuellar, P. et al. (2021). Explorando la relación de las abejas sin aguijón y plantas en los TCOs Sirionó y Lomerío: guía ilustrada. Museo de Historia Natural Noel Kempff – UAGRM & Fundación Noel Kempff, Santa Cruz de la Sierra, Bolivia.

Urquizo, O. N., Cardozo-Alarcón, F., Adler, M., Lozano, R., Calcina-Mamani, S., Collao-Alvarado, K. et al. (2022). Pollen preference patterns by Tetragonisca angustula (Apidae: Meliponini) in a Boliviano–Tucumano Forest. Neotropical Entomology, 51, 649–659. https://doi.org/10.
1007/s13744-022-00986-3

Vit, P., Pedro, S. R. M., Maza, F., Meléndez Ramírez, V. y Frisone, V. (2018). Diversity of stingless bees in Ecuador, pot-pollen standards, and Meliponiculture fostering a living museum Meliponini of the world. En P. Vit, S. R. M. Pedro y D. W. Roubik (Eds.), Pot-Pollen in stingless bee Melittology (pp. 207–227). Rio de Janeiro: Springer International Publishing. https://doi.org/10.1007/978-3-319-61839-5_15

Wille, A. (1960). A new species of stingless bee (Meliponini) from Bolivia. Revista de Biología Tropical, 8, 219–223. https://doi.org/10.15517/rev.biol.trop.1960.30214 

Wille, A. (1962). A revision of the subgenus Nogueirapis: an archaic group of stingless bees (Hymenoptera: Apidae). Journal of the New York Entomological Society, 70, 218–234.

Wille, A. (1965). A new species of stingless bee (Meliponini) from Costa Rica. Revista de Biología Tropical, 13, 3. https://doi.org/10.15517/rev.biol.trop.1965.28774 

Wille, A. (1979). Phylogeny and relationships among the genera and subgenera of the stingless bees (Meliponinae) of the world. Revista de Biología Tropical/International Journal of Tropical Biology and Conservation, 7, 241–277.